Drosophila_melanogaster Locus Hrb98DE
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Hrb98DE
Drosophila_melanogaster
Hrb98DE
3R
snoRNA:Psi28S-3405a, snoRNA:Psi28S-3305a, snoRNA:Psi28S-3405b, snoRNA:Psi28S-3405c, snoRNA:Psi28S-3305b, snoRNA:Psi28S-3405d, snoRNA:Psi28S-3305c
2723..2862, 2892..3041, 3071..3210, 3341..3480, 3534..3683, 3750..3889, 4565..4716
7289
CACCGTGCTCCCAGACACCGCGTTCGCACTCCAGGCAGGTCGCATTCTGCAGCGGACAC
GTGCAGGCGTGGTTTTGGAGACACTTGCGTCCGTGGCAAACCCAAGCCTCGCAGAAGTCG
CAGATGGCGCCCACCATTCCGAGGCCCGTGGTGTAGACGCCCGGATGTTTGACCACGCAG
TCGCCGGTCTTTAGCATGCACTTGATTTTCCCGCACTGGGCGCAAATGGGTAATCTCTGA
ATGCTCTGGCAGAAATAGCAGAAGGCTCTCGACTTCTGCTTCTTCTCGCACTTGTCGCAC
TCCATTGGTGCATTGCAGGGCAAATCCGCAAGAGGCACCTCTCTGCTGCGGATCTCCTTG
AGGCGAAGCTTCTGCTTCTCGGCCTTCTTACGCTGCCCAGTCTTCTTTTTCGGCATTTTT
GAAATCAAGGAATTAGAAAACTTATTTCCTTACGTGTGCGGCAGTGTGGCTGCTGCGGGT
GCGCCGAAAAATACCACAAAAAGCTTTCGAATATTCCGCTAAATATGTAGCTACATCTTG
AAAATAGCTACAAAAAATGCGTTAAATTAGCATCGTGGAGTTAGCGGCGACGGCGGAGCC
GAGTAATTTAACACATCATTTTTCTGGCCAGCGTGCATTTTGGAATATGCTCTGCGAGTG
GAGATATTCCTTGAAAAGTAGCTAGCCGATTTTTTTATTGCATATTTTATATACTTTCTG
AGTCCTATAAACTTTAGTCGTACATAGATAGTTAGATCTCTTAAATAGTTCGATTTATTA
AGATTTTTGCATTTGTATTTTTTTTGGAATTTACCTATAAATAGCGAAAAATTAAATAAA
TAAATAAGATTCTCATTTTCCATATTTCACCGTTCTGCCATAGACGCTAATTTGACCCAC
ATAGATTTTCAGTGGAAACAAGTGGAAGCAACAACCGATTAGTGTAACCAAATACCTTTG
CTTTTATTTAGGTCTAGTATTTTTGTAAGGTCTGTCTACGGCTTTCCTTTCCACAGGAAA
ATATATTTTCAGTTTTAGGGAAGGGGTGCTACAGTGAGCGTCTTTCGTTCCCAGTGTCGT
TATTTCTATAGTATTGCTGAGATATATATCAGAGCAGTAAAGATATTTAAATATAAGTTC
TTCGAAATGGGTGGTCACGACAACTGGAACAATGGTCAAAATGAGGAGCAAGATGTAAGT
AGCACACAAAACCGCGACTGCACAGGGAAAAAACTCAGTTCGGCCATAATCCCAATATAT
ATATATTTTGGTGATCAACGCGCTTTTACCCATGCGGCAACTAAAGTTGATGTGCTAAAG
CATTTCGTTGCGGTTTTGTTACTTAAGACTAAGACTAACAGTAGTTGTATCTTAATAGTG
CTAGGGAGTACGATGCTGTCGGTATTGGTTTCTCTTTTAGCTTTTTAGTGCAAAAGGCGT
GATCAAGAATACACATGTTACACACATTTTTTAAGGCATGGTGAAAAGAAACAGGGCAGA
TATTGTAAAAGTATTGTATTGACAAGGGTGTCTGTCAACTTATCGTTATCGTTCTAGGTA
GTATCGAATAGGTGCTGGGTTTAATCGGGTTGTAGAAACGGTCACACTGTATTCAGTTTT
TTCATTCGTCTCGTGTGTCAGGGGACTTTCTCCATTTGCAATAGCAAAAAAAATAGTTAG
ATTAGAAGTTGTTCAACTTTTGCATTAGTAAAATGGTGAACTCGAACCAGAACCAGAACG
GCAACTCCAATGGCCATGATGATGTAAGTAGTGGATATTAAGGGTCTAGAAATTTCCTGT
AAGCTGGTGTCTCGCCTTGCCGGTCGCCATTTTGAAAATTACGCATGTGTCTCAAGGGCG
GAAAGTGAGGTTATGGCCATTGATAAAATCAATAATTTAGGACTTTCCTCAGGACTCCAT
CACCGAGCCGGAGCATATGCGCAAGCTGTTCATCGGTGGCTTGGACTACCGTACCACCGA
CGAGAACCTAAAGGCTCACTTCGAGAAATGGGGCAACATCGTGGACGTGGTGGTCATGAA
GGATCCGCGCACAAAGCGTTCCCGCGGATTCGGATTCATCACCTATTCCCACTCGAGCAT
GATTGATGAGGCCCAAAAGTCGCGTCCCCACAAGATCGACGGTCGAGTGGTGGAGCCCAA
GCGCGCCGTTCCCCGTCAGGACATTGATTCCCCGAATGCCGGAGCCACCGTAAAGAAACT
CTTTGTTGGCGCCCTCAAGGACGACCATGATGAGCAGAGCATCCGCGACTACTTCCAGCA
CTTTGGCAACATCGTCGACATCAACATAGTCATTGACAAGGAGACTGGCAAGAAACGCGG
ATTCGCCTTCGTCGAGTTCGACGACTACGATCCCGTGGACAAAGTTGTGTGTAAGTACAA
CGCTTTTCCTAATCTAGACAATATCAAATATCCTTTAAGAATGATTTATCTCTTCGAGAG
TAGACTGTTAGGAAAATCACATTGCCATGTTCTTAGATTTATACAATACAGATTGAATTA
TCTGCACAGGAAACGAATATTAACCCCATTTGTGTACGCGGCGTTCGTGTAGAAAAAAAG
TATGACATGCAACCACCCCTAATCTATATGCTCAATCAGCTCTGGCACATTGTAGGGCTT
CTCGTAAATGTCCATCAGCGTCGGATAAACGAATGCGCACTATAAGCAAGAAATTTCGAT
AAAATTGCAATTATTACAATATATCCACAGTCCCAGCTCCGCATAGCAATGTTCGATGTG
CTTGTGCGGCGTTTGTGACTGTAAGAATAAATTCCAGCCAGTATTATATCATTGTTGTTG
GTGCTCTTCGTGCATCAACGATGAAAGAGTATATGGCACACTATAGCTTGAATCTAAAAC
TGTTTCCTAATATCACAGTACTGACAAATTAACTGGTTTGAAACCATCACCAGGGTAGTT
TTTTTTTAAACGCTGTGAGATGAATTAAAGCGTCGGCTAAGCTATGTTATGCGAATGTAA
GCATTGCGCCTATTCAGTGTAACACGCAGCCTCGTTACAATAGTTCAATTAATTGCTATT
ATGGAAATCGATACACAGTCCCAGCTCCGCATAGCAATGTTCGATGTGCTCATGCGGCGT
TTGTGACTGTAAGATAAAAGACCCAGCCCATATTATATCGTGTTGTTGGCGCTGTTCGTG
CATCAACGATGAAAGAGTATAAGGCACAATATCACATTGAATTACCAACTATATGAAAAG
AATGAGTATCTAAATGCCTTCGCTTACTTGAATATACTGACAAATCCACAGAATGGTGAA
TGTTATTTAGCGTGAATATATCTCCTAAAATTAGCTACGATTCCACAGTCCCAGCTCCGC
ACAGCAATGTTCGATGTGCTCGTGCGGCGTTTGTGACTGTTAGAATAAATTCCAGCCAGT
ATTATATCATTGTTGTTGGTGCTCTTCGTGCATCAACGATGAAAGAGTATAAGGCACACC
TTGATTATCGAACCGATTAAACAGAAAGTTTCTAGATCAGCCCCTTCGTGGACGTCACAG
TACTGACAAATTGACGGGCTTGAAAAAGTCGCCTGTATGGTTTTTATTTAAACGCTGTGA
GATTAATTTAAGCGTCGGCTAAGCTATGTGATGCGAATGTATATTATAAATCAATTCTGT
GTAACACGCAGCCTCGTTACAACTGCAAATCAAATGCACCGAAATGGTGAATGTGTACTA
TCCGATATCGATCCTAATTTTAGCTAAAATTCCACAGTCCCAGCTCCGCATAGCAATGTT
CGATGTGCTCGTGCGGCGTTTGTGACTGTAAGATGAAATCCCAGCCAGTATTATATTGTT
GTTGTTGGTGGTGTTTGTGCACCAATGATGAAAGAGTATATGGCACACTATCCTCCGGAT
GCACCACATAGGGAAGTTCATTTTCGAATACCACTAATAGCATGCTTTCCCTCTTTATTT
TTGCAGTGCAAAAGCAGCATCAGCTGAATGGCAAAATGGTGGACGTAAAGAAGGCCTTGC
CCAAGCAGAATGACCAACAGGGAGGTGGCGGAGGACGCGGTGGTCCGGGTGGTCGTGCCG
GTGGAAACCGCGGAAACATGGGCGGTGGAAACTACGGCAACCAGAATGGTGGCGGCAACT
GGGTAAGAACTTATTGATCGCCATCAATTCGATTTGAGGCTTATTACTGGTTAATTGGCA
TTGCAGAACAACGGTGGCAACAACTGGGGCAACAACCGCGGGGGTAACGACAACTGGGGC
AACAACAGCTTCGGTGGTGGCGGCGGCGGCGGTGGTGGTTATGGCGGTGGCAACAACAGC
TGGGGCAATAACAATCCGTGGGACAATGGCAATGGAGGCGGCAACTTTGGAGGCGGCGGC
AACAATTGGAACAATGGTGGCAATGATTTTGGAGGCTACCAGCAGAACTATGGCGGCGGT
CCGCAGCGAGGTGGCGGCAACTTCAACAACAATCGCATGCAGCCCTACCAAGGAGGTGGT
GGATTCAAAGCAGGTGAGCAACAGCACGTCTGTTGATGCATTACTGATAACAACTAGATA
GCAAGACACAGTACCCTGACACCTAACTGTTAGAGCGTCGATAGAGTTTGGCAGTTAGCT
TATTAAACGCTGTGAGATCAACTGACGATGGCCTTCGCTATGTTATGCGTATGTAAGATA
ATCCCAGTACGACGTAACACGCAGCCACGTTACAGTTTTTTCATGAACAGTCACCACCAG
TATAGAAACTAGACTAGAAAGACGATTGGATATGTTCCTAACGATCCTGGGTTTTCTTTT
AGGCGGTGGCAATCAAGGCAACTATGGCGGAAACAATCAGGGCTTCAATAACGGTGGCAA
CAACCGCAGATATTGAGAGAGATTCCGGACGAGGTGAGACATCCAAATAACCACTACTAA
CACAAAAATATACATAGTCCAAGGCGAATTCAGGCCATAACTAACCGCTTATCTATCCCG
TATGACCATTAATCTTTCGCTTGATTTGACAAACATATGTTGTGTGTTTTTTTTTTTTTA
TAATAGCGCCCTTATCGGCATTTTTGGTAGTTTATAAAGCATATTGAGACTAAAAAGCAA
AACGGCTGAGACAGTCCGACCCACCTTACTCAACAAACTTATATACGTATTTACACTTTT
AAGTATTTAGAGAACAAAAACCCATCAACCAATTAAGAACTCCTTTTCATACCAATTGTT
TTAAATAACGTTTCTCATTTATCGACATTTTATAGGTGATAAAGTAAAAGTCGCTCAGTA
TAATCCCAAAATTCAAAGTCAAGTAAACGATACGCAATTCAATGATCAATATGATGAAGT
ATGAACGCACGTTCATAGTCCTAAGAAGTTTTCCGAGCACCACAAACCAAACATTACAGA
TTGATTGATCAGGATCAGTGCAGTGCAGTGAAGTCGTAAGAAGTTTGGTTCAGTCTTGGA
TTAGAACAGAAAGAGAGATCAGTACCAAGCAAGACCAGACCAATACAGAGTGCAGTGCAG
TGCAGAGCAGTGTGTGAGCTAAACAGAAGAAACACAGCAAGTGGCAGTACACGTACACAG
AAGGTGACCAGGATTCCATTCAATTTGTCTTTGCAAGCGATGATAAATTGAATGTCAAGA
GGCGCATCGAAAACTATCCAATACCCACAGAATTGTAATCTATAATTTGCAACCCATATG
TAGCAGCCCATATAAGTAACATTGTAATTAGATCCACAAAGCCGACGACAGGCCAAACAT
TTGTATCTCCACCACACGAGCAACCAACCAACCAACCTACTTAAAACAACCAGTCATAAA
CGAATCAGCTATGTAAAACTTCAAGGCGGCAGCCGAGAGATATGTTTCTTTGGTTGCAGA
CAGCTCTCCAGTCCATCGGCTGCCGGCAACTTTTGATAATCAGAGCAGAAAACACAAAAT
ATATAAAAACATGTATTACATTTTACAACTTTACTAGGCTAAGTTCTCATAGAATTAAAT
CGAGTAGAGCGTGCGGAGCGACTTCTGCATCCATCCGCACGCTACCCTAGTCTTAATAAT
TTTACTATTCAAGTTCTAAGCGAACCTGACCGTGTGTGGAGGAATCTAGATACTTAGATT
TTTGAATAAGTGTCGACATGGATATAACCTCTTCCGCTGCTTAGATGTAACCGATCAACA
AACAACCTTTATTGTAATTTATACCTTTTAGCAAGCAGTCTGTCTGAGGAGTCAGCGCAA
TTATACTTAACAAAATTTACATTTTAATGTAGCTAAAAAATACAAGATGCAAAAAAAAAA
AATAAGCAAGTGTCCCGCAATTGATGTAAACTCTGACGAAAGAACAAAAAGTATATAGCT
AAGCCAAAGCCTCGTAGTTTTCTATATTTCTGTAGCAGCATCAGCAAAAGGATCTCGATC
AGAATGAGAGTGTATTGCAGAGGTAACAAGGTGCAGCAAGTCTGACCAGGTCCAAAAGCC
AGCCAAGAATATGTACTTTACTATAGCATTTGTTGTGGGCGGGCCATTAACGTCGTTCGA
GAGTTCTCCTTTCACTCGCTTAACAGGAATCATTTTCCCCTTTTATTTGATTTGCCCCCC
GCCTGCTGTACCATGTCATTTACAACCATGTATATTATTGTAATTTCTGTTGCCAGTTGG
CTGCGAAAAGTATGCGAAGCGCTGAAAGACTGCCGCCGCGCTACTGAATGCAGCCACGGA
AGGTGCCCGCGTTTGCTAGCAACTCCGGTCGCTGGGTTTCGGTTCCCTCTGGGTAAGTAA
TCCTCCGCAGATCCCAAATCCGGAAAAAGTTGTAACTTTCAGGTGGTCTGAATCGGCTCG
TCGCACCTGAGGATGGAATGGATGTTGAACGGTTTCCCCTCTGCACCATCGTAAATATAC
GACTTTTATTTATTACTTCATTTTATTTTCATTATTACTATCTTTGAATAAAGAAATTTC
AGAATACCAAACAAAATGATTTTCGTTTCATTTTGAATTAAAATTTCACCAGTGGGGGAA
AATAACGGTATTTGAACAATAATGGCGTTGCGAATGTAACGTGATTGGCGTAAAATCGCA
AATTCCGTTTTATATAGTTGAATGATTTTCAAAGCATTCATTTTGTTGCATTTAATGTTA
AATTTTAATTAGTCCACTGAAAATAATAAATCATGATAAATGAGCACTGTGTCTGTCACT
TTGTTGTTGGTTTGAGTCTTCTCTAAGTGGTGAATAAGTTTTCTGCGATATATTTAAGCG
GTCGCAATACGGTCATACTAATTGCATTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 1900..2389, 3966..4141, 4206..4512, 4802..4892, 5255..6289
1146..1193, 1900..2389, 3966..4141, 4206..4512, 4802..4872
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved