Echinops_telfairi Locus Mono:59:SNORA79
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:59:SNORA79
Echinops_telfairi
Mono:59:SNORA79
scaffold_165156
SNORA79
1001..1137
1638
TTTAAGTCCTTTTTTTTTTTTTAATCTTCTGAGCCATACCTCGCCTATCCTACCATTGG
GATATATGTGTCTTATATAATGTTTATTAAAATGCATCATACCTAACAGAAGTTTTTAGG
GATCCAGCACGCATTTCATTAGCGAAAAACGTTTTATTGGGGGGGGCTTCAGAAAGTTTA
TGAAACGATTTCATTACCTTTTCATTTCATTTTCCACTAACTTTTTGAAGCCCCCCTCAT
TTGCAAAATCGTACAAACAATTCAGTAACAAAAGGGTTAACTCTAACATTTAGTAACAGA
CCTTGCCAAATCTATTGCATTTCTAGAGTATGTTGACACTAGCAATACTCAGGTGAAATA
AAAGTTCCAACTTTTATGGAGCTTATAGTCTAGTGAGACTAAACAACTGATATCAAGGAG
TTCAAGAAGAAAGAGTTTTGAAACTGATGTGGTAGCAGTTGTACAATACTGCTTGATGTG
ATTGAACTATGGAATGTTACGGAATCTGTAAGAGCTCCTAACAAAATGATTAAATAAAAT
CAGTGATAAATGCTACACAATTGAATTGAAATAATGATGTGGTAGAGAATGAGGGATAGC
TAGAGTAGACTGGCAGAACAGGGAGTACCTCTCTGAGAGTCTGGTTTTTAAAGCATAAGG
ATGAAGACCAATTGATGAAGGATTTCAGTCGGAGGAAGTAGTTATTCAGTTTATCTAAGA
AGGATTGAAATTTGGTGTATTGGAGGAACAAGAAAGGCCAATATGGTTTAAACATCGTCA
GTGAAGGGGAGAGAAGGGCAGGCTGAGGAATGCAGAAGTTGGATGATCGTGAGATTTGAA
AACTAGGGCAGTTTGTTACCTTTGGTGATTTTAAAGCTGAGGTATAATAAGAGTTGACGT
GAATAGTCTGGTTGTTGGATGGAAATGGTGGGAGGAGGGCCACGATGGAAGGCAAGCTTT
AGTTTAGAGGGATTTCTGTTCTTAGAAAACACCAGGCTCATTGATGACTGTTCCTCCTAT
TGCCTTCAGACCTGGCACTAGGGTTTTAGGGCATCATAAATAAAAAATTGATTTTCTTCA
CTCATAGGATAATGGGTTTTATCTGACTAGTCTCTGAAATTTGCGGAATCAAACAGCTCC
TTTCAAAAAAAAAAAAAAAAAGAAAAGAAAACATCAGGCTCTTGCACCAAGTCAAGAGTT
GATGGTGACTTAGAGGACCTACAGTAATGGTACAGAAGAGAACGTTTCCTTTGGAAATGA
AGTTATCAGCACTTGGGAGCAGCTGAGGGGAGTAAAGCAAAGAGAGGAATCGTGGATTAC
CTGTAGGTTTTTTATTATAGCAACTAGGTGGATAAATAATGCTGTATATGGAGTTGGTGA
GACTGTAGCAGACATATTTGTCAAGCATTGCTCTTTTGGTCTTGTCTTCTTTGAGATGTC
CATCAGACAGTTAAATGAAATGAGACAGACAGCTGGATAGATGAGCCTAGAGAGGTCCCA
CTTGGGAGAACTCTGGACTGGAATTGTAGAGTTGGAAATCAACATGTAGATAGAAATTGA
CACCATATAATTCAATAAGTTACCTAGGGGTGGTTTGGCTCCACAAAAGGAAGTAGCATT
AGCATTAAGTGAGGTAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved