Drosophila_melanogaster Locus Tl
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Tl
Drosophila_melanogaster
Tl
3R
snoRNA:Me28S-U1554
6470..6584
45361
GCAATTACATTTTACATTTTACTCAGAGAGAGAGACTAATCAACTAATAAATCCATAAT
CACTGTTATTACGTATGCTGCCTGAGATGCTTAGACTTTGAAGTTAACCGGTTAAACTTG
GCTAACAAGAACTGAGAACTACTGGCCAACAACAACTGCCGGCTTTTCCCCCAAAAATGA
AAACAAAACAGTAGAAGGCTCTCTTGCTCTACCACTTTCTCTTATACTCTTATACGAAGT
ACCTGTATTTCAACTGTTTTCCTCTCTCGCATGACTTTTATCGCATGCGATTTGTTTATA
GTGCAACGACCACAGACACGAAGATAATTCGTGTGTCTCTCTCTTTTTCTCCCACGCATC
TGTACCTTCGAACGGTATTTGTGGGGTAGAAGAAATTGCTCGACTTATTATATCGTTTGC
CACTCAGAAGTTAGGGAAAGAATTTTATTTTTTATAAAAATCCTAGTCAACTAACATAAA
TCAACTGAAAGCTCGATTCCTCATATTATCACATTGTGTTATTGCTACAAGAACTGTTGT
TCTAAAAATTCTTATCAGTACGTCAAAAATATAAAAAAATTTCGAGACTAGCATTTTTAT
CCAACTCATATTTATTTATAATAAGCTGATTATATATAAAACCCAAACAGCTTTATAGAA
ATAACTTCACACGTTATTTAAGGTTAAAAAAGTAGCAAGATAGGATGTTATTAAAAGTAG
AATATAAAAAATATAATAATAATTTAAAATGTCTTAACAAACTGGAGCTTAAGGAACCAA
AAGCAAACAAAATGATATAAAACATATAAAGACTGTGACAAAATTATTAAAATTTAAAAT
AAAATATATTAATAGGCTGATTACAAATTTAAGTAAATAATGTTTTCTATATTGAGCAAA
GGGTATCTTGCCGCCGACTCAGCCACTCTCTCGTCTTTCCCTCCACACTAAGCGCACTAC
CAGCTCTTCATCTCTCAGTTCTTCTTTCTTTTCGAGTCGAGTTCAGTTTGTTCCGAATCG
CCGACGTGAACGCACGCTTGTCGCGCTTGTAGCAGTTGGATTTTTGATTTTCCCAGCCAG
AGTCCCGCGTTCGTGTGTTGTGGGCCGCTTTTGTTTGTCTCGTTTTGTGGCCAGCGATTT
GGCAACCGAATAAGCCAAGTTAAGAGCAACGCTACGCAGCACAAAATCCATAAAAACAAG
AAACACAAGGCGCAATTAAATGCAAATGTGTGAAAGTGTAGCAAGCATTTAACCAAAAAT
AAAATCGCAAAAAATCGCGGCTTCAAAGTGCGAACAAGCGCGAACAGAGAAGCTAAACAA
CAGTGCCAGTGCGTGTTTGTTCGTGGCAGCTTAAGAAAAGCCAAATAAATATTAATATTT
GCACAAGAGATCGCAGCGGAGTAGCTAACCTCACATTTAATAAAACACGTATTAAAACGG
TAAGTATTTACGTCTCCTTGTTCAGTTATTACACTTTGAACCGTGCCATCTCGCTCTGTC
TCGTTATCTCCCATTCGATTTTGCTTTGTGCTAAGCTTCGCTTGGCTCGCGCTAAGCTCA
GCTATCTCTGTCCCACTCTCTGATCAGTCCAATTCGCCTATAATTGCACAGAAAAAAATT
TACCAAATTGATGGCTCATCGGGCAATTGGTTGACATTTTGTTCCAGTTTTGATCACAGT
CAGATAAAATCAATTTAAAGTACATAAAATGAGCTGTAAAATATTTGTAAACATCTTTAA
ATTGATCTATTAATACTACTACTACTACTACTACTACTACTAGTACTCTGCGTAAAACCG
TATTTTTTCCTGTGCAAATTGGCGATGAATAACAGTTTCAGCAGTTGTAACCGTTGCACA
ATTTTCCCCAGTGCTTGTGTGTGTCACACTCTTGTTGTCCACAATTTCCGTGGTTTTTCT
CGGCACTTTCCAGGGAAATGTGCAAAATGCTGCAGTGCAGCAGCAAGTGCTCTTCGGCCT
TGGGGTGTGCTTTGCGTTTTGGCCAACCCATGAACGAAACAAAAAAGAAAACAAAGCCAC
ACGCATTTGGCCCAAAGCTCACGAGCCAGCATATTAACACTTTGAATTTTTGGCCAAAAA
CCAGTTTGGAATCGAAAAAACAAACAGACACAACAAAAGTTTATTTACTACCAAAGAGAG
CTTCGTTCAACAGGTTTTCATTGCGGGGACTTTTATTCGTATTGAAGGTGGAAATACCTG
GGTAATGCAGGTTTCAAAAGTACTTCTAACAAACCAGAAAATGCCCACTTGTGCTTTAAA
AGCTAATAAGTTGCTGATTAGAAACAGCAAAACAAAATAAGAGAAGAAGGAAGGGACAAG
AATCTTCTCGCTTGTACCAATTATGGTAAAAATCGTATGACCTTATGATAAACTTAGACT
TTTGTTTTTAATTCATTTCGATTCTTCTTGGGTTTTCCAACACCATAAATCTCTTCTTAG
TTGATAGCCCTTGACCACTAGCTACATTTATATGAAAAATTCGGAAAACCCCAAGATTCA
ACCCCAAAAGTTCAACGATTATCGCTCAGAAGCAGCAGGTCTTGAATTCAAGAACAATGC
TGTTTTAACAATAATTATACAATATATATAAATTTTGATTGTATTTTTTTCCGATAGTTA
ACATCCTGCCATTGAGCTTCTTTCGCCTGAGGGTTTTCCGAATAACTGTACTCTGGATTT
AGGTTAAGATTTTTCTTCTTTGGCCCACATCAAAGGCAAAGAAGCTTTCAAAGCGGCTAT
AACAATGGCGGCAAACTGAAAAAAAAAAATGCTAGTCTTCGTCTGTGAAGGTAAAACTGC
GGAAGTCATTTAACAGTCTACTTAACTTCTGCCAAAAAAAAAAGAAGTGAACGAAAAAAA
TGAAGTGGAAAACGGCAAACTGCAAACGTTCAAGATGCTCCGCTTGGGTCTTTCGTCTTG
GCCACGTTAGAAAGTAGCTGTAATTGTGGCTCCGTTATTGTTATGGCCAAACCGCCACTA
GTCCAACTGCAGGCGGTAAAAGTTGCCCAAAATGAATTGTCATACAAACACGTTTGTTAT
AAATATTTCTGCACAATGAGAGACTCATTTAAGATTCATTGTACTCGCTTTTTTAGTTGT
TAGCTTTATTTTTCCCCCTCTCATTATTGAGGGCGTTTGTCCACTCGGTTGATAAGCGAA
AAGGCAGAAAAACAATATTCAAAGCTGACTCCGCTTTGGTTTTTACATCTGCCAAGTGTT
TTTTAGCTTTCTGCTATTTCACTCTTAGTTATTGGCGACTTGTGTTGATAATTAGCACGT
CGGCTTTCAGCGTTTCTATGACTTGTGGTCCGCTCAGCGTGATGAGTCAGCCTCCTAAGC
TGAAAAGAGCGTTACGATCGAACCACCATATGTCTTACTCTCCCGATCTCAGATCAGCGG
GCGGTTTAACCCAAAGTCAAACCAGATCCGTGACGTAAATGGGAGACAAATACACGCAAA
AAAAAAACAAGACTGAAGATCTGAAGATTGTATCTATAAGATCTGTTATTAAAGTGATAT
GTAATTACATACTACATTCTTATATGATGACTATAATGACTAATATAAACACGTTTTAAT
ATAGTACAAGTTTATATTATATAGCGTAATATCATACTTACCGTATTGTTATCACCTGTT
TTTTTTTAACAACTCATTTCTTTTCGTGTGATTTCAACGTGTGAGGTTTTTTACTCTCCA
ATCAGATTGAACTGAGATAGAACTGCCTGACCAGTCACAGGGCTTATTGCCTTGCATTCA
ATTAATTAATTTCAATTTTATTGCTTCAGCTGACCATAAAATCGTGAAGGGAGGAATAAC
CATAAGTTCCCCACTGCGACATTCTCTCGGTGGAGGGAAATGAAGTCGTTGCACTTGCTT
TCACCCTAATGCCTTCATCAGCTGCACAAACGAAAAATCTCATTAATTTTCCACTTTCTG
TCTATCTTTGGGTTATCTCTCCATTGTTTGTCCCCGTCCCAGTTCCCTTTATGTTCTTAC
TATTTTTTTTTTTTTTTGGCCCTACCTGCGTGCAGGAGTTTTCCCTCATGAAGTTTTCGG
TCGCGACATGTTTTCTGATCCGTGTCCTGTGCTCTGGTCTAGTTCATTAGATGGACTTGG
CTAATCGATTTCCATAATCAAACAGATGGCGCCAGAATATGAGAACGAGAATGAGACATA
GCAAATGAAGCCGAGTAAATGTTGATATAATAAACCCCGTGTGGCAGGGCCAATTAGGCC
TTACTCCTCACCTGTGACACAGCCACATATTTTCTCATTTGAATAAAGAAACACGACCAC
AGCAGGGGAAACATTAGACGCGCCTAAACGTAGAAATTAGCGGCCACAGAAAACGGGAGG
GAAAAATTCCAAAAAAATAAACATACCGAAAAAGAGAAATTTAATTAAAGCCGCATAGAA
AAAAATGCATAAATTTAGTCACCCAAAACACCCACCCACCTGGCATGTAATATTTGTAAC
CTCATTGCGGCGGCAGGGGAAAGGCGGTGTAATTTTCACGGTCCCCGATCTGCAGCTTTT
CACCAACTTGGCGGGTCAGTCCGGCATAATGATTAGGGTCAGTGTGGGGTGGAAAGTCGG
GAAAACTCCTGCCACCCAGCTGGAAAAGGAAAAGCAACAGCAGCGGCATAAGCATCAGCA
TCAGCAGCAGGTTGCCAACAATTTCTGCTTATAATTTTCCGTTTTTCATCCTCCTTTTCT
TTTTGGCCCGCTTTGTTCTGGTCGAGATAAAAGCATTTGTCATTAGCATAAAATGTTCTG
GCTCAGGTTTTGATCTGGAGTTTGGCCCGAAAAAAATTAAAAATGCTACGAATATTTGAA
CTTCATTAGTGGGCCAGCGAGCCCAAATGGGCACTTGGCTATAATTAAAATTTAAGCTAA
TTTTAATGCTCAGAAAAGCGGGGAAAGGCAAGCCGAACAACAGTAAGTCAGCAACAATTT
GGGCCAGATATTATAAAATACCTCAAATGGTGAATGTCCAACGCTTGATTTAGCTTTAAG
AATGGAACACGAACCCAAAGTGAAAGATAATGGATTGGGAAAATGGAAAAACCTACGCTT
TTCCTTTGATGGGCATTCACTGATAAGAAATGCCCACGCAACAATAAGAACAGGAAGACA
CGTTTTCGTAGGTGCCAGTAAAAGGCGATCGAGTCATCATGCCTCGCCGAGCACCCTTGG
TAGTACCCTTGTAAACGTCTCAAGATTAAAGTCACCGATAAGTCGAAAATGTACTTAGAT
GGCCAAGATGCCATGATAACGCCACTCCCAAGGGCCAACACTCAACACTTTGCGTGAATG
GTCTGCAATTAAAGGGACTTCTGCTGCGACTCCTGTCAACGTTAATGATTGATATCCGGC
CATTCGGCCTGGGAAAATGTTTGAACACACACATATTTTGCCTTGACATGATCCCCAATA
ACCGAAAATGTCAGGAGCCAGCCCCTCGAATTTACATCAATGGCATATCGCTTGAAAATT
TAATAGCACATTAAGGGCGGACAAGGACTAACATTTGCATTCCTAATGAGACGCCCGCCA
CGCAGACACACACACACACACACACACACACACAATCCGTATCCACGTCCACGTCCAAAC
TGCAATTGGTGGGGACAGTTGGAATTATATAGCAATCAGTCGCGGACTGAAATGTGTCAA
TATGTTGCAGACAGGGGGTGGAGGACATGGTGTGGCACGGTATCGGTATGTCTGCAATTT
TTATGCAGGCTCTATAAACAATTTACTTCATCCAGCAAAATCGGAGCAAGACTGATGGCC
AGCGTACATGTAAATCAATACACAAACAAATTATAAATGCAAACAGAGACGGGGCAGATG
GGGCAAATGGGCCAGACAGGAGCGAAATGTCCGACTGTTTGCACAGATTGACGCCATTAA
AATCAACATATGACAGTTTTTTCTTTTTTTGCGCCCATTTTTGTGGACCCTGGCCCTGGT
CACATACAAATGGGAATACCAGAGATATGTATGTATGTATAAATCCAGGCCACCTCTTAG
ATGGAAGTCAATGATAATCGGCCAGCGACGAAGCCACCACACAATCAGAACTAAAAACAC
AAAACCCAGACACGAAGACAAATCTGAGCTGGAGTCTTGCATGTTTTAAGCTGCCTGCTG
TGTGGATCCACATAAGAGGTCGTAAAAACAGAGTGTCATAAACATAAAATTGATTTTGAT
TCTTTTTTTTTTACGTTGTCACCGCTATCTTTTGGGTCTTTCCCACTCTCTCTCTCTTCA
TAGGCGAATGGTAAAAATCTGTGGGACAGCTTGGGGAGTGCTTAATTTTTAATCGAGTCG
CGTGGGCAGACCTTCACTTCACAAGGGGCCCCCATATAATATTGATTTCAGATGCCGAAT
CTATAAAGCATTCCAGTACACATTAATTACTGTTATTATTAGGACACTGCGCATTAATTA
TGAACGAGCCAGCGTAGATATTATATCACAAGTGTCTGAGCAGCCACTGTCCGTCCAGAG
GCATAACCATAGTCATACTTTTTAATGGCCCATAAACCTGAAGGGCCAGAGAACATTATT
GATATTCTCTGTATACACATATGTATTCCTAATTTATGGCGCAGTCAGCACAGAAAGTTT
AATGAACCTGCAGCTTAAAATCATAACTTCTATGGCTCCCGCCCATGATGATGATGATGG
TACGCCTATCTGCCTCGCAACAGGCGAGTTATTAAAACTGACAAGTAAGTCTGAGAGACG
CCGCCGCCACAGAAATAAGCGCAGCTAAAGTCAAGACCCCAAATTGAAACTCGAAAATAT
ATTACAAGACACCATACAGTGCGTCACGCATTGTTAAGGCAAGAGGAGCCGCACAGCAAG
TGGCTTTATACAAAAATTGTGTGGCGAAAACGCAAATAATGTGGTCTCATATGGTGAGGT
AACAAAAGCGGAGAAAGTACAAATATTATTTGCAATAGGGTTAAACAAATGTATATAATA
TCAATGGAATAGCAAACGTTGTTTACTGTTGTTTCATAAACTTGTAACTTGGTATACATA
TAACTACGAAACGCACCGTACTTTGAGCCTGGCTTACACAAATGCCAGTAGGAAATGCCC
GTGGCTTACTCACACATAACGGGGTCTTCTTCGGTTGGCATCGTCGTGATTGCCGCGTTG
TGGCAACACCTTTGATGCGGCTGCGCATGCGCCGTGAAAAGCTCGCAAGGAATGCATTTT
CCAATAATTTAGTTAGCGCGATAAAGTGGACGGGGCAAAATGGGGGCCTACTTGAACATA
ATGCGATTTTGTGGCCAACCAATTTACTGATGGATCGGATCTACCTCGATTATGTTAATC
GAGGAGGGAACCTAGCGTGGGAATCTGGCCCGGCAGTGCCTCGCAGCTGAGATTTCCACG
TAAGCCGCTTAAGCCGCAGAAGAAGTGGGATGTGATTTCTTCCTTCTCCGCCATCGTCAC
TGGCAAACAGACGAGTCCAATTTTGGGCTCTGAGCCATTTGACAAATAAGACTTTTCATG
TCGACATCATCGCGTTGTGGCAGGAGCAGCAGTGGAAGCAGCAGCGATTCGTTTTGTAAT
TATTTTGCCAAGCAACAAAATGAAAAGGAAAATTCTGTTTTCATGAAAACTGTCAGAGGC
CAAAACTAAAAGCAGACAGAAGATAAATAAAGCAATGCTTATTGCTGTCCTTTGGCTGTG
TGTTTGTCATGAAAACAGGACTGAAGACCGGCAAACAAAAAACCAAAACGAAAAACAAAA
ACACAAAAAAACAAAAAACAAGAGAAAAACAGAAGGCTCGCAAAAGAAAATGAAGCTCTA
GAGAAAACTTTCATCGTTTGGTCGAGAAAATTAATTAAAAGATAATGACGAATTCGCTGT
TTGAGTTTTAAACACATACATACACACACAAACAGAGATATTTTGTCAGAAAGCAATTAG
AAGCGGCAACCAATTATGCGAAATAGTTTACCCAGGCAAAGGCCCCTTAAACTGGGGTTC
TTTGGGGTCCTGGGGTTCTGGGGTCCTGGCCTATCCCCCAATCGGTCTTATCCGTGTCAG
CCCGCCCAAGTCACCCTGATGACCTGTTTGCATGTCTGGCACTTTGCCTGTCGACACTGA
CGCGCTGCCATGCTAAATATTGATCAATTATGTCGGTCCTGTGGGAAACTTGGCAATTTG
AGCTGTCTCTGGCAAATGCATTCGCACAATCCATCAAGCGAGTTTGTTCTAATCCAGTAC
ATTATATTCTTCCTTTTTTTTCTATATATTTGCAGGTAAGCAGAAGCATTGAGCAGCTTT
AAGCATCCGAAATTCAGAGCATATTCTGTGTGAACCTCCTTTGAGTGAGTATCCAAGGAT
TTATTTTGAAGTTGGGTCGTTTCCTGTCTGTTCAAACGAATGGTATTTGCTTTGTTTTCA
ATTGTCTGCAATCGCTCCATTTATGAGAACTCAAACATAAGCTGGGAACGAACGAAAGCT
TTCCCACACAAATTTGACCTGTCATCCAGGGGCATGTTTAGCAGGCTTTGCCCGCAGGAT
AAGTGCATAAATATAAATGAATATTTTAAAAGCTTTTCAAGTATTATTTAAATGCGCCAT
CTAAGTCCCCCTGGGCTCGTTCGTTTCGTACATATGGGCTAACTCTGGCTGGCTGGATGT
TGCGAATTAACATTCAGTGCGCCCCGAGCACTACATTCAAATGTCTGCCGGGCATTTGAG
TAACGTCGAGCTAAAAACTTCCTCTGACATTCATTTCTTTCATGGAGCTGGAAGCGCCTT
TTCTTGTTGCGGCTAGGCAGATAAGCAGATAAGCCAAGTTAAGGCGATTTCATGAGGATG
CAGAGGCAATGTTGAAATTTTACGCCTCAACAGAATATCGATTAGAATTGTTCAATTTCA
ATTATCATCCAGGCGACCGGGAAATGAAAAGATTTTCCCAGATGATGACAACGATAATGA
GCAATGGGCGGGGATTTCGGGCGGCCCATTCGAGCGGGAAACATGGAAAACGTGAAACGT
GAATTGCATAAAATTTAACACTAAATAGCAAGCCAAAAAAAAACCAAACAAAATAAAAAA
GTTGCTGACTTTCAGTGGAGTCTCAAATTGGGATTCTCGAGCGCGCGCCCCTTCTGTCGA
TTGATGCGCCAATAAAATGAAATAAAACAAAATTAATGAGCAGCCGTTCGTGCTGAGCCA
GCACAGCATTGGAAAATTGCGCAAAATAAATTAAATTAAGCGTTTGTTTCCCAGGATTTT
TCGTCCAAAATCGAATTGCGCCGAGTCGAGCCCAAGATGTATGGCATTTTAAAAAGTTTT
AGCCCAATTTAGCGCAGTTGATTGTAAATAAGTACATACATATATATATATATATATATA
TATATAGTACCTACTCACAGCGAGACGACATCTTCAAAAGCCAAGCAAATCGAAAATCGT
GACAGGAATGCATGAGACCGATTTTCCCAGGGGCAACTTGGAGACTTGGAGACCCAGACT
GGCCCTTTTTCACTCCGGCTTATTTATCCTTAGATCGCCTTAATTGCAGCACACAACGGC
ACACATTTGATTCAATCAAACACAGTCATTGATTTTGTGTCTTATTATTGCGCCTTTCGC
TTACTTTTTTTTCACCATTTTCAATGACTTCTTCGTATAATTGAAATTGCTTTTACTTTT
TGCCTCGATTCCTTTTTTTCTTGGTGAAGGAGGGAGAGCGCGCGATCTGGCTTGAAAATT
TATTTAAAGCAAAAGCATTTTCAATTAATTTTCCAGCAGCGGTTTTTGGTGCCAGCCGAC
AACACCGCAAAACAGCCGCAAAGAATTTTATTTATTTATATTGAGCTTGCTGGAGCAAAA
GTGTCAAAGGACGCAGGACGCAGAAGGCAGGACGGGGGACGCTGGGTTTGAGGACCCCTC
CGAGTCCTTTTCTTTTTGCTTTTCATGTAGATTTTATTTGCGGCAAGCAGCCGCGAGTCA
ACAAACATACATAAGCACATACCCATGCCCAGGCCAAGAAATTGAATTTTACATGTATTT
TTAATATTTACCAAGCGGCAGCAGCCAGCAACAACAATAAAAACGAAAGCGACTTGTTTG
TCTTGTTTGCGCCCCAAAGGCAGCTACAGTTTTTGATGTATGAATACCCTTGTGCGAGGA
CCCCGGGTCCTGAAACTTGCTGTTGGAGTTTACATTTAAGGGTTAACACTGCTGCAGGTC
TTATTTTTTAAGAATAACTTTTTATTATTCTTTCCGATATCCTACAGGCACCGAAGTGTG
CACTTTTGTTACTTACTTTGTTTAAACTTTGCTCAATCGATACTTTTAAATATTCCTAAA
AATGCAGGTTGGCTTCTGGGAGCAATGTACTAAAGGGCATAAACTATATGAGAAATAATA
ACACAATATTATATCTGTCAGATTTTGATTATTTTCTAAAGGGTAGTACCCATTCAAGGA
CCTCCTTTCAGTTAGCAGCCTCATCTGCATCCTTTTTACCGCCGAGAAACAAAAACTGAA
GACAAAACATATTGAATTTCACCGCTGTCTGTCGGTTCTTTGCAGCTTGGCCCGCGCTTT
GTTATCATTTTTTTTCGGGTCCCACTTGCCATAATAAAATGGAAAATATTTGTTAACGTT
TTTATGCAAATCAATGACGCTGGCAAGCGAGCTAAGCAAGCGGCATGGCCACAGAGGAAA
AGATGCGGGCCAGAAGGAGGCCAAAATGTGTGGGTGGTGTGTGGAGTTGGTGGGAATTTA
TAATAAAATTTTGACATGGCGACAGAACAACTTGACAGCCATAAAACATCAAAAAGTTAT
CGCTCCATCGCTCCATCCGCACCGAATCCCTCTGCATCAGCCTCGGGCGGATGGGATGGA
CATGTGTCCTGGCTCCTTGGAGCAAACCGTTTTCTTATTTTCCGCTGGTGCCGTTCGTAA
ATTTTAAAATCAAGAAAATGCGGGAATTGCGTTTGTTTTTCCCCTCCCGGCTTCTCTCGT
CTCTTCACTTCACTTCACGTTTTTTTTTCGTTCGTATAGCCCTTGTTTTCATCATCAGCA
TTGAAATGCATAAAGTTTTTCGCAAAAGTTGTTGGCTGGATTTGTTTGTCGCAAAGGGTC
GAGAATGGATGGTAGTGAATGGAAGTGAATGGAAGTGGAGTGGGATCGAACAAGGAATGG
GTAGAGCCGAAGGATCTGGAGATTGTGAAAGTTTACCCCGCTGTTCGCTGGGATTTTCCT
GGGGTATTAGCGTTGTTAGCTCCACGTTTTGCCTGTGTTATACTTGATTTTGCCTTCCTC
TGCCATTGCCTTGGCCCTTTCCCAATTTCGTGTACCCTCTCTACCAACTTTCTTCGTACT
TTTCTTTTTTTTCCGCAGTTGACTTGACTTCACATTGCCTTTGGCCCTGTCGTGAAATTT
GCTTTGGTGCGTATGTGCGTTTTGGGGCCAGAGATTTGTCAGCCTTCGAGTCAGAAAGGC
TCGGCAATCTTTTTCTTGCGGTTAGAGGCGAAACCAATTTGTAGATTTGAAAAGTTTCTC
TTGAAAACCGTTAACAGGACACTTTGAATATTACAAGAATGAGGGGATGAGAGTCCTTCC
CGACATCTTGGCACTTTTTTATGCTTTTTTTGGCACTCTTGTGGCGGTAAGGACAAGCGA
ATAATAAGTTGGCAGGCAGCTGACACAGAACGAGAAGTTGGCTTTTATTAGCTGTGAGAG
ACCCTTCAAGTATCTGGTAATAAGTTTTCAAGATTTTCCCTGATAACCAAGTAAATGGAG
ACCGGCAGAGGCCTCTCGGATTCCTTCATTCTTTTGTGCCCAGTCACTTGGGACCTTTTC
AATACCCCATGCTCACCTTTTTACCATGCCTCTCAAACGAGGCAAATATAAATTCCGAGA
TTAAAATCTATATGGTGTGCATATTTCGCGCACCTTGACTTGTTTGTTTTTTACCGAGCA
CCCTCTATGCTTCATTCACTTTCAATAAAAAAGCATAATTCTGGTTTTACAACGCGAGGC
CGCCAAGGATAATGCCAAAGAATCGCCATACCAACGCACAGCGACATGGATGGCAAACAC
ATTCCCTCGTCCGACTGTTTGCATGTGTGTGTACGAGTGTGATAAAAGGGATTTAAGATT
CAGCGAACGATAAATTGCGGTAAAAGGTGTCTCTCATTCCGGGCAACAAGGATCCGGATC
TGTATCCTGCGGCCGTGTTTTGCTGATAGCCAAAATCTTTCGCATTGAAAACATGATTTT
TAACTGGCAGAGCTGAAAGGCGAATACGACAGCCTTCGTGTGTGAGAAGGCTGTTTGCAT
GGTGCACAAATGAAATGAGATTTCCCAGCTGAGATAGAAATACTTACTCACTTACAGATG
GAAAAATTGCGAAGTCTAATTTAACCAAAGCATGATATTTAAATGTTATTTAAAGATTGA
TTCTTAAATATTTAAATTTGAACCAAAATCTTGAATGAAAGCATCTTAAATCTTTGCCTG
CGGTCGGAATATTAATAACATAATATTGTAAAATCCCAAATAAGAAGACTTTACTCGTTG
AGTTTTTGTAAGAAACTGATTTTATTTGGAAATATCTTCGGTTTAAATAGGTGACATGAG
AATCGCATCTTAAAGTAAATGGCCTACGCAGAGGCCTAAGTAAATAGTCCCCGCCTTATC
GAGGTCCCACGCTCGGGCACATCTGCCTATCTTGAGCGGCGAGGACCTTATCTGTGGTCT
CCCACTAAGGGACTATTTTAGGAGGCGGGGAACGATCTCAAGTGACTGACTCATGTAGTG
TGCACTTAAATTACATGTTTTTGAGCAATGCACCCATGTCGCCTTAGATAACAAAATCCT
AAATATAATTTATCGCTCTCGATTCATTTACATAAGATATGAACGGAGCCCAAAATTGTA
AGTCTTTAAATATATTCGTGTTCATGTGTGAACAATATTTCTCAATTTTCTCTCTGTGCA
CAAACACGCACACAAGCGCGGAGGCAGACTAACGCACACATTCAGTGGCATATACATACG
TACGTGTTCCCATTCAGGTGGAGCATATGAGAAATTCTCAATTTGAATGCAAACATGCTG
GATTATTATGATTTTCTTCCTACCGTTGGCAGTTTTTCTTGTTAGTTTGCTTGCTGGCTG
GCTTTTTTTTTTGTGCTCCCAATGTGGTGGATGCTGAGCTCCAGCTCCTGGGTATTTTCC
GTATGCGGAATGCCTTTGCTAGGAATCTCTTTTTTGCACCGTGCTGTGTGACAAGTATTA
AGTGCAATCAAAAGAAGATTTACAAGCGTCATGAATGAAATATTTGCACCACATATGGCC
GCACACACGAACGATTCACAGATTGTATCTCTGTTTCTATCTGCATCCGCATCTGAAAGC
GTATCTGCACTTGCGCATAAAAACCCATTTCACGTGGCTTCATATTTATGGTTGCCCAGC
CCATTATCCCAAAACCAAACACTTTGTCTATCTTGATCAGTCCGCAGGCGACTTTAATTA
TTGATTATGACACAGAAAACTCAACTGGTGTCGGGTGTGGGGGGATGTAAAAGTCAGAAA
GGGTCAACTGGCAAAGTGAAAGGATGCGACATCCAGTTGTGGCAAAAAGTCGCTAATAAA
TTTGTAGCTCTTTGCTACGTGAAAGCGTGGCTTTTGCCCGCTTGGTTGTTTGTTTCGGCG
CTTTGGTTTTTCGTTACATTTTCCCAGGCGGTGGTAGTCGCATGACTTTTGAATAACCTT
TCCCACAATTGTTTGTGCTTGTTGTGCACCAAATTGCACAGACAATTGCCGGCGACTCAC
TGGATTCGTAGCTTCAGATTCGGATTCGGATTCAGATTCAGCTTGTATTCGAGCCACAGT
TGATTGGCGCAACTCGCTATCACATTCGCATATTCATGATGACACACACATACTCGTATG
TGCATGCATAACTAAGTAATACAGTCGGCAAACTGGAGTTCGCCTCCATGATTTAGCAAT
TGAGACGACTACTACGACTACGACTACGACGATGACGACGAGCCACGATTAAGATGCGCC
AGCTGGCTGGATTACATTGAATTGACTTTGGGGCCATAATTGATGGCTTTCCAATTCGCA
GGGACTCGCAACAGCCGTATATGGCTTAAAAGTCGATATCCACCCGAGCCTTTGATGTAA
TACAATGCGCGCTTCTCGCTTTTGACACTCCCCAAAAACTAATGATCTGGCAAGCCGCAA
AAACCAAGCGAATTCGAGTGTGGCTCGGGCTGGCTGGATGGCAGTTAATAAACGAGTACC
AATTCTCATGAGTGGTGGCTCTTCTGGTTTCACTGGGGTTTTAGCTTTCGCAGCAGATTG
TTCATTTCGAGTGGCACTTCTTTAATTAATAATCCATAGCCTGCTGATAATTGCAAAAAG
AAGATTGGCTCATTAGCATGAAACAAATATCCAAGATGAAGATGCTAGATTATCTAAGCT
GAGTAATAGCCCAGTGCTATATGAGTTCTTTAAAATATTTGAAAATGATAAGATAAAACC
ATAAAATATGTATTGTACACTTGTATAAACCACTTTTATACGAACATTTACGCGTAATCT
TCACTTGCTTTTAATGAATCATTTCCGAAAATTATTCTTGATTTCGAGCTGCCAGTTTTT
CTTTCCCGTCAAAAGTTTGACTTGAGCAGGCATTTAGAAAGCGATTTGTTCAAACATTTC
TTTGGGCAGTTATCGGAAGTTAATGGCTGCGCTGATAATTCCCCAAATTGCTTCTCTTGT
CTTTAGAGCATAATTTACGCATCGTCGCGGGCGAAATGATGTGTAATACGTATACGTATA
AATGTATGTATATACTATGTCTGCGCCAGCTGGCATGTGAGTGGCTCATAAAATGGCCGT
TCACAAAAAAATTGGGCTCGAAACGGCAGTAAAAATCGATGCAGGCCAGATATACACCGC
TGGCATGTGTGGCAGTATGTGTATTTACCAGAAATTTACCAGCGGGCTTTAAATTGTAAA
GCGTGTTCGTTCGGACGAAGACCCGCGCAAAATAATATGCTAAGGTTTAAGGTAAAATGC
GGAGCTCACGGCTGTGGCAAACAAATATTGCGCATACGCCGTGTTAATTTGCATTGTTAT
CAGACGCCGCCACTGCGGTTCGCTGATGCGCATCCTTAGAGGCATGGCATGGCCATATCC
CCGCTGCCGCCGCTCCACGTGGCGTATGCGTAACTCCATACGTCGGTTTGTTTTTATGCC
GTATGTGTGTATGCGTTATTAAATTTATTTGACTTGACGTGCTCACACACAGACTCACAC
ACACACCCGCACAGAAGGAGGCAACAGCAGCAGAGTAGAAAATGAAATGAGGATGCGGAA
ATGGCTACACAAACATCGGCAACGGACGGAACAGACGGAAGTTGCGTTCCAAGGTTTCGG
ATTCCAAGTTTTGCGGCTGCTGGTGGCTATGCAACTGCCCCAACCGTTCTCCTTTACATT
TCTCATTCTCATTTAATATTTAAATTGCTTGTGGTTAAAATATCTCATGTGCTCTTGTGG
CAATTTATATTTTAAATTATTAATTCTGCCTTATTACGTTACATTCAACCTTTTTTGCTC
TCCCCCAATTCTCTTTACCATTTTACCAGCTCAATTTCAAGCTCGACTTCATATTTATTC
AAAAACATACGCCATGCCCAAGCATCAGCTCACATGACTTAGATTTTTTGGATGGGGGCG
GATTTGCTTTTGGGTTGGCAATTGAATTTGGTCTCTCTTTGGATTTTCTATTTGCATTTC
AAAAGGAATTTTCAATTAAAATGTCAACATAATTTAGAATTATTTGTCGAATCTATTCCA
TTCGCTCATGTAAATGGGATCTAGGCTGGATAATTTAATTTTAACTTGTTTTATATTCTT
TAAAGGAGATACTCAATAGCCTTGAAGCAAAACTAAAATTGCATGTTGGGTAAACAAGAA
AAATTACAGAATTACTTCTCAGTATTTGCTTGTATCTTAAGCATTTCTTTAGAATTTCAT
TGCCTTCGATTATTTTTATTAAAATTCTAAAGCCATCGCACAACAAAAAACATGTGCTCT
TTGACCTTCAAAAATATATATTTATTTGTGTCCAATTGAATTCAATATAAGCCTTTGATT
TAAATTTCTTTAGCGATAACCCATTCTTGATTCCATAAATATCGGTTAAATGTTCTTTAT
CATTGTTGTGTACTCGCTTTCTGTATATGGATGTAAAAGCACTCTTTGATATTCATTTAA
ATCGAATAAAGGCAGATAAGAAGTGGCTGCTGCCATGTACAACTGAGTTGCTCTGACTAT
CAGTCTGAAATCCCCGCGCCCCCCTTACGACTATGTTCATATCGTTCTTTGTGCCTGATG
GGTATTAAAAACAAATACATTTTATTCATGGCTGCATGTCAAAAGTTTTCGGGGAATATT
TATTTCACAGTGGCTTGTATTTATGCCGTACATACCGACCTTCTCAATTCATTCGCGTCC
AACATTTTTTCTCTCTGGATGAAAAAGTTTTTTGCTTTCATTCAGCGAGTCGCATGTGAA
TTTTATATCCTTTATTTACGCATAACTTTTCCTCACGCGTTGCGCAACAAAAGTTTGTAA
AACCGCTGAAATGCAATTCGCAGAAGTTGCGCGTAACTAGAATGGCTGATGCAAATGAAA
CTTTAATTTGTATTCATATATAAAGCATATTTTTGTTGAGTTTTTCACAAGCTGAACTCC
GCAAAATGGTCAACACGTTAAGTTTACGGGTTTTGTTATTTAACCAGATAAACACGCTAA
TTGGTTGGCATTATTTTAAGCTGCTTTTGTATGTTGCCTTATTCCAATTTGGCATTAAAG
CTCATCAAATGCTTATCTGCTATCAGCACCCAGCCAACTGCTGAAAGCTACAGATCCTGG
CCACGCATTAGGACAAAAAATAAATGGAAGCCTTAATAAAAAAGGAAATGTCGCATAATC
GCGTGTGTGTGTTTGTATGTGTGTGTGACAAATGATACATAGCCCTAGGGAATGAGGGTT
TAGCAGTTCATAGACCCCCAAAGCAGACGCCCAGTATTTTTCATTAGGCGCGAAAAATAT
TAAACAGACGACAGGCAAAAATTATTATCCTGAATCTGGCAGCCAGCGGTGGCGATGATA
ACAAATTACGTATACGCATCACACATACGCCGCGTTGTCGCAGGAAAGCTCATCAGCGGG
AGCTGGCATTCCGCATATTTTTTTCCCGCCTGTTATATTTAAGCATCGTTTTAGCTCCAC
TCGAGGCAACGTCTGGCTGTGGCAGTTGGCCCTCTAAGCTGTTGTGATTGTCAGTTGCGT
TGCTAAGCTGTTTCAGCCGGGTTGGGAGAAAAAAAAAAACAGAAGGAGGAGTAGGAGATG
TTGGTTCCATCATCAGCAAACAATTGTTTACTCCTCCAGCGATGCGTGTGCTCGGGTCCT
CGGGCACTTTATTATATTTGTAATATGTATTATGACATTTCTTTTATGGGCTTTTCCCTC
TTACCCGATGATTTGTCGATCGAGCAATCGGCACGGCGCAGTGCGTTAAGCATTTATTAA
GCCCAAATGCGAGGGTGGCATAACAACCAACTTATGGCTACCCAAGCTCACGCAGGAAGT
GGGCGTAATTGCGTTTCTATGTTTGCTATTTGTATGCCTTCATGTGTTCATTTCCGCACG
CAAATAAACAGGATAAAATCAGGCAATGGCCAGAGATTCAAGCAAACCCGAGTGCCACAC
ACCCACCCCCTGCTAGAAATTATTGATCGAAATACAGGAGGTGCGGTTGCGATGGGGGAC
TTCCTGAAAATGATCCCGAGGCCACATAAATTCATTCTTTATGAAACGCAAGCATGCCAG
ATTGAAAGGGGTGTTGACAAATCCTGGGGCCCCAAAGCCTGACCTGCGGCACTTCATAAA
ACGTAATCCGAGTGCCAGGGCCGCTTATGACAAACATAATCATTAAGCCATTATTATTAT
TACACTTATGGCGGGCGGGTTACGCCGCCTCCACGCACATAAATTACTCGAGGATATTGT
GGGTTGGACTGCCGTGCCAACCGGAGCAATTCTCAATGATTTACGGTCCATATTCCGATT
GCCGGCGAAAAAGGATGGCAAAGGATGGCAAAGGAGCCGAAGGCGACGCCGCTGCGTTTC
CATCGATAAACAACTCAAAATGAAATGCAATTCCGAGGGAAAATGCAAAAGGAAGCTCCT
CCTGGCTTCCAGGAGCCACGAGTCCTGCGACTGTCTGCGGCAGACCATCCTGCGTATCAA
GTGTGTGCACAGCCTGACTTGTCCATCTATCTGTTTGTCGATATTGGAAATCCGATTTTA
TGGGTTTTTATTTCGTTTGACTATGCGCTGATTTTCAATTGCTTTCGCACTCGCTCGGCG
TTCACCCCATTTTCCTCCGGTCATCATTTTAATAATAACTTTTGCCAGGGATGCAGGACC
TTCTCGTCGAGGTCCTTGTGCCCCTTCTTTTTTTTATATCCCAGTGCGGCAAATTGTTTG
TCTTTCATTCTCCAGTACCACTACCATTCGTTCTCGTTCTCTGCGGTCCCAGCCTTATTT
TTGATTTTATGAAATATTTATGTCTGGCTTTGGTCAGCAGGGAAATTGATTTTTCCTACC
ACCTCTTTGGGGCCCCCAAGAACCCAATCACCCAGGCACCCAATCACCCAATCACCCAAT
CACCCAATCACCCATTCCCCATTTCACTTCGCCTGTCACGTACATGTCCTGCGACAGCCT
GTTGAGAAACAATTACAGTTACGCCCAGCGTCCAAAAAGGACCACGCACCTGCGTCGTCC
GTGCAAAACAGGTGTTGACATGTGTCGCGGCAACGAATTAATAAATATTTTATCATTTGT
ATAAACACAACATTTCATTAATTTTTATATATTTGTATTTGTGGCCGCCGGCATGCGCGC
ATATCCCTTTGTCTGTGACTATGCATATTCTTCTTAATTAATCGGCCGTGTCGCGTAGTC
CTTTGTGTAAAATTATTGGTAAATGCAGCCGGCAATTAAATACTTAATGCCAAAGTGCAG
AGTTAAACAGCCGCAGCGCATTGCAGCGCAGCAGAGAAACCAGAGGCATTGTCAACATCA
TCATCAACAACAAAGGCAGCAGTGCCAGGAATCGCCATTATCGTTATGTTAATGGAGTGG
CGCTCCAAAAAGATGGCCATAATAATAATAATAATAATAATGATAATGATAATGATAAAA
ACGATAATGTGGACAATTCCTTTTTGCATATTTTCAGTATTTATTATCAAATGCTTTCAA
TTGGGTTTCAACCAATTAATTTTCATAATGACCACATAGCCGCTGTGCTTCAAGAGCGAC
GTGCGATTTCAATAATTTTAATTAACCTATAGACAGTGCTTAATGTTGCCTGTAAATAAA
TTAATGTGCCAGCCGACAATGCCGTAATGCTGCTTAACTTGTTAATCCTTGCAATCCCGA
AATCTAAATGCCCCTGAAACGGCATTAGCCAGTTTGACACTTTTACTCACTGTTCTTGTC
ACTCAGTTACTTCTACTTTTATTTAGACCTGCATATTAAAAACATCATTTTTCATTTCCT
GCTCCCCGAAATAAGTGGGTGGTAGATGTTTGGGGTGGGGTGTCAAGTAGTTGGCAGTGG
GTGAAGGTCGCACGCACATGACGACAGTCATCAGTCAGTTGGTTAACTCGCTGTGGCCCG
CTTTTGGCCCACTCTATGCGTTTAAGTGCTTGTTTGAGGTTTACTCGCAGTGTGACCATA
ATCTGCCACAGACACTTACACACACAGAGCGACGTCAACAGATAAATAAACAAGGACGAC
AAGGACAGACAATCGGCATAAGACAGAGACGGGGCGAGCGGATATAAACGATGTCCTGGC
ATAGCCTGATTAATGATGTTGCGACAATAATTAATTATATGCCTGCATCGGGGGAGTGAC
GCCTGGTGAATGGTTGGGTGTGTTGTAAAATGTGCGATGTGGAGTGGGCTCAGTACAGGG
TTTTAGTGTGGCCGATACCGCAAGTATTTCATTTCATTCGCGCAGCGTTTTACATGGCTT
GGTGTTGGTAAGCCACAAAAGCCACTAAATGTTGCCTAAGCCATTTCCACGGTGGACAGT
GGCGTAGGTTTGGGTTTTGCCGGAGGTTCAAACTCAATATTTACCAAATTACGCTTCTGA
ATATAATGGTAAGTTCCAATGGTAGCTTTGAGAATGGGTACAAGCATCTAAATTTAATCA
ACTGGAACTCAAAACCCCTTCAGAATTTTGCTGCAACCTCCTTCGTTCTAATGTGAGCTG
CGAGCACGTCAAAATATATTAGACTCGATTGTTATCGGACACTCCTTTAGCCACTCAAGT
GCTGGCAAAGCTTTGGGGTAGCAATTAAAATGCAATTTAAGATATTTCTGCATATCCCTC
GCCTCGAAATGCTTCGTCCGTGTTTTTCGCGTTCATTGCCAGCGCGTTTTTCACCGTTTG
CCAGTGTGTGAGTGCATGATTTAGACATTTCAATTTGCATGTGTTAACATGCAATGCAAA
AAGGATTCGATTCTTATCGCTGCCACATGCCAAAGGCCAAAAAAAAAAAGCACTTCCAGG
CGGGAGCAGTGCCCGAGTCCTGTCTGTGGATCCCAGAAACTGTTGGCCAGTACAGAAAGC
ACTTTCCGCCACTTTCTTTACTTCAGTTGGAGTCGAGGTTTATAATGGCGCAACTTGCAT
GGCATGCGATGTGCAGCACACTCCCACATACTCAAACAGACATATGTATGTACATATATG
TGCTTTGCGCTTTCCTTACCTCTCCGCAAATGTGGAAATTTGAATATCCTGCGGTAATTT
CCACTATTTTTAGTACTTTGTTGCCCTTTTGAACTGTCATTACTGCGGCTTGCGGAGTTG
AGTGAGGAAAATGCTAGAAGAAGTTGTCGCAAGGGGTTAAGCGACTGCCTGCTGGGTTTG
GGTTTTGGGGGTGGCGCATCTTTTGTGCCATTCACGAGTTTCTTCGCCCTTCCGTTTTCC
GCTTCTCCCTGTCCCCATCCAGCCCCCACAATCCTTTATTTGCATGCGAGTTGAGTTACT
TTTTATGGATTCCTGCATAAGCGGTTGGGTTACTAACAAAAAATATAGCGACCATTTATA
TATATATATATGTATATATATTCCGCAGAACTTGGCAAACTTACACAACTTTGATGGGGA
TTTTTGATTACTTCTCAAATGGCTTCCAGCTCCATCAAGTGCCCCACCGCTCCTCTTTCG
CCCTAATGCGCAATTAGAGCGCCATTCGTTGATTGAGAAATTAGCCAAGTTTGAGCTGCT
CCCGTCAAAAGACCGTTTTCGGCGTGGCCGAAAGGACTTATGTGGCATTAAAACGTTCAG
AAGCCATTCTTCATTATGCTGGCCAAAAGCGGATGACTGCGGACGAGTGCGAACGTGGTC
ATTGCGTGAGCCTCCATTTTGGCCACTTTCCCAAGCATATTTCTGTGTGCGTGGCAATTG
TCCGTAGTTGGGCAAAAACTTGGAACTCGCATCTAGCACTGGGTGCTGTTCAGAATGCCA
AATGTGTCCTGAAATGCTCTAATGGCAATAATACTAATTTTTGAAAAATTATACTCATTT
ATAGCGAAGCAAAGATATTTGTACTTGTACAAAATATTTGTACTTGTACAAAATATTGTA
CTTTCAAAATCGAGCATTAAATTTTTTCTCTGTGTACTTAACCATCCAATTTCTCGCCTC
GTCCTAATGTTGCGCCTTGGAGTTTCAGGGAAATTGACCAGCTCCACTCGGGCGATTTCC
ACTAGCACATTAACCCCGAATCGGTTAAAACGCAGCGAGAGCCCCACAAAATTGGCACGT
TAAAAGCGTCTATAAAATGCATGTGTAAACAAGCCCCGAACTCGTGTCCAATTATGGCCG
GCACACACGGATTGGTGGGGCAGGAGCTGGTATGGTATGGGGAGCTTTAGGAAAAAGGCG
CTTGGTGGAGATGATGAGGTGGGGCGGAAGCCGAAAGCAAACTTTTATCTAAACAAACAG
CTCGTTTGGGCCAGGCCAAAATGGACGGCAGTTGACTGGCGGAGCAGCGAGGCGCGGCAT
GCTAAAAATAAATGAAGACATTAGCGCCGCTCAAATGACATGTTATCGACTTTGAGGGCC
AGCGGGCCAAGCGATGGCGAACACCGCAATTACCGTTAGCAACACACACACACACTCGCA
CACACATGGCCGTGTATGTGTTAACCTGGATCATAAATAAAAAGCTATAATGGAGGTAAC
CTTTTGGGGGCAAAAAATAAAAGACAGAGAGTGAGTGAGAACAACGCGGCTGTGACTGCG
TTTGCCTTTCAGCTTTTTTAAGCGCGCTTCAGATTCTTGCGAATGATATAGGAACATGCA
AACTTCCGGCGGAAGTGCAGGCGCGCGACAGAGACGGAAGACCATTTCCCCCGTACTCCC
AAATACACGGACACGAAAAACCCATTAACACACACGTACACACTCATATATGTGCACACA
CACTTACTTCGTTTTGGGTAGCCGTTTTTTATGTGTTTGCGATAAATTCTCATTTCGCCG
AGCTGCGCTTTTTCGCCGCAATCAGTTGGGTGGAAGCAACATAAATATTTTACCATCCAG
CCAGACTGACAGACAACCAGGCAAACGGCAAACAGCCGAACAGGCGAAGGGTCCAACGAT
CAAGGGAAAGGACATTGGACAGGAAATGCTCGAAGGCGCTGGCGATGCCGATGGCGATGG
CGAAAAGGCCACCACATAAAGTTACAAAAGTTGCGGCATTTTCAAAATGCAAATTACCAT
GTGCGAGTTCTTTGGACGCCTTACCCCTTGCTCTCTGCCCTCTGCCACTGCCCCTAACCC
CCCCCCCCCTCGACGCCCCGCTAGCACTCAATCAAGCCACTCGAGCCCATCAATTAAAGG
TCATTTACATGTCAATGCAGCGACCGGCGGCCAGCAGCAAATAACGAGAATAACAGCAAC
AAACCGCAAAGTTTTACACCCAGCACAACTTCTCTGTAATTGAAGCATTTTAGCCCACGT
CATTCCACAGATTTGTATGGCCAACTGAAAACAGGGGCGTTGATTACTCAAAAAGGGGGG
TTTCGAAATGAATAAAGAACAAGGTGTCTAGACATTATTAGTATGTAAGATGTGCCAATA
AAGTCCTGATGACTGAAAAACTGCAGATCGAAGCATCTGATATGTGAGTTTAAAAAGCCC
CCTTTGCCGACGCCTCTGTGTAATGGCCCTTGCATGTTTATGGCCCCCATTAAAAATCAT
GCTCCTTTGGTTGGGCGCAAAAGACTTTTGTTACGAAATTGCATTTGCTGTTGCCAAATA
CTTTGCAGTTTGTAATTTTAACTGCGTTGCAATTTGTTAAGTGCAATGGCCAGTGTGTTT
ATTTTGGAGAATTTAAGTACAGACCCATGGTCTAGCTACAAAAATAAAGTTATTAAATTC
ACGAAAAGATTGCCAAACAATAACTGGCCACTGAGATTATATGTTTTTGAGCGACAGAAA
TTAATTTAAAGCCGCTTTAATAGCCAGAGAACTAACACGCAAACGCATAACGACCGCTAA
CGCACAAACTGAGGCCAACAAACGGGCCTTTGTTTCGTCAACATCATAATGTCGCCCGCT
GTGCTGCTTCCGCGACAGCGGCTAAAAGTTCCAACCCATTCCACCCCTTTTTGGCCAAGA
CCCCCCAGCCAGCAAACAGCAGCAAACAATCCGCACAACACCAAACGACCGACCCCCCAC
CCACCCACTCACTCACTCAGACACCACAGAGTGTACTAGTCTGATTTGCATTTTCGACAT
TGTTTGGCCCGATGATGAGTGCCACGCCTCCGTCGCTGATGGAACCCATTACCAACCCAT
TCCGCACTTGGCATCGACGGCAATTTATGTGTTGCATTGTTTATGACAGATTTATCGCAA
GTTAATGACATGCGACCGCTGATTTATGTAGCCAACACAAATATGCCAACGAAATGACGC
GGAGCTGACAGGACGAACGCATACGCATACATACGGCATCCGAATCCATCTGAATATCTG
AATGCAAGGATCCGCCAGATAAAAGCACTAATGAGCACACCTCTGCGGATCGAAATGGAA
TATATGCCATTTGATCCGCACTATTGGATGAGTGCTGCAAAAAAAAAGAAAAAAATCAGA
TTATTTTCACATTAACACAACGGCATTTTCCTTTCGGCTTTTTAACTTCCTTGAAAGAGG
TACTTAACTTATATGATACGATACGATGTTGTTGGTGACCTCAGAATATAAAGAAATTAT
AAATTACTATCCTTTTTTAGACTGCATTTTACTTCACACCTATTTCATCTATGTATAACA
ATTTCCATGTTGACGGCAGTCTGCGTAGTGCCAAAGTTAATTCATAAAAAATTAATCATG
TTTTTTTTTGAGTCGCATTTTTAAAGTGCCATATTTTACACAGTTTTTTAAAGAGTATTT
GATGGTTGGCCTATCCAGTTTTCAAGTTTTCACGTTCATCGTGCAGTTTCTTTTCCTTCT
GTTGGTTGGGCGCTGTAATTTTAATAATAAGAAATTGTCAGCGCATAAAATGAAGTCCAG
ACAACGGCAGCTGACACAACAACCCTCAGTAGTGGACCTTACTGAACAGCATCCAATTCC
CGGACTGCCGCCACTTTTAATTTAAAGCTGTTGTTGATGCTCGTATATAATAATAAGTGC
TGGCTCTTCTTCTTCTGTAAACTTCCTTTCTGGTCCCGGACATGCAAATATTTATATGCC
AACGTTGAACTTTGTTGATTACAAAAAAAAAAAGAGCGGAACGGAAAGGAAAGGCACACG
AAGAACGGAGCAACAAAAGTGAAAAGATTTTTTGTATCATTCAGATAGGTTTTTTCTCCC
AGTTGGCTGAGTAATTTTTTCGTTTTCGGGAAGTAGGTTAAGACACACTTTTTTCAAGGC
TTTCGTTTGCCTGCCTTTGTACGCGAATAAGTTTATTTGGTCAAAGGTCAAGTGTAATAC
AGCCGAGAGTGATGTACTCGTATAAATTCTACACATACATTTGTATATATCTGCACGATC
CTTTGCGTGCTTTGAGAAATGGCCTAGCCAATTCGGGGTTCCAGTTTTTTGAGGTCAGCC
ATATATTTCAATTAGAGTTGAACATGCAAAGCATAAAGAATAAAATTCCAGCGGCATGAA
GTCAAACATTCTCCGTTTTTACTCCGTTTCTTTTTTTATTTTTTGGCTTTTGTGAAATCC
GAATCCCACAGGCTACAGAAAGCCATCGTGTGGTAATGCTAATAAAAGATGATTTATGCG
TGTGGAAAATGAAGCACATATTCTCGTGCAACTTCCCAGGGAACTTTGTTGTGGTTAATG
CGTGCGACTCGCTTCCTGGCCAACAAGCGGCAGCAGCAACATGGCCATATCGACTTTCCA
CTCGTCGAAGAAGTAGCAGAAGGTAATTAACACGCTGCACAACAGCAACCACAACTCAAA
ACACCTAGAGCGTCAGCAGCAAGAACAATGCATAAATCTACTTTCCTGGTTCAATGCGCC
GGCTGCGGTGAGCAACAACAGACGTGATTAGAAAAGAAAAGAAAAACCCAATGCGAGGGA
GCCACCGCACAAGAACTAGTTTTCTTTTTCGTTTTCCTACCTTTAGCATAATGGGAAATC
GAACCCGCAACAAACGGTAAAAAAAGAAGGGGGGAAAAGAGCCGCAACGGTATAAAGAAC
TTCAGCTAACCATGTTGCCTAGAATTGGTAAAAAGGCGACCGAGGAAGCTTAGAAAGTGC
TGTGGAAACCAAAGCAGGCCAATGAATCGTTTCGGCCACATTTAAAAGGCTTTTCCAACT
AAGCACAGTAGACTGGCTAAGTGCATCCGAGCGCGAATTATGCCCATGAAACATGTGTTG
TAAAAGATACACAAGAGGGAGTTGCAATTGCAATTGAAGTAATTACAAATGCACAACCAT
TCGGCGGCGGCATTCTATATTCTATATTCTACATACTAAATGTGCCGAACAAAGGCTGCA
AATTGCTGAAAAACTCAAACAAAAGAAGAGAGCCGGCGAGTTGCATGAATGCAAGACCCA
AATGCATACACAAATAAATTAGCAACTAAACAAAAAACAAAGACGAGCTCCAGCAGCTGC
TGCGATGTAATTATGTAAAAAAAGGAGGGGGCGGCTGCATGCATCCACATGAGCTCCATG
CTGCTGCACACGTTCGCCCGGCCAACGTGGCAACGCATTTGCACATTTCATTATTTAACA
AAAAGATGGCAGGGCAATAAAAATGTTGCCTGCCAGCAAGCATCACTTCTATTAACATCC
ATTGAGAGCTGGCCGCCCTAAGCAGGCCTCATTATGCAAACATCCACAGAAAGGCTAGAG
CTTTGGATCTACCGAGCCCATGTCTATTAAAATTAAAATGCGCTCGTCTCGTTTTTTTTT
TTTTTTTGTAATCTTTCATTCGCAAAGTAAGAGAACCAAAATTGCCACATAAACGCGGAA
AAAGGGGTACAGGGGAAACTGGTCTGCCACTTCAGTGATTTTCAATATGAAAATGCAGCC
AGACACAGCTGACAGATAGACAGACGGACAGACAGAGAGGCAGTCGAAATGGGGGAGTTT
GGTGTGGCATGAATGCATGTTACCGCATGCTTGGATGAATACGAATGCAGGAGCATTATG
TGGCAACAGTCAGGGATTGCGGTTTTCAGCCTATGCAAATTAGCAAGATATACGTATAAC
TGACATAAACGCGGTGCATGATAGTAGGATAGTAGATAACAAACTGCTTGCATTTATCGC
AGACATTTAACAAACTTATCGTAGAGATAATGGCTGTTAAGGAGACTTGACCACACAACA
AGAAATAGTTCAACGCACCATTTAACTCACAAATTTCGTTTAAAGAATATAATAGCATAA
TAGTTAGTTGTGAAGCACATATCATATTTTATGCTGTATCAGGTTACTTCAATGAACTAT
TAGGATTATTTATATACTATTATATAAATTGGAATATATTGATTTTTTTTTCATCTGTGC
ATCTGCTCAATTTATGAAATCAACTGTCGATCCATAAGAAATTTAAATTGGCTGAGGTGC
CGAGGTGGCGATGAAAATGTTTCGATAATCTCTGCTAAACATGCCATGTAAAATGATGAA
GAAAATCGAAAGATTAGTCCGAAGCGCAGAGCATGGAAAGTCAAATAAATATTTGTGAAA
ATACAGCACACATATTTGGTATTCATTCAATTTTGGCTCGAGTCCCTAACCCCGGAACAG
TAAAAAGGCAATTGAATTAGAAATTCTTGAGAAGTTGTCAGTTTAGATAACTGGCAATTT
GTATGCGGCGAGCAATTAGAGAATTTTTGGGCCTCAAAATAAAATAACAAAATAACCAAA
TAACAGACACACACGAATGCGACAGACAGGCGGAGATGAGCTGATGAATTTAGTCAGCAG
GAGCTGGCCATGCATATAAAATAAACAAAGAAATACAAAGGATGCTTCCTTATTTATGGT
CGAGTCCCAGAAATATATTCAAATATGTAGATTTGCCAAGTTTATTCCCCATGCCCCTTT
TTTTCCCTTCTCCCCTTTTTTGCAAAGGCAGGCAGGAAATAAACGAATTACAGAACACGA
CCTTTCCCATTTCGACCCTGGTGAAATTTGTCATTTATTTGCAATCTGGGCTTAGTTCTT
AATTATTTTCTTGAAACTGTTTTCTGGCTTTTTCAATTTCATTCGATTGGCCCCGAAATG
CAACGCAAATTGAATAGAATTATTCTACAAATTTGAATATTCTTTTTCGAGAGACTTTTC
GGATTTGTCCTAGCCATGCCCGTTGCGAGTGATTCATGTCAAGTTGCAGCAGCACTCAGT
CAACGTAATCCTTTGGCCGCCTCTTGTCTGCATTATACGCTCTTGACTTGCAAATTGTTT
GCGGTTATGGCTGCATTGCAAATTCTAAGTAACAGTCAGCTTAATTAAATTAAGCATACA
CATCCAGCCACGCCCTTAAGCGGCTGCAATGGGGGCGACATCGCTCATGAATAGGCATTA
CGTATGCGTTGAAATTTAAGTGGCTCACACACACACGTGTCGTTGGCACACCGAACACAC
ACTTGAACACACACACGGACACGGCTTGTTTGCCACTTCTGCGTATGTATGACATAATTA
GTGTCATAATGACACTCACCCACACACATGCTATGCTATATATATGTGCGCCACTTGTCT
AGCAGACGAAAAGTTGAAAATTCTCTGAAGAAATGGCCCCACCACACAAGTCATTTGGAA
TGCTAATAAGATGCCCTACTCTTTCACCTACATCCTTCCACCTTGTTTGCGACCCCTCAG
CTAATTTGCATATTTTTCACGCTTTTTGTTGCAGTAAATTACTTAAAAATACATAAAAAA
TGTTCAACCGACTGCAGATGCATCTGTAGTGGACGCCAGGATACAAGGATAACACATCTG
CCTTTCTCCAACCAACAAGTACAGTTCTGAGCAAGGTAAGAGAAAATAAATATTATTACA
GCTCTCCATGCGCTGCTTGTAAATATTGATTACAAATTTTATAAATAATATCCAAAAAAT
GCTTTGATTACTTCTTATTTATATATCATTAAATATTTTATTATTCCATTGGAGCACAGT
TTTCATTTAACCTTTTTTTTGTTGTGGTTTTTTGTGTAATTGAGCATAAAGCGAACTACA
AATATAAATAAATTGCATTAAATAAATATGGCACTGCCGTGGACAATAGACAAAGTGGAA
AAAAAATAGAGAAATAAAAACCGCAATTATTTTCATAAATGTGCAGCACATTGGAATACC
CTAAAAAACAAAAAAAAGGAAAAGAGCGCGGAACGCTTCTAAATTTTCAGCACTTTCCCC
ACAGAGTTCATAACTTATCACACACTCACTGTCAGCCGCACAACCAAACACACACCCACT
TACACACCCACACTTGGCACTTGTTGTTACTTTTTTATTGCCACCTCTTGCCACACCATC
TCCTTCGCTCTTTTTGCGAAATGCAAAATGCGAAAATGCATTGTGACAGCCATTTTTTTT
TTTTGTAAATGTCAACAGGAGGAGCACGAAAAAATACGTATTCGCCACAAACACTTTGTC
GCCGCTGTGTTGCATAAGGAAAAACACTTTTAAAACATTTTCAGCGCCGCTTTTATGGGC
GTCTAAAAACAAACGGGGCGAATAGAACAAAAAAAATGGCTGAAAGGCTTTACGCGGCAG
CGGCCACTATTAATGTACTTTTATTTTTTTCATTTTGCGCTAGATGTGGCAGCGTGAGAA
GGTTCTTAAAATATAAACAAATGCTGTCACGCACGACATTTTTTTTTCTTTTTTTCCATA
ATAATGTACATATCACAAATATCATGATACAAATAACACTAAATGGGCTCACGAGTTAAT
CTTTGAAAAAAGAATCACCTTGCCCCGAGCAGTATGCAACACATATAAGCCATCTCGAAT
ATATTTTGCAGCTTAGCTTGCTGCAAAAGCCATGTTTTTTGTACCACATGTACTACAGTA
GCTCTTCGAGTTGGTAGACAAATTATGCGTTAAGACTGCAACCCTGCGGCTTAAAAAGAG
CCGAGGAATTTAATTAAATTTTGACAGAGTTAGCGGAGGGCATGAAAACCAAAAGCCCAG
CCGAACTGCGTTAAAGCCGAGCACTGACAAACCAAAGCGGCAAGAGGCGAAACAAAAAAT
TGCTGAAAAATGTTTAAATTTCGCGCATGGTTTTCAATTGGACGCGCTGCTAGAAAACGC
GAGCTTTAGAGCCCACTTAATTGGTTTTCGCTAGGCAACGGCAAATGCAACGGCTGCTGA
CCGCAAATTAAAATAAAAGCGTTGGCCAAAACCCACGAAGGCCAATGGCGTATTTGGCCC
AGCTGAAGAATAAGCAAAGCGGCTATACAAAATTTAAATTGCATTGCCGGCCCGTCCGTT
TTGACCATTTTGCCCGCCGAATGCGGCGGCGACCACGTGGTGAAAGGACAAACACAATGT
GCACGGCTTATTCGACTTTATGCAAATTGATTGCATAAATAATTTATGATTAAGGATCGA
GCAATAATTTGCCAATTTAAATGCACAATTAGTTTAATTGATGCGCTGTCACACGCCCAC
CAATGCCAAAGTGCAAAAATCTATAAAAAATACACAAGCGTCAAATATGCAGCTGCAATC
CGAGCGAAACAAACTCGACGGCTCTGTATTTGACAAATAAATAATAAAATGTTTATTTCC
ATTTCGAAAATGTTGCCATATTGACAGTCCGGCCAGTACATAATTATGCAAAATTCAGCG
ACAGCGTAAATAAATATATAAAATAAAGTTCCAAACAAGCGACTGCAATTAAAATTAAAA
ATTAACAAAATATTTTTTCCAGCATTATAATCACACACACAAACTCAAAATTAACACCCT
CACATGGATGCCATCGAGTTAAAGCTCATTAAATTTGCATTTGCATAAGAAATGCATAGT
TTCAACGCTCCGCACGCCCGCCCTGCCCAAAAAATTCCAACGTCATCAGCCCTTCTTAGC
CAGAAAAAATATATATATATTTTAACGAAAAACCAATTAATTCAGCCAAGCGGATGGGCT
GCTCCTGGTGATGTTGGTCCTGCAACTGAAATATTTTCTATATGGTGCAGCCCATTGCGA
AAATATGTAAATGTACCAATTTCATGTGAATTACCATCAAATTATTTTTTGGTTTTGGTT
CTCGCGTCATTCCCGCCAACAATTATGCAAAATATTTTTGTGTTTATGGCAGCTGCTGTA
TCCAAATATTAAAGTATAATTAAGAGGTGATTACCAGACGGAACTCCTCATAATTAATTG
CTTTGAAATCATGGAACTCCATTTCGGAGCTTACCCTTTGTATTCTTAAATGTTCGAGTT
CAGCGAGGTTTGAGGGAATACCGCATAGCACATTTATTCAACCACTCAGTGTTCCACTAT
CTGTGCAGCTATCAGCACTTTTTACTCACTCATTTTTTCATGCACTTTCCACTGAGTCCG
CGTGGAACGTTCATTAAGTTCGAGTGTTGGTCACAAACGTTGCGCATAAAGTGCACTTTA
CGAATTCGCGCATTTTTATGACAAGATTTCAGCTTTTCATTTTCATTTTCATTTGAAACC
AAAAGGCCACGCAACTCCACACCCTCGCCATCTATTAAGGCTGTAACGAAATTTTTATTT
ACTTTCTTTTATTTGTACTTTGATTTAATGGCCATAAAAATGCGGGGCGAAGGAGCCAAG
TGAACGCGCGTGCATAAAAATCACAAGGCACGCTGTGAATTTTAATACAACGCTGCGTAT
ACGTAATGATTTCACTTCGGTCGTCGCCATTTTGATTTTCCATTTCACCAACAACCGCTG
TTGTTGTTGTTGTTGTTGTTGTTCTGGTTGTTGTTGTTGCTGTGGTTGCTATAACTGGTG
ACTTTAAATCTCCCTTTTTTACCCCTGCAATTGAAACATGAAATTGCATTTATTGTGCGG
CAACAATGCAAACAGGGAGCACTGAATACTGACAGAGTCCTGGAAAATAGCCTTATGACA
CCCAAAAAGTAGGCAGAGATTTTTGATTTATCACCACAACGCCACACACACACGCACGCA
CATGCATATATGCATAGTGGATCGGCATATACATATATGAATACTTATGTACATAAATTG
AAATGAAGTGCCAGGCACTTTTGTGACCGTTTCAGAGATTTTAATCTTTATTTATAGCCA
TTGCGGTCGGCATTGTCCTGCGAGCACATCCTGCATTTTCGCGGCTATTGATAAATTTAT
GTTAAGCAGCATCGGCACTCTCAGTAATTTTTGTTGATAAATGTTAATGTCTCTATAAAC
GCGTGTGAAGCATATAAATATATCAACATAAATGTCCATTTTAAATGTTAATCAAGGCGA
GGCCAAAATCTATCAATATTTATAGAGGCCAGAAGTCCAACAAAAAACATTCAAACTAAT
ACAAAATATATTGTAACAATAAATAACCCAAAACAGAATGGGGACAAAAAGCGCCAAATT
CCTACGGTTTTCGGCCGACAATGAAGGGCAATCAATACTTTTTTCTGGCCACTGCAAAAC
CAAGTCGGACATTCATCGGATGTGGTGACTGTTTGTCCGTCCGTCCGTCTGTCTATGTGC
AGTCGTTGCATAAAGCAATCAGTGCAAATATATACACCCAACTGTGCTCTTACAAATAAA
TATTGCATTGGGATTAAGCCCCATCACAGATAACTCTATTCGCATGGTATTCATTTATTT
CGTTATTTTTTTTTTTCAATTGTGTCTGGAATTCAGAAGCGTCACGCGGAAATATGTTCT
GTATTTGGCTGCACCTTTTTTTAACGCCAAAAATTCACTAGAATTGTTAGCAAAAAAAAA
AAAAAGCTTGTGCAGAAAATTTAATTTAATTTAAAATTTTACTTGCAACTAAAATCCCTT
TCACACATTTGAACATGTTTATTTACTGAATAATCTTAAAAATTCTTTCCAAGAAGGAAG
TGCTAAAGTTTCCCGACGCCGAGCTCAGAGCCAATTGGCACCAACGAAACTTGCTAGCTA
AAGTGTCTTAATTATCGCAGCTACAACTTTAGGTGCTCGGACTGCTGGCCAAAAAAAGAA
TGACGGGGGACCCCTATTGAACTAAACCGAACAAACAACCCAACCAAACGAAGCAATAAC
CGGAGCTCAAATGGGCAACAAACAGCAGGGTAGTGTGCGATTATTTATAACAAGCGCAAA
ATGTGCACAATTAGCGCTATATATGGCATCGGCCTATAAGTGGGCTACATTGGGCCGCCA
TAATCATGGCAGGCATGCCATTTAGGGCTACAGAACTTTAAACGTGATTCACATTTCAAG
AGGGGAGTTGGCGTTGGGGAGTACAATAAAACAAAGCGAAAATTATGAGGGGCCAGCAGC
CGCGGACAGGAACAACAGCAAATAAATGAAGACGACTGGGCGAGTAAATAGAAATCAAGA
AAGCATAAAAATGCTCAGGGACCCCAAAGACCGACAAAGTTTGAATGCAGCGAAAAATTA
AGTAGTTGCGCGGCTAGGTGGAACCTGTCCTCTCAGTCTCCCCAAAGAAACGAGATGCGC
CTCCATCCTCATTGGTAATTGAAGTGTACACGTGCGTCCCCTGGCAATCGGACTTGGCCA
CATTGGGCGGATTGTCGGCTGGGTTGGATGGTTTGGATGGGTTGGATAGCTGGTTGGGCT
GGCCAGCATTATGCTGTATTATTTACAATATGAGGGCCTGCCACTTAGATCCCCATACGT
AGCTCCCATCGCATGGGCCCATAAAACGCTGTTTAAATGAACGCTGGCCGAGCGTGGAAT
GGACGACATTTTCATTTACGATGCTAGTGGCTCGAGGAGGTGAAGTCAAATTGAATGCGG
ACTGGGTGTCTATTATTTTATTTCTATTCCGACATCAGCCGGCAGCCAGCAGCTAGTAGC
AGACAGTACAGTAAAGCAAAGAGGAACGGAACCCATCCCATCCGACGTCGAGTTGTTTAT
TTATGTGATGGACTGTGCGTGTGTGGAAGTTGCAGATAAATTTACTTAGCCGCCCGAGGA
GAGCGCTCTAGTTGAGCAACTCCGTAGCTTAAGGAAATGACAAGTTGCAAGAGTGGAAGA
GTGGACTTGGCCAGCGAGATTGATGGTGCTGGAATAATGAAGCGGGGCAGAGGCGAAGTG
ATGTACCAGCCATTGTCTTCCCACACAGGAAGAAACATCGTGATGTGGACGCTTTAAAAA
TCAATAAAATAATACTATTAATTTTGGAATACTAATACACTATCCTAACTCGTCATCTGG
CAATGTGAAATGCCTACAGCTTTTCATTTATTTTGAATAGAAAAAATTTTGAGAATATAT
ATGGTTTTTGCGTGCATGCTCCTTGAGCTTGTTTGCAGTGCGCCATCGCCTGGCGAGTGG
AAATCAATTTACGTTAAATGTTTGCCCATCCACCGAATCTAAACACGGCCGGCCACATCA
ACCTGGGCTGACAGGATGTGCGCTAAGTGAGCCAAGGAGCAAGTAGAGTGATGGGCGAGG
GAGCAGTGTAGCAGTGGAGGCGTGCTGAAGTGGAGCAGTCAGCCGCAAAGTATCCATTTG
AGTGACTTTGGGCTGGATGCGAGGCTGAGCCACAAAGTAAACAATCGACCACTGGCGCTT
CTGCGTTTTCTGACACGGCAAACAACTGGCGGTGCAGCGAAAACATCATCATCATCATCA
TCACCACGGTCTTATCGTCATCGACATGGCCAACAAGAATGGGGCCTATTAAACTTGAAT
GCGTCACGCATGCTTGCTGGTTCTTCTGTTGCTCGAAGAGGTGCTCCTCCACCGCCTGCC
ACTGCTCCACTGCCATTTCCATGGGCTCAACAAGTTTTTGCATTTGTCACGAGCACGAGC
GCATTATGCTTAAAACTTTGCGCAAAACTTGGGACGACAACATGATTAACAGACAAATGA
CATTACAAAGCCTTTCACTTGGCGACTTCTCCTCACTTCGCTTTGCCAAGAAAATGACAA
AAAAAAAACCGGGGCTAGGGTTGGGGGAAAAAAACTGCAGCACCAGCAGCGCCTTACTGC
CTTTCTATTTCGCAGACAATGAGCTGGCTTTCAACGAGATCTGAAGAGGCAGTGGCCCTT
TGCGATGGGGTATATATGAGGGAGTCTCGGGTCTCGGGCTGGAATGCGCAAATCAGGTCT
TAACCCCTTTTCTTTCATCTGCTTAGCCGTCTGCCGTAACTTGAACTTTCAGTGAGCTGT
GCAGCTGGCAAGAGTAATGAGTGAGCGAGTATCTTATGGATTTGGCATTGTCGCTGACTT
TGAAGTTGGTTTTTTGTTCACTTCACTTGGGTCTCGCCTCCTCGCAAAAGTTGAGCTCTG
CTCTGCTGATGCATTTACTAATAGAAATTTTAAATTTAAATGCCAGCATTTCGTACACTC
ATCCCGCCCTTTGGCGGTTTGCACTTAACGCAAAGGCGTTACAGCATAGGCAGCTTCAAG
ATATTTTCAATTCACTGCGGCTCCAGCACTTTCGTTTCGAGTCCGCACTTCTTTCGCCTC
TGGAATTTTGATGCGCTTTGGCTGAAATTCAACAGAAGAGTAGAAAAGTGTAGGCCATAA
ATAATGAAAGGGGACTTAATGTATTCATTCGAAGGATGTCTTAACCTTGCGAACCTTGCT
ATGTTTGTGCATAATTAGCTCAGGAGCAGGAGCAGCAGCAGCTTGGGAGCAATTCCAAGA
AGATGTTCTACATTTATCACTGGCTTACACTAGGTACAAAGCAGTCTGTATTAATTGCAA
CTGGATATTTATGAAAGGTTTTCACAGAATGCCAGACTTGACATTTAACATTGTAAATTA
TATTGTAACATTTGTCGAGTCACTTGGCTGTGTCTCAGTCTTGTGCAGTCTTAATGCTCT
TATTGAATCCGAATAGCAGATATGTATGAATTTAGTTGGGAGATACTTTTTTTCTACTTC
TTTACTACTTTTGTGGCTTTAATGGTTTTGCACACTTATATGCGTTTTTGTTTTCCGAAT
AATATTCTTCTGTTATGCACTTACTGAACAACAATCTTTCATTCAATTGTAGTGGAAAGA
AAAGCAATGCCACATTGCCAATCACACAATCACATATCGAACAGTTTCCAATTTTGCGAT
ATTAAGACCCGCTTAGAGACTCTTCACATGCCGCCCCCAAAAAACATCTTGAGATGTGGA
GTACACAGATGTTTACTTAAAGCTCCCGTTTGGCAATACATTGGCCCATCTGGTTGGCTA
TATAAACATGTCTCGGCTGCCTGTTCACCAAAGTGTTGGAGGCGATGCCTGTAAAACCAG
AAACATGGGGCCAAAAGACTTGCAAAAGTTTTTGGGGGAATTGAAATCCTTTGGCAAACA
ACCGAGCAGCCGCACACACATATATGTATATGAATGTTCTTGCACACACTCATTCGTATT
GAAAATGGGGGAAAATGAAACATTGCCAGTGCAGTGGGATACAAAAACCGCACTTGGCCA
GACTTTCGGTTTCCTAGCAGCTAGGGGCTAGGCGATGGGAAATGGGAAATGGAAAATGGT
CGAAGGACACCCGCTCGAATGTACTTCACATGCGTGTACGAACTTTTCTGAAGCATTTGT
AAGTTTTTAATAAGAAATTGTTAAACAACTTGTTCTGTTTTTTTGTTTTTGCCTCCCTTA
CACTGCTTACTGCTCCTTAGGAGCTTTGGAGTGGCTGCTGCTGCCGCTTGGCAGAAATTG
TAGTAATCAACATGACTAATGTTGATTGATGAACGGGCGTAATGTGTGTGTGTGTGTGTG
TGTGTGTACGTTAGTTTTTCATTCGTATTTCCTCTTCATATTGCAAAAATTAATTTAAAG
ACCGAACAATATGTCAACGCCATTTAAACACTTTGGCATTTGCCGTAATCCCGACAGTCG
AGCATTAAGAAAACTTAACGATTAAATGCCTGGCTGGGTGGTTTTTTGTGCAGGATGCCT
CCTCGCAAAGCCAATTTTCCAAGAGCAACCTGCGGGCGGTACGACTATTAAACATCAGTC
TTGGCTATACCCGCACACACTCACATACCGAAGTAGGGTTTCCTCTTGGGAAGGCTTACA
TTGTGTACTCCTTGGGTGAGCAATAAAAATCCGAGGTGGAAGCGAGAAGCTTCCTTAGAG
CTCCAAAACTCAAATTCTACCCACACAACCTCATTGTGCCATGCCTGCGGTTGTAATTTA
GTGTGCCTAATGAATTTAGTACCGTTACATACCGGAAGTGAGCATGTGAGTGCAAAAATG
CGCACTCAACTGGAATGTCTGTGAATCTTCATGGCGTCGTGTGTGTGTGTGTGTGTATGG
GTTACTACGTGGTGGTATTGAGGTTTCCCCAGTATCCTGTGTGATGTGCTCCGTGTGTGA
AAATGTGTGAAAAATCTGCGCTCTGGCAAAACTTCGTTAACCTTTATTAACGACACGGAG
CGTCTAATTAAACAAGACAAAATTTTAAATCGAGCGTAACGCTTGCGCAGGTATGTGTGT
TCATAATTTCCCAACATGTGTGTGTGTGTGTGAAATGAGCAATTATTTTTAATTGCCTGG
CGGGATTAAATTGGGTGCCAGAGCAGGATTCAATTAATTGGCAGGTCTCCAAAAAGTTTA
CCAAGCAAAGGCCACACTTCTAGCCTGATTGCCCAGAGTAAATGTTGGTGCTTCACATTG
AGGAGAAGGAGCAGAAAAGGGAGGATATGTTTCCGCTCCAGGCGAGATGTCAACAAAACG
GAGCACAATCCGCCCCAGATTAGATTGCATAAACAAAACGCGCTCGGGATATCAATTCGG
ATTGAAGGAGGTGCCTGGTTCCAGGTCGCAGGTCGTTTCTGGATATTTACACGGCCAGCG
TGGCATAAAAGAGAAAAGTAATTTTCCTAAGTGAATATAAATGTTTAAAATCTTGGCAAG
AAAAGCAACACAATAGCCAGTTTGCTTGGCAAACTGACTGCCTGGCCAACTGACTTGGCC
AAGAAGAAATTTAAAAGGCAAAGCACTGTGGGCGATGGTAGTTTAGATCCACTCATTGGG
TGAAAAGTGCTTAAAGTTTAATGTCAAATTGAAGTTGGCCAGGACGAGGGAACCTTTGCC
GTTGCAAAAACAAGGTGTCGAGTTCCGAACTCCTGTGGCCCAGCAAAGCGTGTCTATTCT
GCCATCTAATAGCTTAAGGGGAATATGGTCGATATCTGCCATCTGATGGCTAGCAAACAC
TTGGCAGACACAATGCCTTCAATTTGCAATAACTATTAGCATTAGCATTTAGCCATATTT
CGATATCCAAACACTTTTCAACACAAATAACCTGTCTATCTGCCTACCTATCTGTTGTCC
CATCAAAGTATCTCATCGGTAAGCTGCAGAAATTTAAAATGACCAGCAGTTGCACATTTT
TCGGTTGCCCAGAAATTGATCAAATTTTCCGATTTAACGAAGCACAACTAAGTTGGCGGG
GGAAGACAAAAATCAATATAATCTGCACAGCCAGGGGCCAACCCTTGGAAAATGTCCTAA
TTAATGAGGAAAAGTCACCAATTTGAAAATCAAATTACAGCGCGCATAATTAAATTGCCT
TATCAAAATTTCATTCAAAAGCGTCTGTGGGGAAGGCACAAAATACGAGACTTTTTTTTT
TTTATATCAGCTTTCTTAGGCTAATGGGACAGTTGACAGTGAATGCAGTATGGCCTAAAG
TTGCCGATTTTACGAGCGACAGCTAGAAGGCCAAAAACTTTTAATTGAATTCCTTTCAAA
TTGTACGTAATGGGCACAATTAAATTGTCACCATCAGATTGAGAGGACGTCAAGGAGGAG
GAGCTATGAGCTGAACTCAGCTCTGAGCTGAGCTGAGCTGCTGGCTCAAGTTCTCGTAGA
GCTTTGGCAAAAATCTCGTATTATGCAGCACTCGAGCGCATGACAAATTCATTAAATGCA
CAAAGACCGTAAAGTGCTCCACTGTCCGCATGGAGCAACAGGACGAAAGGATGTTGGTCG
ACGGGCGAAGAAATGAAGAGAGCGTTTTACAAAATTTTATACACTCCCTGACCGTAATTA
CACCACACAGAGGTAGAGGGCAGCCGGGATTACAGGGTATGGCGTATGGCGTATGGCGTA
TGGCGAATGCATACCGGGCAGATGGGCGAACAGTAGTTGGGCGTGGTTTCGAGGTGAGCC
AACCATGAAATGCAACATGGCAGAGGAAGCGAACTCTGAGAAGCGAAAAGGATGTGTGTT
CGTTTGTGCCATATTTATACACGAGTGTTGTGTTGCCACTAGGTGTCGTCCGGTGCTTTG
TGTGTGTATGTCCATTTTTTTTCTTTTAGCCCAGAAGTCATCCGGATTTTGCGACCCACA
AACGTTGGCATTTAAATTAAATTCATTTTTCGTCCTTTGCCGCTCGCTCACACACTGCGT
ATGCGTGCTGCTAATGACATATTTTGAACGGGCTGTCAAAAATTCTGACTCGCGCTTAAT
TAACCGTCCCTGATTAAGCCGCATTCAAAGGACTTTACGCACCGACGTGCAATGAGCACA
TTTGCCAAATTTACTCGATTCGGCGCAATGGCAAATGTTTGTATCCAGTTTTATTTCACT
TTCATATAATTACGTAAATGTTAATGCCGCCTCTGAGTCGCTGCCTTTTCATTACATTTC
GAGAATTTGCCGTTCTGTCTGTCACTATGAGAATGACAAATGCGCTAAAGTTTTCTTCGT
GCTAATTACGGAGTGTGCACTAAAGGAAAAATCACCTTGAGTACGTTATTTCGTTATAAT
TTCCTAGAATAATTAGTCTCTAATTAATCACAAGTGTATAGGAAATATGAATGGAATGAT
ATTTTCTAAGACAGCACATTCTTTCCAATTGACTGCCACACATTTCTAAACATTCCTTTC
AATTTCTCCATTTGCAGTGAACCCATTTGGACAACATGAGTCGACTAAAGGCCGCTTCCG
AGCTGGCATTGCTTGTGATCATCCTGCAACTGCTACAGTGGCCAGGATCTGAAGCATCCT
TCGGTCGGGATGCGTGCAGTGAGATGAGCATAGACGGACTGTGTCAGTGTGCACCCATAA
TGTCGGAATACGAAATCATCTGCCCGGCGAATGCGGAGAATCCCACGTTTAGGCTAACCA
TCCAGCCCAAAGACTACGTGCAGATCATGTGCAATCTGACGGATACCACGGACTACCAGC
AGCTGCCGAAAAAGTTGCGGATCGGTGAGGTCGACAGGGTTCAGATGCGACGGTGTATGC
TGCCCGGTCACACGCCGATAGCCAGCATCCTGGACTATTTGGGCATAGTGTCGCCCACGA
CGCTGATCTTTGAGAGCGACAACTTGGGCATGAACATAACACGGCAGCACTTGGACCGTT
TGCACGGTCTAAAGCGATTCCGGTTTACCACTCGCCGTCTCACACACATTCCCGCCAACC
TACTGACGGATATGCGGAATCTGAGTCATCTCGAACTAAGGGCAAATATCGAGGAAATGC
CATCGCATTTGTTCGACGATCTGGAGAACCTGGAGTCAATTGAATTCGGTAGCAATAAGC
TGAGGCAAATGCCGCGTGGCATTTTCGGCAAGATGCCCAAGCTGAAGCAGCTCAATTTGT
GGAGCAATCAACTGCACAACCTCACCAAACACGACTTCGAAGGTGCCACCTCGGTGCTGG
GCATAGATATTCACGATAATGGCATCGAACAGTTGCCGCACGACGTCTTTGCCCATCTCA
CGAATGTCACGGATATCAATCTGAGCGCCAATCTCTTCCGTTCCCTGCCGCAGGGCCTAT
TCGACCACAACAAACACCTGAACGAGGTGCGTCTGATGAACAATCGAGTGCCCCTGGCCA
CGCTGCCTTCGCGTCTGTTTGCTAATCAGCCGGAACTGCAGATCTTACGGCTGAGAGCTG
AACTGCAATCGTTGCCGGGTGACTTATTCGAGCATTCCACACAGATCACAAACATCTCGT
TGGGAGACAATCTGCTGAAAACTCTGCCCGCCACCTTGCTGGAACATCAGGTGAACCTGC
TGAGCTTGGACTTGAGCAACAACCGGCTGACACATCTGCCGGATTCACTCTTTGCACATA
CCACCAATCTGACGGATCTGCGTCTGGAGGATAATTTGCTAACCGGCATTAGCGGGTAAA
TATATTTAATAGTTTACTTTTTAGTTACAGGCAATCGCCAACACTCCTATTATCATTCTT
TCAGATAGGATATTTTCTTAAAGTAATGCCCTTCTTTGTTTTTTAATTACAGCGATATAT
TCAGCAACTTGGGCAACCTTGTGACCCTCGTCATGAGCAGGAATCGACTGCGTACCATCG
ATTCCAGAGCCTTTGTAAGCACAAATGGACTGCGACATTTGCATTTGGATCACAACGACA
TTGATCTGCAACAGCCATTGCTGGACATCATGCTCCAGACCCAGATCAACTCCCCGTTTG
GTTACATGCACGGCCTTTTGACCCTTAATCTACGCAACAACTCAATCATATTCGTCTACA
ACGACTGGAAGAACACGATGCTCCAGTTGAGGGAGCTGGACTTGAGTTACAACAACATTA
GCTCGCTGGGCTACGAGGATCTGGCGTTCCTGTCTCAGAATAGATTGCACGTAAACATGA
CGCACAATAAGATACGGAGGATAGCGCTGCCCGAGGATGTGCACTTGGGCGAGGGCTACA
ACAATAATCTGGTGCATGTGGATCTCAACGATAATCCCCTGGTCTGCGACTGTACGATCC
TCTGGTTTATTCAGCTGGTGAGGGGCGTCCATAAGCCGCAGTATTCCAGGCAGTTCAAAT
TACGCACAGACCGATTGGTTTGCAGCCAGCCAAATGTCTTGGAGGGTACTCCAGTTCGTC
AGATAGAACCACAGACGCTCATCTGTCCGCTGGACTTCTCCGATGATCCACGGGAAAGGA
AGTGTCCGCGCGGCTGCAACTGCCATGTGCGAACCTACGACAAAGCACTGGTAATCAACT
GCCATAGTGGCAATCTGACACATGTTCCTCGCTTGCCCAATCTGCATAAGAATATGCAAT
TAATGGAACTTCACTTGGAGAACAACACACTGCTCAGGCTTCCTTCGGCCAATACACCCG
GATATGAGAGTGTAACTAGTCTGCATCTGGCTGGCAACAATCTAACCAGCATCGATGTGG
ATCAACTGCCTACCAATCTCACCCATTTGGATATAAGTTGGAACCACCTGCAGATGCTGA
ACGCAACCGTGCTGGGTTTCCTTAATCGTACCATGAAGTGGCGCTCGGTGAAGCTGTCCG
GGAATCCGTGGATGTGTGATTGTACTGCCAAGCCGCTACTCCTCTTCACCCAGGACAATT
TCGAAAGGATTGGAGATCGCAATGAAATGATGTGCGTGAACGCCGAGATGCCAACACGAA
TGGTGGAACTGTCGACCAACGACATTTGTCCGGCGGAAAAGGGCGTGTTCATAGCCCTTG
CTGTGGTGATTGCCTTGACTGGTCTTTTGGCCGGTTTCACAGCGGCACTGTACTACAAAT
TCCAGACGGAGATCAAGATTTGGCTGTATGCTCATAATCTCCTCCTGTGGTTTGTCACGG
AGGAGGATCTGGACAAGGACAAGAAGTTCGATGCCTTCATCTCGTACTCGCACAAGGACC
AGAGCTTCATTGAGGACTACTTGGTGCCGCAACTGGAGCACGGTCCTCAGAAGTTCCAGC
TCTGTGTGCACGAACGAGACTGGCTGGTAGGCGGACACATTCCAGAGAACATTATGCGCT
CTGTGGCGGATTCGAGACGAACGATTATTGTGCTCAGCCAGAACTTTATCAAATCGGAGT
GGGCACGCCTTGAATTCAGGGCGGCGCACAGATCGGCACTGAACGAAGGACGCTCGCGCA
TTATTGTGATCATATACTCGGACATCGGAGATGTGGAGAAGCTGGACGAAGAGCTGAAGG
CCTACTTGAAGATGAACACCTACCTGAAGTGGGGCGACCCGTGGTTCTGGGATAAGCTGC
GATTTGCCCTGCCACATCGCAGACCCGTCGGCAATATCGGTAATGGAGCGCTAATCAAGA
CGGCGCTGAAAGGTTCCACGGACGACAAGTTGGAGTTGATCAAACCGTCGCCGGTGACGC
CACCGCTAACCACGCCGCCGGCGGAGGCAACCAAAAATCCGCTGGTAGCGCAGCTAAATG
GCGTCACCCCGCATCAGGCCATAATGATTGCCAACGGCAAGAATGGTCTGACGAATCTGT
ACACACCCAATGGCAAGTCGCACGGTAATGGCCACATCAACGGCGCCTTCATCATTAACA
CGAATGCCAAACAGAGCGACGTATAGGACTGGGAGAAGGCGGAGCTGTTTCAGTTCGATC
CCGACGATGAGCTATTGTTCCGTTAAAGAGAAGCCTCCAAGAAGAACACTGCCACTGACG
AGGCGGCGGTGAAAAGACCCAGCTGAATGTAAAAAGTCTAGAGAATATTATCGATTTCCT
CGTGTTTGGTCAAGTTACAGTCGCCCTCTTATAGGTTTAAATCTCTTGCGCTGGTAGTGA
AGCTACAGCAAAACTAAGTGAAAATTTCAAATTTCATTATTTCATGTGGCCTTTGTTGAC
GAAAAATGAAACAAAAATGTTTAGTTTGAGGAAAGATGGAAACACAAGCTAGTTTTAAAC
ACATCACTCTGTTTTAAGTGTTATCTGTAAGCTTAGCATAGACCCTGTGCAGACTCTTGT
AGACATAAAAATCTCATTTATTTAGTAATTATTTGTACATTAGGATTATTGCAAGCTGCC
GCATACAAAACTGAGAATAGCTCAATGCTAAAATACCTTTTGAAATGACCACTTTTATTT
ATGTTTTACCTTTTAACAGAATCTCAATGAAATGGGAATCTGAATTTTGAACAAATCGAG
CTTTATTTCGAACTAACTACTTATTATTTGTTAGAACGCAGCCTACAACTAGGTGAACCA
CTTGCAATACACATACGACGTATCCAAATAGTAGTATAGACTCTGTAATTGTGTGAACAA
ACGCAACAAAAGCAGCCGAAATGAAATACAAATTGCCTTCTTTGTATGTATGTATGTACG
TATGCTAGATATATAGACCCCAAGGATTCATAATCGATTGCATTGCATACACACCCCGTC
TCTGTACATAAACTGGATATTGATTTCTGTACTTTTCCAAAACTAGTATGTGTATCGCAC
AGCAGATTCAAGGACCTTACACACAACTATCACTAGTATCAACTGTAATCTCACGCCCAT
TTAAATGACGCTATATAAATAAGTACATAACACGCGAATACATAATTCAGTGGACACACA
TTATCATGTCATCTACCAAACAATTAGGCTAGCTCTTCATCCATACAAAAACCAGAATGA
ATATCGTCTATGATACGTAAATGTAATTAAGCTAAACTATGTGTATATCGTCTAAGCTAT
AGATTGTCTCTGATATGTAATACCTAAGGTACCTACAGATTTATGCAGACACACTCATCT
ACTCTGTATGCGTATGAGTACATTAAATCTAATTGTATATGAAAAACACATACAACGCAA
ATAAAATATATTTTAAAAATTTAAACCCTTGAGATATTACATTTTTAATCCCAACCAAGG
CAACAGAAGGGTAAGATATTCGTATATATTGTTTTAGATTTTATTATGTATACACTTAAA
ATTGTACACTCAGCCGTTTTAAGTGTGGCTCGCCTTATTGAACTAAAAACAACTCAAGAC
ACAAACATAAATGTAAGTACAGATTGCCTTAGAGTAAAATACAAATCGTTTCAAAGGAAT
ACCACTAACAAGCTGCACTTGAAAGTTTTAAAAATGAAATCACATCTTTTATGGAAGGAA
AAAGCTGCTGCGCTATACTGGTTATACATTTTGGCGTCAGCGAAAATACGATTTAAGCAA
TTGTCCTTTGCAATTCTCTGGCGAATGCAGGCCGCATTTAACTATAGCTATAGGTACGGG
TTAGGTTGGGGATTCTCCTTTACATACGAAGGGTATATAAAATATATAATGTGTATATAT
GTATGGTTCCGGTAATTGGTTTTCGTAAGTCGTCGTTGTAGCCTACGCGTATTGTACAGT
TTATATCAGCAGTTCGCCCCCCTCTTATCGCTACTTGTCTACTACGGTTTTCTTTAGTTT
TCAATTGGTTTGTTTAGCTCACAATCAGTTCCAGTTTTCAGTAATGTCTTCTTTGGTGTC
CTATGTTACTCACATTGGGATCTCTCGCGACTTTAACTAGCTACCCCCGCTCCTTCCCAC
CACCATCTGTCCCCCATCAGCCTCATCATCCTAATGGCAAAGAAGGCGTCCCACGACGAC
TTGGCTTAGATTGGGCCCACCTAAAGCAGCATGTCGTCATCGCTTTCGGTGAACTCCCCA
TTGGGTTCCAATAGCAGGTTGGCCTCCTCATTGGATTGCACCTGCAAATATTAAAAAAAA
AAAAAAATAAACAAAAGAATTCAAAAACATGTTTTCGAATGTTCAGCAATGTGTATTCTA
GGAAAAATCTGTAGGTATTTGCAAAATGTAACAGCAACAATGAAACTCTTCGCTTAAGCA
CA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1438, 28534..28654, 29238..29627, 39677..40914, 41032..44361
39695..40914, 41032..43102
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved