Echinops_telfairi Locus Mono:582:SNORA41
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:582:SNORA41
Echinops_telfairi
Mono:582:SNORA41
GeneScaffold_561
SNORA41
1001..1135
2135
TCTCTTTCTGTCTTCATCCCAGATCAAAGAATCCCGAGTTAGGATCTGGATGAAAGATA
AGCCCCTGAATTGTCGATGGGCACACCCCACACACTGACCCAGCATCTGAACTTGCTTAA
CAGGGAGCCGGGGCTAAACTGCTTCACCCTGCCTGAGAACCAGGGAGCACTGCATTTCTC
CACAGGGTGGAGGAGAAGAGGCAGCATAAACCAAGCCTGGGACACCTCCCTCCCGTCTAG
GTGCACTCATTCTCCTGTTGCAAAAGACGGCAAGGAAGCGAAGCCAACTGCTACCAGTCT
GCTGCTGCTGGAGTCTTACGTATTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGGGTACTCCCCCCCCTTTTTTTCCCCCTTCTCTTCCCCCATTCTCCCTCTCTT
CTACCCTTGAATTTTTAGAAGGGTAGGGGATGTGTAACATTTCAAAAGCTAGGTTGGTAA
ACATGTTCAAGTGAGCTTTAAAATTTGAGTTTCAAATGTACATCAGGAGCAGATGGGGAG
GGCCTTTTCTAAAAAATCAAATTGGATTTTCTGTGTGTATGGTCATTCTGTAAATACTTT
TGGGGTTTTTCATTTTTTTTGAAAGACAAAATCCTGTTTTGTGGGATTTTCCCCCCCAAA
ACATTGCAAATTAACTTATTTACATTCAAATAAATTTCTTTGATAAAAAGTAACATGCCT
ATGTGTGATATATACTTAACCTATGAATAACTTTTACTTGCTTCCACAGCTACTGGTCTG
CAGCTGTTTTTCTGCTATTTTCTGTGGCATTCTGTGGGAAAGAAAGTGTTACCCAATGTA
ACATCCCTCTTTCCCAGCAAAATGGAAAGTTGGGCATATGTGTGTGACAGACACAGAAAA
CAAAAAAAACGTTTTACTTGCGATTCACCTTTTTAGAAATCCAGTAAAAAGCCTTTCTTA
AGTAGCAATGGAAATCAATCAGCCCTAGTATTTGGAATAGACAATTAAAAGGCATGAGAA
ACATATTTCTCTGGTTGTGCCAGTCCTAACTTTCCTTAGTCATTAGTCACCAAATTCTTA
GTGGTTCTTCATGGGGGGGAAAAAGTTAGTTGATGTAACTGAATTAGAAGGCTGTTCTTA
CTGTCTCAAGTGAACCTGTAACATTAAAAGTATTGGGACAGGAGAATGTTATCTCTGCTG
TTGGGTACTGTGAAACCATCCAGACTCAGCCACTCAATGTACAGCAGAATGAAACTGCCT
GATCTTTACATCCTCACAGTCACTCTGTCCATCTCACTGAGGATCTTCCTCTTTTTTCAT
GAACTCTACCAAGCAAGATGTCCTTTCTCAGGGCTTGAGAATGAGTTTATGAGGCTATTG
TTCTTAAGATGCCCATGCTAGGATTGATTTTAAAAAAAAAAGGTTTCTGATGCTAAGGAG
TTGGGTAAGAATACATCAGTGAAAATAAAGCAATTCTCAGCTCTTCAGTGCTGGTTGCGC
TTAATTATTTCAACAGACATAAGTCAGTCAGCGCTAATTAAAAAGGGTGTGAAGACTACT
GCTTTGGTAGCATACAATTAAGTGCAGTAGTACTCCCAAGACTTCTGGAATTTATGGCAG
TTTTTATTACTTCATCTTTGGGATAGCATTTTGTAGTTTGCTACTGTTTGGAGGGCAAGC
CCCCATCAGACTGTTTACTAATTTGTGGAGCTTCGATCATAAATTCTGACTATGTTGGCC
TGAGCCGCTCAATATGAGAGGCTGGCTATCTTCTACAGACAAAGCCAAGAAGGCTGTGTA
CGTCGGTTTCCGCTCAGGAAACGCCCCCGCCTACTCTCCAGGACACGCTTGTTTCTCCCG
CCAAAGTGGCGTCAAGATCAGGTCCTCATCAAACAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved