Echinops_telfairi Locus Mono:366:SNORA40
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:366:SNORA40
Echinops_telfairi
Mono:366:SNORA40
scaffold_278302
SNORA40
1001..1123
2123
TGGTGGAGTCGCAGGGTTTGATTTGGGCTGCTAAGCAGAAAACAAGCTCAATGATTTGA
GACCACCAGCCACGTGTCAACCCATCTTGTTGACGGCCTTCCTGTTGGGAAGAGGAGGCT
TCCTATTCCGGTAAGCAGTTACTTATAGAGAAGAACACGTCCAATTTCACAGCCACCCCA
GGTACCCTTCTGAACCATATGACCTAGGTATTCTTCCCAAGAACCCAAAAGGGAAGAACT
CACATAAAATCCTTTTGCAGGCTTCAGGGACTATTCCTAAACTTGCCTACTTTTCAAGAA
CATTATTAAATAGGATAGTCCCTTTTCATATTTAGGTAGGGCAGTGGTTTTCCAACTGGC
AGTGAGGGTGTCGTATCCAGAGTGTATTGGAGCTTAAATTCTGAGCACTCTGGTTTGAAA
ATGGCTATGAATGTCAGGGGCAGCCCAGAATTCCTTTTCAGGGTCCCCAAATAGAGTACA
CCTCCACTGATTTTTTTTCTGATCATTAATCAAGGATGTAAGTGGTCTGTGTGCCTTAGA
AAGTAGAAACCACTACCCCGCCTTCTCCAGGCAGCCCAGGGAGGGCAGTCTCTCTCTTGG
GGGGCTTATCTGGATGTGTTCTTGATGGATGTCACCATTCTGGGGACACGACAGTCATGG
GGTTGAATAGTCATGAGTCATGCCACATCAGTCTCGTCCAACCTGCCTTGGTCAAAGGAC
CCTGGATCCATCTTATAAGCCTTTCTATCTAACAATGTGTCCTAATCATGGTCCCGATTC
TGCATGTGAAGTCCCACTTAAAACTGAGGTATGGATCGGCCATCAGTCATGAATTTGTGA
CCGTTTCCTTTGTTCCATACGCTGTTTATCTAGCTCCCTCAGATGCCATTTTTACCTCAG
GCTAATGCCCTCCCTCATCCTCATTGTGTGGCGATGTCTTTGTGTTCCTCATCTCTATTA
AGACAGAAAAGTACCATGGACTGTGGAAAGGACACAATGACTGCACTTGTGTTTGTGTTT
GTTTAATTAGCGGACACCCAAAGACAGGTGCAAGAATAAATCCTCTTTTGTAACCCAAAA
CTCATGGTCCAGTATGAGTTTTGATACAGATGAGAAGGGACATGTCAGAAAATAAAAAAA
AGGACACAACAATCTGTCTATGGACAGAGTGATCCTTAAGGGCAAGGATGGTAGACATAG
TGTCACGAATGATCAGTCCTGAAGAAAGACATCTGCTTGGTAAAGTGGAGGGGCAGTGAA
AAAGAGGAAGGATCTCAAGGAGAAGGGCTGGCATCAGGGCTGCCACAATGGGTTCAAGGA
TAGGAACAAGCGCAAGGGTGTCGCAGGACCAGGGAGTGGTTCGTTCTGCAGCGCATAGAG
CCTCTGTGGTTCAGAACCAATTGGATAACACCTAACAAGTGTTCTCTACATTATATTGGA
GATGACGTCTCTTTTGTACCCTGAAACAAGAGACATCTTTGATTGCCATTGTTTGGGGGG
AAGATATGCTCCTGGTGTCCAGTGGATAAAGGACAGGGATTCTGCTATATATCCAAAAAT
GTCCAGGACAGTCCCTGACCACAAACAACTCAAAACCCAACCTCACTGGCATTGAGTCAG
TTCTAATATCTAGGAACCCTATCAGACAGGGTAGAACTAGCCCCTGTGGGTTTCCCATAC
AATAACTCTTTAAGGTAGTAGAAAGCCTCCCCATGGAGCAGTTGGTAGTTCAGAACTTCT
GGCCTTGTGATTAATAGACTATTACACCACCAGGGCTACCTACAAAGAACTACCAGCCCC
AATTATCAGTGTTTCTGAGGTTGGGAACCCCTGACGCAATGTCTAGACTTTCCAAAGCCT
TCCCTATCTATTAGGTCAGAAGAATCTAGTTTTTTGAGAGTCACCGAAAAGAAAAGTATT
CCTCAGTTAATTTAGAAAGGATTTATGGAGTCCCTGGTATGTATAAAGTTCTGTGTTGGG
GACATTTCATAATGGAACCTTGTGTGCCAATACTTGTATTTGACCTGTGAGTTAGGAGCA
AGGCTGGGTAAGAGGGCAACAGATAGCAGACCACAAACTATGTGAAGAGTTATATGCCTC
GATGAAACATACAACTGTCCTCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved