Echinops_telfairi Locus Mono:262:SNORA70
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:262:SNORA70
Echinops_telfairi
Mono:262:SNORA70
scaffold_321189
SNORA70
1001..1145
2145
TTATCTGTCCTGAATTCCAGGTGTTCAGGGGCTCTAATCTGTACCAATGTGTGTTTTCT
GGGTCTAGCCAGATTTGTAATGTAGAACTGGGTCATGGTAGTGGGGGGAGGGTTGGGGGG
AGGGAAGCATTTCAGGAACTAGAAGGAATGATGTGTGATTTGTCGGTAAGGAACTCAATT
CTTCCAATCAGCATGTGAACACAGAAGAGGGACTCTCACCACCCGAAAGGAATACAATCG
AGCCAACACTTTGTGTTCCACCTTTATGAAAATTCTGAGCTAAAAAACTAAGCAAGAACG
ATGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGTGTTGGCTATAAATTCAATGTTGCCCCCAAAAACCCAAGTAGC
TATAACATCTGCTCTCGCTCTACAAATTTTAGAGACATGGGACGTATTTACACCAGAAAA
TAGAAAAAATATGCTACAAACAAATTATTCCTCTACATTTGTTGCAGACTCTTAAGATCA
CACTGGCCTTTCCCATGGTGTGAGGTGGGATAGTGTGCAATGGCTATGAATAACAGCCTC
CTCGGTAGTGTATGTAACCTGTTGGCATGTATTAGCTGCGCCAAGTAGGAGACCTTGGAG
ACAGCCCTTTGTTGCTCTTTGATGGCTCTTGCCTGGCTACTTTTTGCTATCCTGAAAATA
GGCTCCAAACTGGGCTAAGAGGTGCTTTTGAGAAACCCCAGCGTTATGGTGGCTAGGGTC
CATATTGGCCAGGTCATGTTCATCTGCACCAAACTTCAAAACAAGGAACATATGATGGAG
GCCTTATGCAGGGCCAAATTCAAGTCCGTTCAGTGCCAAAAGACCCACATATCTCCAAGA
AGTGGGGCTTCAACAAGTTTAATGCTGATGAATTTGAGGACATGGTGGCTGAGAAATGCC
TCATCCCAGATGGCTGTGGAGTCAACTATATCCCCAATCATGGCCCCTGAGACAAGTGGA
GGGCCATGCATTCAGGAGGGAGCTTCCTGACTCAAAAAAAAAGAATCAAGGATAATGTTA
TCAGCACAAAGAACGTCCCTCATGTATCAGTTTTACTAACATTTCAATTGACTGGGAAAA
GAAGGTTCCACTTAGTCAAAAATATTTCATTAGCTATCTCTAAATATAATATGCCTTAAG
CAGTCTAATGGACACAAAGCAAGAGCAGAGGTGCTCCTGGTTTACTTTCGTTTGCGTCAG
GACTATGTTTCTTACTTACGTATTGCTCATCTTACATATGCACGAGCGAACCCTTTTGCA
AAAAGCATGGGCTGAGGAAGGAGTGTCCACTTCTATGAACAGGTGTTTCAGCTCGCCCTG
TCACACTTCATGTCGCAGCAAGGAATTGTTTCAAGCTGACTCGTTTTCCTCACACAGACT
CCTTGCTCCCATCAGATGATTGCATCAGCCATCTATGTGATCGAGGAAGTTAGAGTTTCT
CAAGATTCGAAGATTGCCTCTTACAATATAGCTGAAGAATTCATTGGGGTGAGGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCCATCTCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved