Echinops_telfairi Locus Mono:294:SNORA63
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:294:SNORA63
Echinops_telfairi
Mono:294:SNORA63
scaffold_288007
SNORA63
1001..1132
2132
ATTGAGATACTTGGTCTGCAGCCATCCACGTGTCACAGAGACATATTTTATTTGGAATA
AGCCTGCACGTATGAGAACTAGAACGCTAATAACAATACTTTTTTTACTTATCCTCATAT
TTTCATTTCATGTGCTAGCTATAGGTGTCATCACTTTCAATATTTCTATCATCTGACTGT
TATAAGATATAACTCACAACTTTACTGTTTTGCCATGTGTTCATATTTCCATATTTAATT
TTTGGTAATGCTGTTTTTAGGTGCTGTCGAGTCAGTTCTGACACATAGTACGAGAGAACA
CGAAACTGCCTGGTCTTGCGCCATTCTCACAGTTGTTCTTANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTGGTTTAGTATTCCCCT
ATCCCAATATCTCACCTTTCACATGCCATATGTCCAAATATACACAAACCTCTGTCCTCA
CCCCACAGATCCTAGATCAACGTTCCAGAACCATTGTTTTACATCCCTCACATTATGTCC
ACATTTCCCATTATTTCTTTTATAGTTATTTTATCTCCATTTACTTAATCCTCCCCTAAC
CCTTCTCATATATGCTTTAAAATATCTGTTGACTCTTTGGCCCTACATAGATAAAATTTT
AAAAAATAAATAAATGCTCAAGAGCAATAATTTTCCTCCTTGGGCTAAACTGTTATTAAG
TTTAAAGGTGACTTTAGGGGATAATTTCAATTTCATGTGTGATGAGATATTCAGGGTCAT
GGATTAAGGACCAGTAAATCTGTATTCCTTAAGAATTTGGACAGCAGGATTTAGACTGCA
ATATAGCTGTTTAGTGCTATTTTTCATTCCCCCTGCTCAAAGTACAGCTGTTTCTTATCT
ATCCCTGTCTGCTAGTCTCTTGTAGCAGCCCAGGGACTCTTGGTCTCAAACATACTGGAA
AAAAAAAAAAAGAATTTGGAATCATTTTCCTCCAATTTTTTCAGTATTTCTCTATTATGT
TCATGACCATAGGGTTCCCTAGTGATAGCTGGGCACCATCTAGTTCTTCTAATATCAAGA
TTGAAGAGACAGTATTTTAAGTAAACAATTAGTATTGTTCCTTCTGAGTGTATGGTTTTC
TCCTTTCTCATTTGTCCAGATGAATAAAGATCAATAGTTATTTTAGATGGTCTTTCATAA
GCACTTAAGACTCTAGATATTATTCGTCATACTTGGAGGTAGAATATAAACTTTAAGAAT
GACATCATGTCAAATTGACTGAATTTTCCCATGAAGCCATAGCCCTAAATATTCAAGTCA
AAAAAAAAAAATCCCATGAGTGATTTGTTACATCTAATTGCTACTGGCATCAGTTATATC
AGTCATGCTGCATAAACTTCATCCATATTTGGTACCATTTTTCTTATTTCTATAAAGAAA
AACGTGACTACTACATAGAAAGTACTTCCCCCTCCTACTCCCTGCCACACTTGGTAACCA
CTATGTTTACCTACTCATGCAATTTCATAAAATTGAGAAGATGTGACTGATCTGTTTCAT
TCAACATAATGTCCTCCAGGTTCATCCATATTGTAAGATGTTCAAGAACCCATTTTTCTT
CATCTCTAAGTAGTATTCCATTGTATGTAAGTATCAAATTGTATTTAGCCATTTATCTGT
TGGTGGATAGTTAGATTATTTCCATGTTATTAATATTATGAATAATACTGCAGTGAACAT
AGATGTGGCTATGTCTTTGTGTGTCACTTCCATTACATCCCTAATGTATATCTAGGAGCA
AAATTGCTTGGTCATATGATAGCTCTGCCTTTAGTTTTGGGGGGTTGTTTTCTGTAACAG
CCATACTATTTTCTATGACAGCTGTATCATTGTGTATTTCTATCAGCCCTGGATGAGGGC
TCCAAATTTTTCACACCTCCTCCAACACTTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved