Echinops_telfairi Locus Mono:102:SNORA65
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:102:SNORA65
Echinops_telfairi
Mono:102:SNORA65
scaffold_21213
SNORA65
1001..1126
1261
GAGTCCTTGGCCTATTGGCTCCTTAGCCATGATAGAGTGCCCTTCCTGTGCCTTATGGT
GGAATTTGATATAGAGGTTATTTACCAGAGATATTACTGCTCTTGTTCTTCTTGGTTACT
GTGTGCTTAATATATTTATTTCATTCTTTAATTTTTATCCTATTTATACTTTGTATCTAA
GGTGTGTTCCGTTGTAGGTGGCACAGTTTTTGTTTTTTAAAGGCTAGTCTGCCACTCTCT
TTACTGGTGCATTTTAATTAATTTGCATTTAGCATGATTATAGTTAGAAATTTACCGATT
TTGTGTTGTTTTACTTATGTGTGTGTGTGCATGCTGTTGACAGTTTCTTTGTTCTACTTC
AATCTCTATTGTGTTCTTTTTGTTAATGGATTGTCCTTTCATTTTTATTTACTCTTTTTG
TTTACTGAAACTTTAAAATTTTCTTCTTCCTTTTCATAACTGTTTATTAATTCTCTTTTA
TCTTCCTAAGTTTAAAACAGTCTGATACTTTTTGATATCGCCTTGACTTTCTCTTCTTAT
GGAAGTTGTATCCCTGACTGTTTGTGCCCTTTTTCTTGTTGAAGGTGCTGTTGGTACATA
TTGACACTTCTATTTCCCTCTTTTCATTTCTGTAGTTCTATTTGACTTTAAAAAATCTAT
TACCTAGCTTAGTTGCGTATTTTATTTATTTATTTGGCCCTTAAAAAAAAACAAAGCACA
CACAAACATTTTATTAGGACATAATCCAGACACCATATTCATTCAATGGTTCAGTCATAT
GAAGAAGTGTTGTACAATCGCTACCACAATCAGTTTCAAAACCCTTTATTCCTTCTTGCA
CTCCTTGTTACCAGCTCCCTATTATCTCCCCACCTCCCCTGCATCACCCCAGGAACCTTT
ATTCTAGTTATTGTCTTTATAAATATTGTGAATTACCAAAAAACAGAAAAATACCTAAAG
AGAGTCAAGAAGCCTACCAACAGTAACAAAATACCCAGTCATCCACCACTGCACCTGACC
ATTCTCTGTTGCTGGTGCAATCCAGTGGTGAGCTGAGAGTAAGCCCCTGCTCAGGAAACA
GTGTTGTTCTTCATGTGGATGACTCTGCCGAAAGCATGGGGACAGTCAAGACAATAATGG
TAGACTGGGTGTGAACTGGGTAGCCTTGGGTTATGACAGCTGTTTTCTTTTCTACAAAAA
AAAGCAAAACAAAAAACAATAACAAAATACAACAGAGATAAAACCCAGTAAAAAAAAACA
CC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved