Drosophila_melanogaster Locus RpL4
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL4
Drosophila_melanogaster
RpL4
3R
snoRNA:Or-aca3
2123..2269
4130
GGCGGTGAAGACCTCCAGGTAGGACTTCCATGCCTCCGTGCCGTAGTCGAGCATTAGCT
CCAGGTTGAGAGAGCGCACCCACTGGTGCTCCAGCTGGGCCATCGAGTTCTCAATGGCCT
CCTGCCAGGCGGACACCTCCGACAATTTGCCCGATGGCGGCGGTGGCAGTTCGTAGCGCT
TCATGGAGAGCGTCTCCATGGGCAGGCGGTTCTGGATGCGCTCGAACTCGTTGGCCATCA
GCGGAGTCTCAAAGGGCGAGCTGGCGGGCAGTGGCAGATGGTCAAGGTAATTTTTTGTGG
GCCTATAGCGCCGGCATTCCTCCTCCACCATGGCGAGAGCCTTTGGAAGAAGAAGATGCC
ATTTCAAAGTCAGTTTCAACGTGCAACATGGATATCCGTATATTTACCGATTCCCGGACG
CCCACATCGTCATAGCCGTGATCTATGTAGGGCAGAGCATCCACAATAACTTCGCCAGCC
ATTATTTATTATTAATTTCTGTGTTTTGAGACTGTTTTTTCCGCAAGTAAACAAATACAA
TTGCCGCTTCGCACTAGTGTGGCACATTTAGCTACTTTATAGCTATATAAACGGATAACA
GAATGCTGTTAATTAATAGCCATATATCTATTTAGTAAATTTTTTTGTTTTAACATGAAC
ATTTAAGCAAAAAATAAGCGTTGTTTTCTCACCAATAAAAGTTGTGTAAGTTAGTTTTTA
ACGTATGTATGTATTATGTATTGTTTGATTATTTATTATGCGGTTAAATTACAACAATTG
TATTCTTGTTCTTTAAAAACGCATTGCTAATTTATAAATTTAACTAAAATACGTTATTGA
TAAATTCGAATTTAGATTTGTAATATTATAGTTTAATTGCGAGAATATAAACAAAAACTT
CTCTTACGAGAGAAAAAAAAAGCTAAAAGTGTTGGACAGCGTCCAATTAGCCCTGTAAGC
TTGACACTTGCTGCTGTTAGCAAATGCAACCATGCGCCGTGGAACGCGATTGGCAGCCAT
TTCCGGCAGCTCTCTTTCTTTCTTCGTTCTTCTTAATAAAAAGAGGACGGTATCTGCGTT
TGCAGAATATTTAGCACCTTTCATTGGGTTTGAAAATCAACGAAAATGGTGAGAAACGAA
GCACAAGGCACTCCGCAACCGCAGCAGACCCCAAAACATTGGATTTAACACACGAAACGA
TGCGAAAATAGTGCAAAAGTGTCGCCCTAACCTCCACGTGTTTGGAATGTGCGGCGATGG
CGAAATGCGCTTGTTGTGTTTTGTGATGTGAAATGATCAGTGAACTAAACCCGAATACCA
TGTGCACTTTCAGAGCTTAGGCAACGCCAGGCCATTGGTCTCCGTGTACACGGAAAAGAA
CGAGCCAGCCAAGGACAAGAACATATGCCTGCCGGCAGTGTTCAAGGCGCCCATTCGTCC
GGATGTGGTCAACGAGGTTCACCAGCTGCTCCGCCGCAACAACCGACAGGCCTACGCCGT
CAGCGAGCTGGCTGGTGAGTAAACTGTTTATAACTCCTCTTTTGTGTGAATCTAACCCGT
TTGAATTCCTGTTTGCAGGTCACCAGACCTCCGCCGAGTCCTGGGGTACCGGACGTGCTG
TGGCCCGTATTCCCCGTGTGCGTGGTGGCGGTACCCACCGTTCCGGCCAGGGAGCCTTCG
GCAACATGTGCCGTGGTGGACGCATGTTCGCCCCCACCAAGACGTTCCGTCGCTGGCACC
GCAAGGTGAATGTCAACCAGCGTCGCTACGCCCTGGTGTCGGCCATCGCCGCCTCAGGAG
TGCCAGCTCTGGTCCAGTCCAAGGGACATGTCATCGACGGCGTCTCCGAGTTCCCGCTGG
TCGTGTCCGATGAGGTGCAAAAGGTCCAGAAGACCAAGCAGGCTGTCATCTTCCTGCGTC
GCCTGAAGATCTGGGCTGACATCCAGAAGGTGGGTAACTTTGTACACCTATGAAGAACTT
AATCCGAAGAATGTTAGGTCACTTAACTGTGCGTCTATTCAACTTCAACGTATTTATTTA
ACAAAACGTGAAGTTGTGATGTTTTAATTGCAAAGTTATAACTTTTTATTGGATTCCTAC
TTTTCGGATGCTTTCTAAATCTTACTTGGCAGCGTGCAAGCAACTGGCTACTCTTCTGGT
TGTCCGATGCTTGCAGGGATCTCCTGCGTTGCCAGATAAAATGCTCTTCTTGGCGTTACG
ATTGAAACTTGATTCACGGCTTCCATCGTGGTAACGGAAGAGCAACAGCTGTTGTATTCA
TGTTCTCTATTTCCGAATTCCTGGAATATACATACTCACTATCAACTTGTTTCTCATTCA
TTTCGCAGGTGTACAAGTCGCAGCGCTTCCGTGCTGGCCGTGGTACCATGCGCGACCGTC
GCCGCATCGCTCGCCGTGGTCCCCTGGTGGTCTACGACAAGGACGAGGGTCTGCGCAAGG
CCTTCCGCAACATCCCCGGCATTGAGACCATCAACGTGGACAAGCTCAATCTGCTGAAGC
TGGCCCCCGGCGGTCATGTCGGTCGCTTTGTCATCTGGACCGAGTCGGCTTTCGCCCGCC
TGAACGATCTGTTCGGCACCTGGAAGAAGCCGTCCACCTTGAAGAAGGGCTACAACCTGC
CCCAGCCCAAGATGGCCAACACCGATCTGTCGCGTCTGCTCAAGTCTGAGGAGATCCGCA
AGGTGTTGCGCGATCCCCGCAAGCGTGTGTTCCGCAGCGTGCGCCGCCTGAACCCCCTGA
CCAACGTGCGCCAGCTGATCAAGCTTAACCCCTATGCCGAGGTCCTCAAGCGTCGTGCCG
CCCTCGCCGCCGAGAAGCGCACCGTGGCCAAGGTGCTGGCCAAGGCCAAGAAGCAGAACG
TCGAGCTGGCCAAGTCGCACTTCGCCAATGTGGCCACCAAGGCTGCGGCCAATCGCGCCA
AGCTGCTGGCCGCCCGCAAGAAGAAGGTCGCCGCCAAGAAGCCAGCGGCCAAGAAGTAAA
CTTACTTTCCCCCGAGTAGAGCTGACACACTTTTATATTATAATAAACCACAAAAGTTGT
ATGAATTTTATTCATAATACATAGAGTGCGCGACAGTAATGCTCATTAAACTCTTAGTCT
TAGGCACATCATTTAGTTGGCTCTCTTTTTGGTCGTCTTGCCTGCCGCGCTGAGCGATCC
CATCCCTTATCATTCTCCCGCTCGCGCTGATAACAGCGGCATGGCATCTGCATCTGTATC
TGTGGCGGCGGCTGTAGCTTTCGTTATCGTCCGTCGTGCTGCCGCCGATGGCGATGCCGA
TCTTGGTCTTCGTACACGTTCGCACATCCATGGGCCGCACATATACTTATTGTCACACGT
TAATTGGCATTTAATTAAGCGTCGAGCGTCGTCGCCGCTCTTATTCGACTGCGAACGGTC
GACTGGCGCGGTTCTGCGTATCGCGAATATACCGAATCCCTTTTGTGCGGCAAATAAAAG
GCTGGGAAACAAAGGATATATATTTTTGATTCAATTAACCGATGTAATTTCGCGACGGTA
CCATAGCATAGTAGGTAGCAGTCGGTAAACCGGTTCCAAGCCCACTTTATTATATAGCAG
CTTGCCAAAAATAAAGGTAGATGCTATCTCGCGCAAAATCTGAAAGCTCGGATCATACGA
TATTTTCTATGTGCGGGTCGCGACCAATGTCTGGTTATATTGAGTAGAACGCAATACCAT
ATAGCCACCACCACCACTGATCGGCCAGGAGAGCGAGAGCGGCATCGGCATCCCGCAGAG
AGAACGCTGGAGCGGAGCGGCCATCATCTCCAACCGTCTCCTCCACCATTTTCCATCAAC
AACATTTATATATATTTTTTTTTTTTTGCCACCGCAGTAGATGGCAGTGCAGTAGTTGTG
GCCGCTGCCACCAAAAGGGTCGCTCTCGCGTCTGATTATTAGTCGCGTTTAATCGTTGCG
TTCGGTACGTTTCCGAGACCACTTCCGATCACTTGCCCGCCGGCTGATGCCGGAGCATCA
CTACTGACTGACTAGTAGCATTAGCGCGCGGAACCAGTCCCAGGTCCAGGGCACAGCATA
ATCATCATCATGTTGACGACCGTCCTGAACTTTGCCCAGCGCGTCGCCGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1333..1513, 1578..1948, 2348..3130
1125..1127, 1333..1513, 1578..1948, 2348..2995
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved