Drosophila_melanogaster Locus CG1646
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG1646
Drosophila_melanogaster
CG1646
3R
snoRNA:291
1465..1538
7257
ACGTACAGGTTATGCGGTCGGCGTTTTCGCTCGCCGTATTTTGTCTTTGTTCGCCGCGC
CGCTGACGCTTTGCGTTCACTGGTCGCCGTTGCCCGGTCACTGGGTCCCCAATTCACTCA
TCGCGATCGCTTTCGTTGTATTAAACGCGCCGCAATTGATCGAAAAACATTTAATTATTG
TGAAATGCGCCTTGGCTTTGTTGTTTTTGTCACGCTTACAATTCTCGAGTCGCCATTTTG
AGAACAGTGTTAGAAGACGCGCACGAGTGGCAGTCCCGCTAAGAGTGATGCTCGCCAGGC
GGGTTATTAGCTATATTTAATTCACGACTGGATTCACCATTCTAAATAACATTTAAAGAG
ATTTCTTGACTCAAAAAGAAATCTTGTCCGACAAGGAAACATTTTACTTACCAATTCCAT
TTACATGTTTGTATTTACTTGATATAATTCACGATTATGTTGTATAGAAACTATAACAAT
TTTTTGGGCTTTTAAAATCCTATGCATTGAACATTCAAACCCTAAATATTAAAGGAAGTA
GGCCCAATGATTGTGTTATTTGTTTATGTTTTTTATGTTAACTTAATAACCCACTAATTT
ATAATATGTGTAACATTAAACAAATTTTATCTTCTTTCATTAAGAATTATTTATGGTGAT
ATTTAAAGTCCTCTTACCATAAAATATTTAAATTATATTTCTAGCTGGAACATGTAATTT
CTGCTAGAATTTGTATGTTGAGATAGGTTCTGCATGCGCACGCCAAAAAATGAACTAGTT
CGCCGAACTGGAAAAACACTGAGCACTTAGGCTATTTTCGTTATTAAATTATATTTTTTG
ATAGATTGTATATAATTCATTCATCAATGCTAAAAAATGATAAATATCGAAATTCGAAAA
ACCTCTGAAAAATATTCAAAATATAGCTATGAGTCAGTCGTCAGTCTTGACCAAACAAAG
AGATATCGATATTGGCGGGACATGTATATCGATACCACGTTGCAATGTTAATATGGCGTC
AGAGGGCGAAAACGTTGTTATGGAAAGTCCAGGTAAATTGATGAAAAATTACAAATACGT
GCATTCCTTCGACCGGACCTAGTGACCGTTGATTAAAAATTCAGTCCTTACTAGCCCATT
TCGGTAGCTGACACTGACAGTTAGCTGGAGCAGCCCATTAAAGCATTTGGAAAAAAGTGA
ACATCACGAGGCAGCGAACAACCCACAACACCGCGCGTACAGTTTATGTAAACCGCATGG
ATTAACCAAGAAAGTTAATTGACGTTTTCCAGGTCGCCGCACACGTTCTGGTCGGAAGGC
CGCATCCCCGGCTGCATCGCTGCCAACCAGAAGCACCCGGCGCACATCCAAGCGGAACGT
ACAGGTCAGTTCATCCCACGTAGTTACCGCCTCTTCCAGATCATCAGCCAATGATGTAAA
CGATTGCAATTTCCAGTGTGGGTGTGGCGTTGTTCCATCCGCACATGATTCTTCTCCCTG
GAGGAGCGAGTGATTACCTGCAAGGGCCAACTGAAGGCACAGCATCCACAAATGCTCTGA
GAAATGCCGGGAACCTTCATTAACGACTTTTAATCCTTTCAGCTAAGTGACCACGAAGAG
GAGGCCGAAGAGCAAGTGGTCATGGTTCAGGAAGAGGAGGAGCCCTTTAGAGGGACAAAC
ACTGCGGAGGCACCTGCTTTGGAGCCCCAATTCGAGGAGACTCAGCACCAGATAGAGGAT
GACGTGGAAATGCTGCCAGCCGAAGCTGCTGGGGTTGATGAAAAGAGCTCTTCCTTCCCG
TTTGGCACGGTGGCGGAGCTGCATTCAGAGACTAGTGATGATATTAAAGAGACACGCGGT
CAGGCTGGCGTGGACACCCTACTGGCTTCTTTAGCCGGCGATAATGCCAACAGCCTGCCC
TCCGTGGGTGGAAATGACGAGAGTGACAATGTCAAGAAGGCGGACTTTGAGTACAATGTA
GACTCCCTGCAGCCGCAGATGGAGAAAATGAATTCCTCTGAGGACTCCAGCTCACAACAT
GCCATTGCCGAGGATCTGGCCGATGCGGACACCAGCAATGCAACCATTGTCAACACAGAG
ATAGTCTCCGAGGATGAGCTACCTCTGCCCAGCAAGCCTGAAATAAATGATGCCGAGGAA
GTTTCCGATGAAGAGCTTCCAGCACCGCAGCGGGCTGAATTGCCAGAGGATGCTGAAGTA
ATCTCGGAGGATGAACTGCCCGCCAGTAATAACAATAACACCGCCACTGAGCCCAAGGCA
CCTTTGAAGCGCAAGGCGGAAAACGAAAGCGTTAAGAGCACCGAAGATAAGGATGCAAGC
AGTCATGAATCAAGCACAAAGGATAAATCCTCCGAGCAATATAATCCGGGCAGTCCCACA
TCTGAGAGCAACGACGCACAGCCCTCAGAGAAAAAACTCAAGGTCGAAGGTAATTGTTAA
TCTTCCAATGACTAATTAGTTGGTAGAGCTTGACTCACAATATTTAAACCCACAGAATCG
GAGCCCAAGGAGAAAAAGAAGGAAAAGGAGCGCGATAAAGATAAGGAGAAGGATAAGGAC
AAAGATAATAATAAGGATAAGGAAAAGGAGCGAAAGAAGCTGCCGGACCTAGATAAGTAC
TGGAGAGCTGTCAAAGAAGACTCCACCGACTTCACCGGCTGGACGTACTTGCTGCAATAT
GTTGACAATGAGGTGGTTATTTAGCCGAACGCCGCATATCTTGAACTTTAAATAAGCAAT
TTTCTTCTTTCTCAACAGTCTGATGCGGAGGCGGCGCGCGAGGCCTACGACACATTCCTG
TCCCACTATCCTTACTGCTACGGATATTGGCGCAAGTATGCCGACTACGAGAAGCGCAAG
GGCATCAAGGCAAACTGCTATAAGGTGAGTACCCCACTTACATTTGGTCGTGCAAATAAA
TATCTTTCGCAATTTCTTGTACTACGCTTACAATTACGATTACAATTGATATTCATATAT
TTGTTGTTAAATGCAATTTATTATGACCTAATAAAAATACTACATTCAATAAATGCAACA
TCTACCAAAATACACCAAATTGAGAAGACAAAACCAAACTTGCCATGAGACTAGTGCAGC
ATCCACTTAGGATCGTGTTTTCTCATAGGGTTCGTGTCTGCTAAATACTTTTTACGGGAG
ATGAATCTAAAAAGGGTACGGATTTAATTTTTTTAGATGGTGAAAGCTTTATGGGGGAGC
TTGGCAATTTGTTTCAAAGGCTAAGCTAAGTAAATGGACTTAATGGGTCGCGTATAGAGA
TTGCCTCCAAATTTGTTTACGTTTCTTTAAAGTAGTTTCTGTTTTGTAACCTTAGTTACA
CCAAATTCATAATTTCGAGACCGGACGTCGACCTTATTTACCACTCCGTACTCCCTACAC
CTTAGCACTTTTTTTTTGGCGATCTTAGCCCCTGAGATATTGTCCTTAATCTTCACGACA
CTAATTGGACCGTTTAAGCATAAGCCACTCCTGTGTCGCACAAATCACGCTGTAACTCAG
CACAGACTAGCTCAACTCTGTTGACCCTCGAACCCCAGACCGACCTGAACCCGAAAGCGA
CTGGTTCGTCTACTCGAAGTACGATCCGTCTACTTTCTGATCTTCGTACGTTTGTATCAC
CAGTTACCTCTTCAGTTACGTTACCTCCATCCTTCTTCAACACGATATAAATAGTGAGAT
CGCATCTCGTACAGTCGTAAGTACAAATGGCGTTTAAATGAAATTTTTAAGTCTCTTTGT
GAATTTTGTTGTAAATCGAGTGCCAAAAAAGAAATCAACTACAACCTGTGTGTTATGTAT
TCCGTGTACTTGTTAAGTCGCTAAGTTAGCTTTTAAGCCCGAACACCATTCACATCAAAA
CGATAACCTTAAGTATCTGAGCACTTAACTCTTGAAATCTTACTATAAACCACGAATATA
TTTTTATATTTCTCTTCTGCGATCAATCAACAATAAATGAAAAAATCAAAACTTGTACCG
AACATACGAAATGACCAAATCCTAGGTGTTTGAGCGCGGACTGGAGGCGATTCCGCTGTC
CGTGGATCTGTGGATCCACTACCTAATGCACGTTAAGTCCAATCACGGAGATGATGAAAC
ATTCGTCCGCTCCCAGTATGAAAGGGCAGTGAAGGCGTGCGGCCTGGAATTTCGATCGGA
CAAACTCTGGGATGCCTACATTCGTTGGGAGAACGAGTCAAAGCGGTACCACCGTGTGGT
CCAGATCTACGATAGACTTCTGGCCATACCGACACAGGGCTATAATGGTCACTTCGACAA
GTGAGTTCCACTCAAATTGGTTTTGTGAAACATGCGAATAATGTACATGCACATTTCAGT
TTCCAAGATTTGATCAATCAGCATGATGTAACTATCACACTTGCAAACGAGGAGGTGATC
CGTCTGCGCAAAGACTTCCACGAACGTCAGCAGAGCAAGTCCTCCAAGTCCTCGTCGAAG
CATCGCCGGGACAGCAGCAGCAGCTCCAAGGACAAAGACTCAAAGGAGCGAGAACGTGAG
AAGGACAAGGATAAGGACAAAGACAAGGACAAGGAGAAGCGAGAAACTGTCGGGGGCGGT
GTTGGTAAGTCGCCAAAAGATACAAGTGAAACTCAAGTCGATGAATCAGATAGTACTACC
GATCTGACCACCGAAAGCGAGTCATCGCATGCAGCTTCAAAGCCGGCAATGCAGATCGAT
TTCAGTGATCTTAGCACTCTGAATGACGAAGAGGTGGTCAGCATTAGGGACAGGGCTATC
TCGGCGCGGCGCAAAGTCCACAAGTTGACCGTTAGCGCAGTGACAGCCCGCTGGTCCTTC
GAGGAGGGCATCAAGCGGCCTTATTTCCATGTGAAGCCACTCGAGAGGGCACAGCTCAAG
AATTGGAAGGACTACTTGGATTTCGAGATCGAAAAGGGTGATCGCGAGCGAGTCCTGGTT
TTGTTCGAAAGGTGCCTAATCGCCTGTGCTTTGTATGACGAGTTCTGGCTGAAGATGCTT
CGTTATTTAGAGTCTTTGGAGGATCAGAGCGGAGTTGTGGATCTGGTACGTGATGTTTAC
CGCCGCGCCTGTCGCATCCATCATCCGGACAAACCGAGTCTGCACCTGATGTGGGCCGCC
TTCGAGGAATGCCAGATGAACTTTGACGACGCCGCTGAAATTTTGCAGCGTATCGATCAG
CGCTGCCCCAATCTCCTGCAGCTTTCCTATCGTCGTATCAACGTGGAAAGGCGTCGAGGA
GCACTGGACAAGTGTCGCGAGCTGTACAAGCACTATATAGAGAGTACAAAGAACAAGGGC
ATTGCCGGCAGTCTGGCCATCAAGTATGCCCGTTTCCTCAATAAAATCTGTCATGATCTC
GACGCCGGCTTGGCCGCCCTGCAGCAGGCGCTGGAACGTGATCCAGCCAACACTCGTGTG
GCCCTGCAAATGATCGATTTGTGCCTACAGCGCCCAAAAGTCGATGAGCAGGAGGTAGTC
GAAATTATGGATAAGTTCATGGCTCGTGCGGACATCGAACCCGATCAGAAGGTTTTGTTT
GCCCAGCGCAAAGTGGAGTTCCTTGAGGATTTCGGCAGCACGGCCAGGGGTCTACAAGAC
GCACAGCGCGCTCTGCAGCAGGCACTCACTAAAGCCAAGGAAGCGCAAAAGAAAAGGTAA
GAAATCCATGAAGATGTATCCACACTCATTCATTAATCATGGACATTCCAATAGTGATGG
CAGTCCTAGTCGCAAAAACTCATCAAGCAGCAAAGAAGGTCCTGTCCCCACAGGATCCGC
GGCGGCAGCTTACAACAATGGTGGCTCGGCCGCAGCAGTCGCAGGCTACAACTATGGAGC
AGCAAATCCATACTATGGTCAGCAGAATACCGCAGCAGCCTATCCCTCACAGACGCCACA
ACAGGCGTCCTACGACTCTTACTACAATCAGTGGGGCTACGGTTCCGGTGGGGCCAGCGC
CAACAGTGGTGGTAGCGGCTACAACTACGGCCAGTGGAGCGGTTATGGCAACTACTATTA
AGTTCGCTGCCTAGATGTAACCCACTCCGCCACCTGTAGCTCTAAGACGCTACGGCTTGT
TTAGTTTTGCCTTGCTGCTCTGTTAAGTTGTACACATCTAATTGTAATTTTTTATCAACC
CCTATTTGAGCCCACAAAATAACCCCACCATTGCGAAAAATAAAATATACCAGCTTTTTA
TCGGTCCACCATAATCGCGTTGCTTGTATTTAGCCAATATATGCTTGAAATAAGTCGAAT
TATGCCTAAATAGAAAATTAAATATACAGATTGACAGTGAGCGCGCTCTTCGCCCGGCTC
AACTGAAGTCTACAGGTTGGGTCGATACCAGGTCACCTCGCCCCCGTTGCATCCGGTTAC
AAGGAGCGGTTCCCTGGGGCTAAACTTGGCGCACAGAACGACGTCCTGGTGTTCGGTGAT
CTTGGCTAGCTCAACCAGTTTCCGCGGTTTGCTTTTCACCTCCTCAAACGCCTGACATTT
CGGATAGTCGCAGCAGTCCTCACTGTAACCAAAGAGTCTTACCCCATTGCCGTACGGCGA
GCAGACAACCCGACCGTCCGCGGAGAATCCAGGTTCCTTGATGAAGCCCGGTTTGGTGTT
GGTCTCGGCGGCATAGTAAAGCAGTTTCTTGGCATTCACCAGTATTGAATGACCGTTTTC
CTTGAACGTTGGCGTTGTCACAGGACTATTGAATGATCGCAGACGCAGCCTGTTTCCGAT
CTCTAAGCGGACTGTGGTGTCGCTATTGTTGCTGGAGCTGGAGCTGCTGCTGGAGCTACT
GCTACTGGAGCTACTGCTGCTGCTCTGGTTGCTTTCTGTGGGCGGCGGGGTGGTCAGGGG
GCGAGGACTGGTGCTGCTGCCCATCAGACTATTTGCCCCCAATTGTCTTAGCGGAAGCAC
TCCGCTGCTGATGGCGTACACAAAGTTATAGCCGCTGACATGGTTATTGGAGACGCGTGC
ACGGTTCTGTCGGATGGCCCGCTCCTGGACTGTGACCTCCGCCGCCCAGATGTCCGGTAT
GAAGGAATCCGAGCGTGTCAAGACTGAAGGGTTGTCAGAGGCGCCACGCCCTGCTCCAGA
GTTATCCAGTTGGAATACTTGTACACTGCTGACCCGCAACGGTCTCCGTGCCTGTCTGGG
AGTAAGGCCAACCGTATCCTGGTCCTGGGATTCATTCAACGAGCTGCGGCTGGCTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 1292..1383, 1602..2448, 2515..2711, 2778..2903, 4045..4319, 4379..5695, 5754..6257
1012..1051, 1292..1383, 1602..2448, 2515..2711, 2778..2903, 4045..4319, 4379..5695, 5754..6057
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved