Drosophila_melanogaster Locus RpS7
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpS7
Drosophila_melanogaster
RpS7
3R
snoRNA:Psi28S-2626, snoRNA:Psi18S-1377a, snoRNA:Psi18S-1377b, snoRNA:Psi18S-1377c, snoRNA:Psi18S-1377d, snoRNA:Psi18S-1377e, snoRNA:Psi28S-2149
1904..2045, 2060..2198, 2313..2450, 2485..2621, 2652..2787, 2831..2967, 3017..3160
4425
GACTGAAAAACAAGTGGCTTTATAGGCAATCAACCCACCGAAAAACGTTTACAATAATA
ATTAGACCTTAAACATATTAATTACAATATGTAAAAAAAAAGAACTCGTGTTTTTGCATT
GAAAGAGACTTAAAAAGGTTTTTTATTCAAGAGCATATTTCTTGGAATTACTAAAAACCT
CAACAAGTTACTAAGTTTTCATTCAATAGTGTTCTATAGTAATTAAGTTCTACAATTCTG
TAGGTTAAAACTCATACGGCAAATGGCACTGGAATTTACATATATTATATTATCAATATT
ATCAACTTAAAAATGTCCGTTGAAAAGATTAAATATGTCTGCGTAAATATTATCTACACA
TATATTTAAGGCAATAACTAATATTTTTTATTATGTTGTTAATAATCTCATTAAATTCCT
AATTTATGGAAATCCATTCCAAAATCCAAAATCTGTGTAATTACTTTTTTTTAAAAAACG
TTACATGTGGTAACAATTGCGCCCCCTGTGGGGCTTTAATCGCAACATAAGTGGTGATAC
TCGCCGCTGAAGCATGGTAGATAACCCTAAACGAACCTATCGATATATATTTTCAAAGAA
ACATTTTATATTGTTCATACAACAATTTTTTTAATTTTATAGGCTAACAACTTAACTTAT
TAAAAAAAAATTTTATAATAAAGTTTTTCCAAACATAAACCCATAGTGGCATACAAACTT
ATCGATGCTAACTCATAAATTCGTTATACACAATCTTTGCTGAGAACTATCGATTTTTAC
ACGCAAAACATTAAAACGCTGAAACACTTCAAAGAAATATAATCAAATTTTCTTGAATGG
ATGTTATGTTATAATGTTAAATTTTATATATTTAGCCATCCCTCGTATTTTCGACGAGTA
ATTGCTCCTGCAACTGTATCGATAGTATCGCACAACGTTCGCGCGTGTCTCATCGATAAC
AACTCGCTCTGTTTTCCACCTCTACGTCGTGGCTCGACTTCCTTTCCTGTCAAAATAGTC
GACAAAGGTGGTACTTTTTTTCTTCCGTCGCCGAAAATGGCCAAAATACGCGGTCGCCAC
AACGCAGTGCAGCGAAATAATAAGAGAAAAGGCCGCAATGATAATGGCAAATTACGATTT
TCTTGTGAATCCAGAGAAATGCTGGCGAAATAACGCCGATTGCCGGCGATTTGTGATTGT
ACTGCGTTGTGGGGAAGCGTCTGCCGCAGCGAATTTTGTGTTTGTAATTGAACCGAAAGC
TAAAATACCGGTGATGAACATTGCAGATGGCTATCGGCTCCAAGATTATCAAGCCCGGCG
GCTCGGATCCCGATGACTTCGAGAAGTCCATTGCCCAGGCGTTGGTGGAACTCGAGGCCA
ACAGCGACCTGAAGCCCTACCTGCGCGATCTGCACATCACCCGTGCCCGCGAGATCGAGT
TCGGCAGCAAGAAGGTAAACAGTATATGGCGTACATGTGGAGCCTTCAATAGTAATCCGT
AACCCACTCTGCACGCAGGCCGTCATCATCTACGTGCCCATTCCACAGCAGAAGGTGTTC
CAGAAGATCCAGATCATCCTGGTCCGCGAGCTGGAGAAGAAGTTCTCGGGCAAGCACGTC
GTCGTGATTGCGGAGCGCAAGATCCTGCCCAAGCCCACGCGCAAGGCCCGCAACCCCCTC
AAGCAGAAGCGTCCACGCTCCAGGACTCTGACCGCTGTGTACGACGCCATCCTTGAGGAT
CTGGTCTTCCCCGCCGAGATTGTGGGCAAGCGCATCCGCGTCAAGCTGGACGGCTCCCAG
CTGGTCAAGGTGCACCTGGACAAGAACCAGCAGACCACCATTGAACACAAAGTAAGCATA
AGCATCCTCCACCTCAAAGAAGAGTGCATCGTGTGTGTTAGCAGGCGCGTACCCTCGATA
TTTGGGCCTTCCGTGCCATGGAGCTCAATCTTCGCCAGGGGACGCAGAACAGTCAGGGCC
AATTACTCGTTATTGCAGGCATTAGAAGCCATTGCGGTCCTGCATCTCCAAATATTGGCC
ACAGTTGGTCTTTTGATACATCGTTCTTGTGTTTTTCGCTGGCTGTCCTTCCAAAGCCAG
TGATTGTCAAACAGAACGTACATTAATGGCAGCTTATCACTCCACAATGTTGAGCCGAGT
TTTCACGGTTACTGCATTACTTTCCGGCTCGCCACATCATTACACACTCAAATCGATACT
TGAAACCATTTAAACAGTAGAATGAAAAGTCAAATAAGGGGGATAACAGATGGATAGAAA
GATTATATGTTTAAATGTACATAGAACTTTCTATCGTTTTTGTGTTATTTGCTGGAAGTT
ACATCCAAAGCCAGTGATTGTCAAACAGAACGTAAATTAATGCGGCTATCACTCCACAAT
GTTGAGCCGGCTTTCCAGGGCTACTGCATTACTTTTCGGCTCGCCACACTCTCGTAGAAT
CTTTTAAATACCTTGGTTTCTACCACCGTTCTTGTGTTATTCGCTAGATCTTTTCATGGC
CTAGCGAGCGTCAAACAGAACGCAAACTGAAGCAACGAATCACTCCACAATGGTGGGTCT
ACTTTACCAGGACTGCATCATTACTAAAGGATTGCTACAGTTGAATATCCACGAGAATGC
TAATTGTGAACTCCGTTCTTGTGTTATTCGCTAAGCGATTACCTAAGCTCAGCGATTGTC
AAACAGAACGTAGATTAACTGCCGCTAATCACTCCACAATGTTGAGCCGACTCTCAACGG
CTACTGCATTACTATATGCGCCACATTCATGTCAATCAACACTTAGCCCTTGAATACTTT
GGTTTCCATCACCGTTCTTGTGTTATTTTCTGGACGTTGTTCAAGTCCAGCGATCGTCAA
ACAGAACGCAAAGTAATGCAACGAATCACTCCACAATGTTGGGTCTACTTTGCCAGGACA
GCATCATTACTTAAGGATTGCAACAGCACCTTACATTTAGAGTTACTCATCTGAAAACAC
ACACGATGCACTTTGAGTGCCGCCTATTTGCCTCTCGAGCGCCGTTTAGTTTCCTGGGGC
CTCGGGACTTCCTATATAAGCGGAAGATTAATCCAGCCTACCGTACGATATCTTCGCTGC
GGTATTTTCTGCCGCAGCGGAGGTTGCGGTGCTGTACACTGCAATAAATAAGTTAATTCC
TCTGATCGTGTAAACTAATACGTTCTCTATTTATCTCTCCAGGTCGACACCTTCACCTCG
GTCTACAAGAAGCTGACTGGTCGCGATGTTACCTTCGAATTCCCCGACAACTACCTGAAT
GTCTAGAGCGGCGGGTTCTCGTTCGAGAGTAGCACTGGTTCGCCGGTTCATCTGGGAATA
TGAGTTTTTTACATGAGCTAGAGAACGTGAATAAACATTAAACAATCTAAAACTAAGCAA
ACTTCCAATTAAGCCAACTCGCTCTCCGTTGTCCTGTAATTAATCAGCGTTAAGCGCAAA
GTTTCCTGAGTCTCGCTACATTCGTTCGAACTTTAATCCTTTGAAGGAGCAGTATCCTGC
TGGGAAGGGATGTCACATGTTGTGATTAAGGGCAGCCATAAAAGGGGTTATTACATGGCG
GAAAGCGCCATTCATTTGATGCCTGCTCAACTGCTTAATTAAAAAGTTGACGTATGTTCT
TCCAAGACTCGCACGTGTGGCGAAAGGGGTTAATCTTGTGGCTACATTTTCCACTTGGCG
CCTCCCATTTGCATACCATGTAATTATGCCTTTTGAACAATCACGTGTGATTGTTGGTGG
TAGCAACATGAAAGGGTGTGGGTTTCTTGGATTGATTCATTTTTGGAAAGAGAAAGCTTT
TCGACATGGAACACCCCATTAAAAGCTTATTAACCGCCATATTTGAATGTACTGCATGTT
CGTTCATTTGGCAAAGGCTGCTGAACGAAATCAATCTTCTAAAGAAACCCCTTGATTATA
CTTAGTTGTATATTATATGTTTAAATTAATCATTATATTCTAATTCTATTTTATTACGAT
TTAGTAACCGTAATATAGCTATGGCATTCTGCCATCCCCCTGATTTTATCAACCAATTAA
TCGATCCTTCTGCAAGAAAACCACAATAGGTTTCATTAGGGCATTAGTGCATTCCTGCTC
CGTTTAAGCTGTCCAAGTCGATTGATTGCAGTTTTGAAATTCAATTAGAAGCCACCGCGA
AATCACGCAATTCAACAATTCCGAAATGTTACACGAGCTAAGGGCAAACAATGGGAACCA
CAAATTGCTTGTGTATATTGGTGGGTTAAAGCCAAAGGACTGGCAGGACATTCACATGAA
AGTGAACACGAATGGCTTTAAGTTCGGGAGTAGAAAGACAAGACTAGTTGAGTTGAACCT
TCGATTTTCGACAATTTGTTGATGGTGTCAGGTGGGAATTCCCGGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1453, 1518..1850, 3222..3425
1286..1453, 1518..1850, 3222..3302
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved