Drosophila_melanogaster Locus RpS8
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpS8
Drosophila_melanogaster
RpS8
3R
snoRNA:Or-CD8, snoRNA:Me28S-A2564
1760..1851, 2366..2482
3763
AGGCTGGTGTGACGACGCACAATGTGTCGCATCAGATTGGAGGACGAGTGCTTCGAGGA
GAGCGTCTTGCCGCAGTGCATACATTTGGCCATGAATTCGGAGATGCGGATAAAGTGCGC
CCACAGTTTATTGTTCTTCCCAATGACCTTGTTGCGCATCTCCTCCTGGCTGTGCCGCTC
CATCTGCTCTTGTTCGAGCTTCGCGTTCATGATGCCGCGCACCGCCGACTTGGTCTCGCC
CTCTCCGAGCTCCATGCTCAGGTCCTCGGAGGCGGAGGCTTCCAGCTCGTCCTTCAGCTC
CGCCAGCATCTTACCCTCCTCGCCGGCAAAAATTGATCGGGCCAAGAGCTTGTGGTTCCG
GATTAAGTGGCGCGTCAAGTTGGAGGATGTGTGTTTGGAGGACAATGTCTTCTCGCAGTG
TTTGCACTGAACTATGTACTCGGTCAGTCGGTGGAAGTGCGCTAGAGCCTTGAAGTTTTT
CCCAACCATAGCTGCTTCCGCAAATCCGGGAGTTGCAGTTTCGCCTGCTCCTGGCCAATT
TGGTGGCAATTGTCGCGTTTATTTATCAAATTGCTTTTATTTTCGGTGCAAAATGAGGGT
GTGACCGTGTGCGCGAAGCCACAAGCTAACATTTTACCGAGCTGTTACGAACGCAAGCTG
GCCACACCTTATTCAACGGGTAATATATTTCGACAGCAGTAGTGGTATTCTCAAATGTTA
AGTTTATAATTAAATAAGTGCTCCTGTTGTATTCCAAAATACATGTCCTGATATATATCT
TAATTGTAAAGCAATATAATTAGATATTAGTAAATACAATCTACCACTATGGCTCATAAA
AATAATTGGTTTCACATTGCTTCATACATTTTTAACTAAATTTCACTGATTCCAGGTGCT
AAAAATTAATATTTGAATTAATGTAACAGCACCGAGTGTACTGTAGAGCGCGCGCTAACA
GCGCAGAGTTGCCCAACCGCGGCAACTGTCAAAAAGATAACCCTACTTTTTTGACACGAG
GTGCTGTGCGTGTCTTTTCCTTTCTTTCTCGCTTTTTACTCGAACATGGGTAAGTCGACT
CTCGCAAATTGCGTCGAAATATCAAGAAAATGGGCTCAATACGGCCTGCAAACACCATGA
AAGTGCGCACAAAGTACGTTTACAACAGCATCGAGAAAAAAGCAACGGGGAATGTGTGAA
TTTAAATAAATATCCGTGAATTTAACTTGGTGCGGCTCTTTTTAGTGCGCCCCCAAACGT
GCCCATGTTCTTGGTTTTTTTTCGACTTTTCCGTGCGCCTTGTACTAACATGGACCTATT
TCTCAATCACCAGGTATTAGCCGCGATAGTGCACACAAACGCCGGGCCACCGGAGGCAAG
CGCAAGTCGCTCCGCAAGAAGCGCAAGTTCGAGTTGGGACGCCCCGCCGCCAACACCAAG
GTAAGGATAATCTCCGGATAATCGCAATGGCGTGTATTCGAATGCCAGGGTCCAGTTTCT
CATACTCCCATTAAGTTTTATTGGTCGGTGCCGAAATGTGTGCTTGAAAACCAAGCACAT
TTTCATTGTTTTTATCTTACCATCGTGACTTGGATAGTATACACATGGTTTTTATGTCGT
ACGATTGCGATTGTTTTCAATGATCGTTATACCATGTTTTATTTTAAGAGATTGTTTACA
TGCCTATCTAAGTTTAAGTTGGAATTCACCGACAAATCTGTGAAAAGTATGAGATAATTG
GTCCTAATATACAAATGCAATGTTAAATGATGTTAACGCGTGTCAACTGCAATTGTGCTC
TCGAGTACTCTTCTTGATGATTGAAAAGCTTTATGTTCGGACTACTGATAAATATATCGT
TCCCTCCATAAGGTCTCCCGTCTGTATGCCCGGACTAACTCTTGAACTCATTTTTTCAGC
TTGGCTCCGGCCGCGTGCACAAGGTGCGCACCCGTGGTGGAAACACCAAGCTCCGTGCTC
TGCGCCTGGAAACCGGAAACTTCGCCTGGGCCTCCGAGGGAGTGGCGCGCAAGACCCGTA
TCGCCGATGTTGTGTACAACGCCTCCAACAACGAGCTGGTGCGAACCAAGACCTTGGTGA
AGAACAGCATCGTGGTCATCGATGCCACGCCCTTCCGCCAGTGGTACGAGGCTCACTACG
TGCTGCCCCTGGGACGCAAGCGTAACCCCAAGCACGCCCAGAAAGAGGACGAGAACGACG
TGCTGACCAAGAAGCGCAGCGAAAAGGTTATGAAGAAGTACCTGGAGCGCCAGAAGTACG
GCAAGGTCGAGCAGGCCCTCGAGGATCAGTTCACCTCCGGCCGCATCTTGGGTGTGTATT
CTTTCTAATTCATGATTAATGATTTTTGTTATAGTGATGTAAAAACCCTAGCGATCCAGC
TACTTTATTGTGTTGATCTTGTTTTAAGAGAGACGCAAGCCTGTTGGGTGTGATTCTGCT
TGTCATAGTTACTCTGATCAGACCACTAAACTTATACTTTTCCATTTACTGGAAGCCCCG
CTCTAATTCCCTGTTATTTTTCCTTTCAGCTTGCATTTCTTCCCGCCCCGGACAGTGCGG
TCGCTCCGACGGCTACATTTTGGAAGGCAAGGAGTTGGAATTCTACCTTAAGAAGATCAA
GTCTAAGAAATAAAGGCACTAGATAAGCTTGCAAGACATGATTTGCAAACAAAAACGGAA
TAAAACAACTTGTTTTTTATAGGAAGTGCATTTTTCTGATTTTGTTCTTTAATTTTCCTG
CTGACAAAGAAATGCAGCCCAAATAGTGGACGCTTTTGTTACCCAAATAAAGTCCAGATA
AAAGATAAGAATGTTCGTGGATAGTGGAGGGCAAAGGACTCTCCCTTAAATGTCTATTGA
ATTTTCGTTTCATAAGTATGATACAGTAATACGTAATCATTAATAATAGTTTAAATATCA
TTCATATTGGCTATAATTACATAACGCAGACAGGATGTCGAATCCCATAAAGTACAACAA
ATTCATGTTAATTTAAAACTGCCAATGACAATCTTAGAACAAACTAAAAACTGCTTTCAA
TTTTCTTCTTATACTGCTGTCAGCTAAAGTTCCTAGTGTTCGAATAGCATGGTCATCACG
GCCATTAACGCAATGCCAAATACCAGTGCTAGCAGCTGCTTAATGGACTCCTTGCGCTCC
TCCTCCTTCAAGAGATCAGGTAATACTGTGACCAGAGCAATGTGCAGAAAGCCGCCGGCG
GTGAACGGCATAATCCACGAAGTACGTGCCTCTGTAAATGTAAAGATAAGTTTGCTTGTT
TGTCACACGGAGAGCCCATTTAAGCTTACCCATGGCCGACGTTACGCCGGAGCCTCCGAT
GGCCACCAGAGCACCGAGCAGGCCAGCTCCCGCCGTGAGTAGTTGCGCACGCGCGGCGTC
CCAGCGACTGAATCCGGATCGAAGCAGGATTGCGAAATCCCCCACCTCGTGCGGAATTTC
ATGAACTGTATGTAGGGAAATAAGTGAGGAACTATCCTATGTTTCAATAGTATCTATAAG
TACTTACGCAATATGGCAAAAGTGGCTAGAATGCCGTGTCTGAAGGACACCAAAAAGGAT
CCAGCCACGGCTAGACCGTGTGTGAAATTGTCAATTGAGTTGGCCAAGAGGTTCAGATAA
CCAGCCACCTTCTTCGGCTGTTCCTTCCTTTCCTTTGACTTCTGTTCCTGCTCGCGTAGG
AAACAGACTTTACCTACATCTTCGATGTCGCAGGCGCCGCCACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1068, 1333..1439, 1919..2330, 2549..2763
1065..1068, 1333..1439, 1919..2330, 2549..2649
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved