Echinops_telfairi Locus Mono:229:SNORA42
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:229:SNORA42
Echinops_telfairi
Mono:229:SNORA42
scaffold_286066
SNORA42
1001..1134
2134
ACTTGCACTGGGTAAATCTGCTGCACAAGACCTCTGAAAAACAGGGCAATTACTCTAAG
TTCTTAACCTGGGGGTCATGACCCCTTTCAGGGTGGAACCACCCTTTCATAGAGGTTGCC
AGATTCATAATAGTAGCAAAATTACAGTTATGAAGTAGCAACAAAAATAATTTTATGGTG
GTGGGGGGGGATCACCACAATATGAGGAACTGTATTAAAATGTCGCGGCATTAGGAAGGT
TGAGAACCACTGCTCTAAGGAGTAAGGTATGCCTGACCCAGGCCATGGTATTTTTAATTG
GGAAAAGTTGGGCATTGAATAAGGAAAACTAAATAAGAATCTATGCATTTGAATTATGCT
GCTGGCAAAGAATATTGAAAATACTATGAGCTGCCAAAAGAACAAATAAATCAGTCTTGG
AAAAAGTACACCAGAATACTCTTTAGAGACAAGGATGGTGAGGATTCACCTGAGATATTT
CTGACATGTTGTCAAGAGAGATTAATTCCTGGAGAAAGACATTCTGCTTGGTAACGTAGA
AGAGTAGTGAAAAAAGAGGAAGGCCTACAGCAAGAATGATGAACACAATGGCTTAAACAA
TAGGTTCAAGCACAGGAACAATCGTGAGGATTGTGCTGGAATGAGCAGTGTTTTGTTCTG
TTGTGCATAGAGATGCTATTGATCAGAACCAACCTGATGGACTCTAACAATAACAGCAAC
AACAATATAGGTACCACCACGTATTATTATGTGAACTATGTAGAGGTCATATTTGACCTA
CACAAAGTAGCAGTAGAATCTCACTCCTCACCTATTGTCATCAGGCAGAAATCAATCATG
ACTGCAGCATCTGTCTTTCTTTACCCTCCTCTGACACTGAACATGGCCCCTACCAACACT
CTACTTCTCTACTGAGTTTGATAGTTCATTGCAATAGCCGCACAGAATTCACAGAAAATA
CTGTTGATTAAGGGAGTTGATTACAAAAATTAACAAGTTGTGCATCAGTTTGGATTTGTG
GCAGGTCCGATACCACGGGCCTCTCACAGTGTCTCATGCCAAAGCAAACTGTCACCCTAA
ACCATTGTCTGGCTTTATCTGGTGGCTTTAAGGCACTGAAGCATGTTGCACAGTGAAAAA
AAAAAAAAAAAAAACTAACAAGTTACCTCAAAACTGATTAGAAAACATTAAGGATCCAGT
CATTGCTGCCCAGCAACATCTCTCCTGAGCCAGCATCCAAGGCCCTTTTCATCCTCAGCC
TCTACTTCCGTGGCCTGGAAAACCAGCTCACTACTCTGCCTCATAGTCTCTTAGTCTTAG
CTCTGCCCCTGGTTTCCATGCTACAGTCTCTGGTGCCTCGGGATTCAGTCTTCGTCCATC
AGACAGAAATCTCAAACCAAAGGGCTCCAATGGTTGCTTTTCTTCACTCATGGTCCCAGG
GATTCTCCGTCTCTGCTTTAAAGAGGACTATTACATACATTGAAAGAGCGTTACTGGAAG
TTTATTTTGTTATTGTTTTTTGAATGGATCATATCTCCAAGGAAACAGAGTGGGGTGGCT
TGGTCCACATCCTCTAGTATGGTAGAGAAACTATATGCGACCTGAATCCTGTCCATCAGC
ACAACAAAGAACTTCCCAAACAAGATTGTAACCATAGGCATAGAGGCTAGAATTCATATT
ATATTATGTAAGAAATTGTTGGCAAAATGGTCATATTAATTGACTACATCTCACATGGTA
TATGGGTACATGCTGTTGTTAGTTGCCATTGACTCATTTCAGACCCAGGGTGACCCTATA
CATGTTAGAATGAAACATTGCATGGTCCTCTACCATACAATTGTTCCAGTGCTGTACCCA
TTATCACAGCCAGGGTGTCAATCCATCTCTCTAAGAGCCTTCTTCTTTTTCTCTGCCCTT
CACTTTACCAAGAGTGATGACCTTTTCCAAGGGCTGCCCCTTCACTTTACCAAACCTGAT
GACCTTTTCCATTGTCTCTCCTGACAATGTGTCCAAAGTATATAAGACAAAGTCTTACCA
TCCTTGTCTCTAAGGATTAGTATATATATTTAGTTATTAAATATTTTAAAATAGAAAAAA
TATAAATTTAGTTTCTTGCTTAGTATATATAGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved