Drosophila_melanogaster Locus tok
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster tok
Drosophila_melanogaster
tok
3R
snoRNA:Me18S-C1280
5130..5224
31437
GTTGAGGGGCGACGGATAGCACTCCCGTTCGATGGCGGCCTCGTGGACCAAACGATCCA
GTTCGTCGGTGGTGATGCCCACCTCCACGGCTTTGGCACCCTCATCCAAGCATTCTCGAC
CCAATCTGCCGGCCACTCGCATGCCCTCGATCTCCTCGTCGTCCAGCACCTTAATCTTGG
TGCCCCGCAGTGCTTCCTCCGAGAGTGAACGTCCTGCTGGATGATCGGCGTAATCTGGAC
GTTGTATGGCGTTCGGAACTGTTCGCTTGGGAGTCTGTGGGAACGGGCGGAGCTTGCCGG
TGAAGCGGAAATGTGGCCATGGATTGTAGGCTCCATCCTGTTCGGCAGAGTTCGAGGCAC
CGGCTGAGTCAAGAGAATTATATGGTTTCATTGCAATCCAACTCATTAGGAACAAGACTT
TCTAAAACTGACCTGCTAAAGCATGAATCGCCTTGTGCTCCTTCCAGAATCCTTTGAAGC
ACGGCTGCGAGCAGAAAAATGAGCCCTTGATGCCCAACTTTAGGCAGGTGGGACACTGCA
GGGTCGCATCCTTGCCGCAGTTGGTTGTCTCGCACTTTTGAGTCATTCTATTTCAACAAT
TAATGCGAGAAAAATTTCCGTGCCTGCCAAAAATAGTTTAACACAGCGTGACCGCACCGA
TAACGATAGAAAATACCTGGAAGCTTTAAAATAAATACCTTTTTATACCATTATATGACA
ATATATAAGCAATATGGCTTTTTGGGAAATTTGCCTTACGCTTCAAGCAAAATCATAATT
CTATTGGTTTGATATTAAATACTGTTTTCTGATTAAACATTAAAAAAGTTGATATTAAAT
AAATACCAAATCAATGTTTAAGAATGGCGCTACATCGATATCCGATGTTTTCCAAGCACC
GATAGCCTGGGACCAGTTCTGTTCTTATCGATACGTTTGTGCCAGGGTTGTTCGTCGCCG
GCTGTAACGGGCATTAGTTTAAAATTGGAAATAACTTGATAACCATTTTATGTGTATTTA
ACCATTTAAAATGTTACTATTATGGTAAGTGATTCGTAAATAGTATTCATATGATAATTA
ACATAAGAAAAGAGTTAATAAGGGCTTTCCTTACAAATGGTTTAAAATCGTTCGAAATTT
GAAAGTAAACAAATTAAATATGTAAGTTCTTCGCGGAGATCTTTGATCTGGCTAAGGGAC
ACTGGCCCCGTGAATTCGTGGCCTTTGTTTTCGTCCGTCGGGGCGGCAGTTCAAACGCAG
CCGCCTGTTGGGCACTTTTCCGCAGTTGTTCTCGGCGCATGCTCTTGGTGGGAACAGTTT
GGACTTGGACTCGGTTTATCTGTCTGCTCTGTTTATGTTCTCAAATCGCGAGCAACTTCG
GTCGTGAACGGACGTGCTTTCGCTGTAAACTCGGAATCGGTGTCGCGAAACAAAAGAATA
TTGGCAACAAACTTGTTTGAGTCAAATGGCCAAACGCAAATATCCGCAAAGGGCAGCAGG
ATAAATTTATTGGCCAGTGAAGTGAGTGAGTGTCTTGTTTCGAATTGGTTTGGCCAAAAA
AAAAAGAGGACCCCTTTAATATTTCTACCTGCAAGGGATGCTGAGATTTCGGCAGAGTTT
CGCATCATTTGCGAGCGCAACTTAACTAACTCAACAAGTGAATTCAAGGGTTTTCGCTCC
TCCAATTACTGATTTTGTCCTCGTGATCTTCGTACTCGATTGAAATTCGATTACGATCGT
TTTGTGTGTGTGCATTGAAATCAGCGTTATCAGTGTCTGCCCTGATCTTTGGTTTTGCGT
TGAACATGTTTATTATTATTCATTTCTCTGGTTTCCCGCGCCCAACGACAATAAGTTAAG
TAAACACGCTGTTTTTGTTGAGGATGCTGCTGCTGCTGTCTGTTGTCGTTGCTGCTGTAT
ATGTTGCTGCTGCATGTGTTACAGCTGTTTCCATAGTTGCTGTTGCTGCTGTCACATGTG
TTGCTACTGTCTCTTGTGCTGCTGCTGTTTCCAAAGCGGCTGCTGATGTCAATGTTGCTG
CTGCTATCGCGTATGTTGCTGCAACTTTTTTAGTTACCGCTGTTGCTGCAATCTCATATG
TTGCTGCTGTTTCTATGGCTGAAGGTGTTGCTTCTTTGTTGCTGCTGTTGCTGCTGATAG
GAGCGCAGCATTCGAATGGCTATAAATAAAAAACGGCACGCGGTGTGTGCAGCAGTGAGA
ATCCCCCGGCCCGTCTCCGCCGGATTTTCAGCACCACCAGCATCGCTTGATTATTATTGG
TGGGTGTTCTGCGTTTTACGCGACCACACACAGGCACACTGCCACACACACACTATTATC
TTCGCCGTGCGGTTTCCACTTTTCCGCTTTTCATTCCGTCGTTAAGACGCAGCACATATC
TCGTCAATTGGCAATCTAAAGGCCGCCGGCATAATTAAAATAGAATCATTTCTGATTTCG
CTTTGTGTCGCACAGACATGTGTGTCTTATTTTGTTTGTTTGTTTTTTCTTTTTTTTTTG
CAATACGGAACAATTGCGAAAGTCAAGGTGGCCGCGAAAAGCCGCGAAATAGTAGGGAAT
TCCTATGCGATGGCAACGAACTCGATCTCTGTGTACCCAACTCATCTTGTCTGGCCTTTT
ATTGATTTATTTTTTCCCCGGCAGTCAGTCTACTCTTTTTTTATGTTCCCCTTTGTTTTG
ACCAACGATCCTCGATCTTCGACGGCAATTAAAGGCAGGCCAAAATGGTCCAGGAAGGCA
GACATCAGCCTTAATTTGCTTTGGTTGCATTGCCTGCTCGTCTTCGGAACTTTTTCATAT
GCTGCGCAGTGCGTACTTTGTTTGTTTGTGTGCCAGCCGAATGGAAGCTGATGGAAATTT
ATGCGTAGAGAAAGGTGGAAGAATATGAAATGGAAAATATGAAATTTTTGAATTGAGTTT
GTGGAGGAGTGGGGGGGGGGGGCTGGGGCGGTACACCTAACACTTCCGGTTGCCAGAATA
TCAACTTCCGGTGGCGTAGAATTGTTAGCGGGGAAATGCTTTGGCACAAAAGACGCATAT
TGATATTGTTGCCCAGGCTGCTTACGCTCCAATAAGCACACCCACACACACACATAGGCA
GACATACAGACGGGAAGGTCCTTCGTCCTTGGGAGCCAGAAAACGCATTTCATTTTTGCT
CCAGTGAGTTGGCCCTTGTCTGGCAAACGTTTTGTGGCAACTTGGCCATTAAGCATTTCG
TGTTTAAGCAGCAGGATCTTTCCCTCGCCCTTCCCTCTCAGGACGAAGGACCAACAGGAC
AGTACAGCAAGGAATAAAAATTGCCCGCGTATGCATTTCTTAACAACATTTCTCCACCAC
CCTCCCCCTTCGCTCCCCAGCGACAACATTTCATTTCATATTTTGTGGCAGCAGCGCTTT
GAATAGAATTCATTTGGATTCCCTTTCCCAGGACACCTCGTCCACTTCCTTTTGCCTTTG
TCAGCCCCTGGGTTTCCGCATCCCACATCCCAGAACCCAGATCTTCCACATCCCTCATCT
TCCTGGAACACGCACTTCAGACTGATAGCGCCTGCTTAACAAATTTCTGCTGTATTTTTC
GGTTCTTGTTCTCCACTTTATTATATTCCGTCTTCTTCTTTTTTTGCCATGGCAATGGGG
ATTTTTCCGCATTTTTAGCTGTCGCAGCAGGGTAAAAATTAAAAGCGAATTAAGTTCGAG
GAGCTGTGGAGGCATCTAAAAGGTATCTAAAAGGTGGACAGCCGAAGATAACTGCACTTG
ACGCCGGATAGACCACAGGCATTATTAAACCCCAAATTTACCTGCCAACCAGGCGGGGTG
GCAAATCTGCAAAAGAGATTTGAGTTATTTTATGGATATTACTAAGTATTCTGTATCTGC
TACAGCAGCCATGAATTGGGGGGCTTTTTGGAAAGGGTCTTTATTACACATAACAAAAAA
ATTTATAAAAATATAGGTCTCTATATTCTTCAAATGGCTCAATCATAGTTATTTACTATT
AACTTGCGAAAAATACCCAAAAGTTCCTGTCCTTTTATACATCTTGCACGTTATTAGTTT
GCTCGCTGAATTTTCTCAGTGTAAGATCCCATGAAATACAAATATTTTTCCCTATGTAGG
CACAACAGCTGACACCATCCTGCTAACAAGCAGCCGTCGCATCCACATCCTCCTCCAAAG
TCCTCGAGAACAGGAGCACCCTGCCATTGAAAGTGTCACCCCAAGCTACTTCTTCTGTAT
TTTTACTTCATCTTTTGCCACGCCACTTTTTCTGCACCCCCTTCCCTCCGAATCACTTGG
TTTCTTCCCAATTTCGGTTGCTATAAAGCAAAGTTAATGATATGTCGCAAGTGCTTGTTT
GTCTGCCTGACTGGGGATGAGTGTGGGTGAGTGGCTCCACTTCCAGTTGGCTGAATACTG
TCGTCGTTGCTGTGGCCCCATTCCATGTGTAATTAATTAAAGACTAAGCAGATTTTATAT
TTCACTTACTTGCTTGAGACTAATTTATGAGTATTTCCACTTTTTGTCATATTTCAAAGT
CTGCACGATAGACTAATTGGGTAGTTCAGTAGTGGTAGTGAAACGGGAAATCTTGAGGCA
TTCTTAAGGGTCAAGGATATCTTATAGATTTGCCTCGTTGCAAAGCTATTCATTGAGCTC
TCAATGGCTTCGATTGCCTTGGCCGTGGTTTCGCCACTTTTTAGTTGGCCAAAGCCCAAC
TTGGGCCACAAACTTTTCACTGGCCGTCAGTTTTCTCGGATCGTTTTCACTTGCACGCAT
TTACAAGCAAGAAGTTAAGTCGCCAGTTTGCTCAACGGGGGGCATTTTCTCGCTGGAATT
TGTTGGCCCAGTCGCCCTTTTTTATTTGCCAAATTAAAAGGATTTCACTCGCTTTTCATA
TTTGCATTGGGGGAGCTGCTTTACGCTTTTATTCTTTTCATATTTTATCGCCGGCCTGCC
AGGCCTTGTAGCCCATTGCCAACAATTTTCCCACGCAATCACCATAAAAAGAAATCTTTG
CCGCCATATTTCTGTAGGATGCCTGCTCCTCTGTTGGTTTCTCTCTGGCAATTGTTATTC
ATGACCCGAAATAACAGCAGGGTGGCTGCAGGGATGATGATGAAATGAGATGGGTTACGC
TGTACTGGGATGCCAAGGTGAGGCGCATCCCTGGTCTCCAATGGGCCGTGTTGGGTACTG
ATTCCTCTGGCCACACAACGCTCGTCATTCGTCGTTGTTAGTATTAATTATTTCTTAACT
TTAGTGCCGGTTCCTGCTAGCACGGTTTATAAATAAAGCGCAGGCCCTTCACGGCATCGC
TGGGCCTCAGTTCATCCTGCTGCTCCGGCGACCACTGGTTATTTGCATCGACCTTCGTCC
TGTTTCTGTTGCAGATTATGACCCCAAAAGTGGGAGGGTGGCTGTCTATCTGTCTGCGGG
GTATTTTATGGCTGAACTTTATTTACATTCACATGCCGAGCTGCTAAATAATCAGGACTC
GACCCGACCACCCGCTCATTTCGTTTGTACTGTGCTGCAGGATACAGCAGCCAGGAGCCA
GTGGCCAGGATATACGGATGTACCGCCTGAAGGAAGAAGGGTGTGGGCATTGGGAAGTGG
GTGGGTGGGTTTTTGGCCATGGTCTGAACCGGCGTACAAGGGCCACAGGTGCCAGGCAGC
CAAGTTTAATTATTTGCCGTTGGCTTTGGATTCGTTCTGGTTCTGGTCCTGCCCTTTGGG
GTCCTCATCCTCTCGGTGCCCTGGCCTCTGGCCTGCTATCCCCCTCCGTCATGCCATCAT
CCCATCTGGTTGTCTGTTTGTTTGCTTGTTTGTTGTTAGTTCAGTCGCCTCGCTGCATTT
TGCGCTTGTGAAGCATTTTAAATCGCATAAAAGTCGGCCGCAGCAGAAGCAGAAGGATCC
TCTGAGCCCCCGGGCTGGTCACCCCATTCATTATACCATTTCGGCTGGCCTAGCCTTTGC
GTCTGTAATTGAAATTAAGTTGTTGCCAAATTGAGGCTCGTAGTCCTGCTGCTCCGCCCA
CTTGTTAGCCAAGTCGTGGTCTGCATTTCGATGTCCTTGAGTGCTGCCGAAAATGGTCCA
GAAATGCGAAAAGTCGCAAAGTGCTTGGCACTGAGCTAAACAACAACTCTGTTTGCCCGC
AGTCATGCTGAATCCTTCTTTAAAATTCATTTGAGAGCCATTTCAATTCATATCTTTTGC
CGTATAGCTTGCAACTGCAAATGTCAACTGTCAAACGGAGAAAATCAAAATTAGGCAAAC
AAAGAGCTTCCACAGCGAGTCCTGTCAGGATTTGCTCTTGTAAAACACTAAAAACGCCAG
AGACTTCGAGGGTGGGCGCAAGTTGGCTGCTGGTGCTGATTCCCCGTCTAGTGCTACTCC
AAATCAGAGACTGAGAATCGGAACCGCCCCGGCTGGAAAACAAGGATTCCCCAGCCACTT
GACGCTTGTCATTGTCAGCTCTTGTAGTTGGAAAGTTGCGAGCACTTGACAAGCCTGATT
GATGGCCTCGTTGCGAGGAGGAGCAAGTATGCCAGGATGCCAGAATGCCAGGATGTTGGG
CTGCCAGGATATCTGGATATCTGCTGCCTGGCACTCTTATCGCATCTAATTAAACTAAAA
GTAAATGGTGCGTGCCATTTGAAAATGACATCTTTAAGCGTTTAAGTGCGAATATCGAGG
GGACTCAACGTGCACTTTGACGAATAGAAAGAACACTTATTTGTTTTTGTCAGCTATTAC
GTAGTAAAATTGCCATTTGTTTACGCTAACGAATTGACCTAGAACTCTGATAAGAATGCA
CCTACCGAAATCCATGTGGGTGCGATAAGAGCGGAGGAGGAAGTTCATGAGAATGGGCAT
GGAAATGGGAATGATGAGGTCCGCACAAATTCCATAATGAGCAAAGTGGCTGGAAAATGG
CAAAGTGGAAGGCGCTTTCACTTTAGCCAATTAACATACTTTTCAACGATTTTCAATTTG
CTGCCAGAGACGTGGCAACAAAGACAACAAAAGAAAAAAAAAATCGCAAGAGGGACGTAC
ATTTCAAGTTAACTTGCCACCCACCTCGGGCCCACCACCACTGCTTATTTAGTTTGGAAT
TTATCAATTGAATTTTTAATTTCGCTTAAATGAGACGGCGGCAACAAGAACGGCGCCGTC
ATCATCATTCTCGTCCCTGCCGTTGGTCCCATGCGGCGTATACGTAATTATGCGAACGTG
GATTATGGAAATGGCTGCTCGGGGGTTTCCCTTTCCTCATTCCCCCATTCGAACGCCATT
TCCCTGCAGAAATAGCTCCTGCTGCTCCTTCTTGGTTGGGTGAAATTAAACGAAATGAAA
TTAAGAAAATATGTTGCACTCCTTTTGCCTCGCTTCGCTTCGCAACTGTTTTGCTTGGCT
GCAAAAACTTTCTGTCCAAGGTTTCGTCCGTGGAATTGTCTGTGTGGTGTTTGCCTTTAT
TTGCTAGTTGCCACCACCGCCATCACCACCACCATCATAACCACCACCACCACCACCACA
CAAAAGGCAACTTAATTTGCCATAAAAAGCCAGGCGAGTCCTTGATTTGTTTTGTTTGAG
CGGGGGCCGGAAATGAAATGATTTAATGAAATTGCCACAATTGCTGGGGAAAATCAGTAG
CAGCAACAGCAGCAGGAAAACAGCCTGATGACAATGGTTTTGGTCAAACTTCAAGTTAAT
TGAAAAGGTTTTGTGAATTGCTCGGGGTTTTCGGGGCTAAGCGATTTTTAATTACCTGTT
ATTGTGGATTGCAGCAAAGGTGCCTGCCTTTCAGAGTTTCGCCTGCAAATTAATTGAGTG
CTAAGTTAAGGAGCGGCAGGGGCAAGTCCTGCTCCTACCTGTCCTGGTTTTACGGGCTTA
CTGCCTGACCATTATCGTCTAAGTCGACTTCCTTCACTCGCCCCCGTTTTCCGCCCATCT
GTTGGATTTTGCACCTCCTTTGTTCGTAGTTCAGATACCCGAGTTTTATGATCGCCCAAG
GCACAGATGTTGGTTTCATATACACTTAAATATGTATATGCCATAAGATACATATGTAAA
TAAGACACCGGGTGTGCACAGATTGAGATTATCTGCCGGATACACATTTTGTCTAATATA
AACCCATATTGATGAGGCCAAAACTCTGTGTGTTTGCCCCTGTGTCTCGCATCGATTGCA
TTGGATGCCTCATTTCGGAATTAGCAACTGCATCCGTGAGGTTGACATTTCCCAGCCAGA
GTTCGCATTCAAATTGCAAATGAATGCCGGCACAGCAGGCAAGATAACCCCGATTGGGAA
TGCATAAGTAAATTGCTTTCCCCCAGCCGAATGGTAATGTTACTACTGCCGATTTCGATC
TGCATTTTCGCAGTTTAATCCCCAGCACAATTCAGCTTTGTATTTACCCATCAATGTGTG
TGAAAGTACGCCGTTTATTTCCGCCAAACAAAAAAAAAAAATACAATTATTTCAGGGCCA
TGAAAAAACGAAATCCAGCGAGCTTATCTCCAGAAAGTGTGGGTCAATTCGAATGGGACA
AAGGGTTATCTTCGGTTCACCGGGGGCTTGGGAACACAGACCTATAGACTATATAGCAGC
TAAAAACAAGGGAGTATAACATACGATTCACTTGGGAGTTTGATAAAAATGTGTATTAGT
CATACTTATTTTGAAAGGTTAAAAAAAAAATAAATATTAAATATGACAAGACCTTACATT
CATAACAATTTGATTGCACCTTGCTTTTAAGTAAAAAAAAATAGTAAACTAATACTTGAA
ACAAAGGGTTATCAGTGGGTTTAAACAGCCATGAACGTAAACAACATAATAATATAATAA
TAGTGCACACACAGAGTCAGTGTCACTCAGTTCCACTGAGTCTGGTACTAAACTGAATGA
ATCCGCCTCCAACTCATTCCACAATCTAATCAATGCGTTTCCCCTTCTTGTTTAACTATT
TTCATTGCAGGCCCGGCACGTGCTAATCGAAAATGCAGAAATTATACTAAGAGCAGATAG
GTAGGCACATCTCAGTCCAAACGTGGTCAGTGGTCACGAAACGAGGAAAGAGCAACAAAA
CCTAAAATCACAAACCGAAGACTTCAAAGTACACAAGAATTTGAAGCCACTGCAATGCGT
AGGAGGCGTGGCACGCCCCTGGGCGTCAGCTGGACGAACTGCGTCCTGCTCCTGGCCACC
GGTCTGCTGGTGGTGCTCATTTCGGTGCACGCCAAGAACCCCAGGCCGCATCGAGGACTA
CCCGCCCCGGCTCCTGCACCAGTTCCTGCATCCGTAGATCAGGTGGCAACTGAAAATGCC
CACAGGCGGGAACCTACCGTCGATGGGAGTGTACTTCAACGGCTATCGGGTTCAGATAGG
GCTGTTGACGAGGATGAGGATGTCGATGAGGATGAGGATGAGGGGCTAAAGCACCAGCAC
CTCGAGCATCGGCAACAATTTGACGCATATCTGGGCACAATCCGACGGCTGCGTCGTCCA
TACCGCAGCAAATACACCATCGAGCAGCTGATGCGACTGCATGTGACACCAAAGGTATCC
GGAGACATTGACATGGATCCCTGCAAGGCGGGTGAGTACGGGTTAGGGTGCACATATCCC
AGATTCCTCCTGATTCCACATTCCATATTCCGCTTGCCACGGGTCACGGAAATGGCTTAG
CATTTGCCTTGCCTCGGCGTTGATTCAACTCCGCCGTGAGCCAATCTCTAAGCCCCGAAT
CTATATATTTACACAGCAAGGAATATATATATACGTTTTATAAAGAAAAATCTTAAGTTA
TACACTTAAAATATAGGCTTGAAGTTAGGAATATATGTCATTTTAATAATAACTCAAAGA
GGAATAAAGCTAAAGTTAGTTCTTCTTTCAAGCTAACTGCCGGCAAGTATTTCTCTCAGT
GCATATCTATATGAGATTTCACCGATACCCCAGTCAAGTCGTGGCAAGACAAAAGCTTTG
AAAATTGTGTTATCCAGCGAGTTTGAGTAAAAGCGAAAAGTCTTGTTAACTCGAGACGCA
GACAGCTACACACACGTGGAAGTGTCTCAGCTCCATCCAGAGCCACCCCTCCTTATCCCA
GTCCATCGCATCCCAACCCACTCAACATTATTTATGGCCACCACCGAGACCACCCCACCC
CACTCACCAGCACTTGGCATCCAGCCCCCCGGAAAAGCCCCTGTCAGCCGCTTGTTGCAG
CGCTCGAAATTAAGCGCTATTGTGGCATGCTACGTCTACTTGTGCTCATCCTGCCTTCCG
ATCAGCTCGATTCAATTGAATTTACCTTAGTTTGCACAAAAAAAAAAAAAAACACACACA
CAGAAGGGAAATAATAAAAAACCAAGGGAAGATGTAAGGAAATTGACTGCGAGAGCAATG
CGAAAACGAATGCGTCGCCAACGTATCAATGGCTCCTATTCACCCACCTCTGCTTGTCCG
GACAAGGATCCCCGCATTCGCATCCGTATCCGCATCCTGGTCGGAGCTTAAGTCGGCGCT
TGTGTCTGCCAAGGGCAGAAGCACCGGCTTCGATTGCAATTTGTCTGCCTCGATGTGGTA
GATGGCAAGTTTATCTGCGGGTCCATCTATAAGTATTTGCTCACATCAATTGTCAAAAAG
TTGAGCACCCCCTGCGGGTGGCAACCGCCCGTCCGCCATCCATCGAATGCCAAAAACCCA
GTCAAGGACAGACATTCCTCGGGCGGAATCCTCTCCAAAGTATGCGTATATTGAACGGCA
AACGACTTCCGCACTAACTATCATCATTGCCAATGCGATGTCAAGTGTTTGAATATCCCC
GTCTTTATTCCGCATTTTGGATTATATTAAGGGGCTTTAGTTTGAGCATTAAAAAAAAAT
TAACTTATATGATTATTTATAAGCAGCTTTGGCGATATTAATTCATGCCGATTAAAACAG
CGGTGTAAACATTCAATTAGTAAAGTTAATTGTACTTAACCCTTTGGCTGATTACATCAA
TTCCAAAAGTATTTAACATTTCATTGCTGGGAATTCGCATTGTTTTCAAAATAAAACAAA
TATGTTAAACGTTTGTTCTTTAAATTGCAATGTTAAAGCGCTTTTCTATATCAGCTCTCG
CGGAATGTATATTGTTTTAAAATGCAAATGATTTGTTGTTATGCCTGTACCATTATGCCA
TTTATGGGCTTTTACGAACTCATCAACTCCCTTTTATGAGCATTGCGTTTCCCCCATTTG
GGTAAATTACTCTCGTTGGTCCCGTGAAGGTCGATGTCTGGCGCTTCGATTGCCAGATAG
GTCACACCGCCACATAGATCAACCATTTTCGTGTGGTTCCCCAAACTTTTCCAGCCCGAT
TTCACTTCCAATCAATCATCAGCGCCTCGGGGAATTTTTCACTACCGTTCTCTTTTTTTT
TTTTTTTTTTTTTTTTTTATTAATTTTTTATTATTTATTGAATCTTCCCTTTGTGTTAAG
AGACTAACAATAAGTGTTCAAATCTTAATCTAACTTAATTAACTTTCACTTAGTGATAGT
TTTTTTTTTTTCATTAATGCCCTAATAAGTTTATTGCTGGGCTGGGAGGTCGTTGCGGTG
CAGCCGGCTTTGACTGCATACTCGGATTAGTTTTCTTGCGAGGGGATTTGTATGGGTGGT
CAGCTTTTCGTTATACTTCGTTTTTTTCTCAGCTATTACTTCGATTACTAATTTGATTTT
TAGGTCTCTGTGTATGTTTTCGTTTCGAAGGTACCACGGCGCTCCAGTGATAATTCTCAG
AATTCTTGACTGTGCTCGCTGAATAATGTCTATGTTACTTCTGGATGCGTTGCCCCACAG
CTCGGAGCCATAAGTCCAGATAGGTTTTAAGACGGAGTTGTATAGAAGAGCTTTGAACTC
CAGACTAAGTGGAGAGCGAGCATTTATGAGCCAGTGGAGGTTCCTTGCTTTAAGTTTAAG
ATGTTTCGATTTGGCTTCTATATGTTTGCGCCAAGTGAGCCGCCTGTCCAGATGAACTCC
CAGATATGTTACCTCGTCGGCTTGTGGAATGCATATGTTATTCAAGACCAGTGGTGGGCA
TGTTTGTTTGTTTAAGGTAAAGGTAACCTGCTTGCATTTTTGAACATTTATTGAAATTCT
CCAGTCGGCAAGCCATCGTTCTACAGATGTTAAGTGTCGGGATAGGAGTGCCGTGGCTTT
TATTGGGCATTTCGAGCGACTGAGTATCGCGGTATCATCAGCGAACGTGGAGGTTGTTAG
ATTGTAGTCTATGGGGAAATCCGCCGTATACAGGGTGTATAAGATTGGACCCAGTACACT
GCCTTGCGGCACTCCAGCTTCGATTGCGCAATCGCGTGAAGTGCTTGTATCGCATCTTAT
TGCAAACACTCTGTTATATAGGTATGACTTCAGTAGCTTATGTGTGTTTTGGGGCAACAG
CTTGATTATTTTAAACAAAAGTCCATCGAGCCACACTCTGTCAAATGCCTGCGCGACGTC
TAGAAAAATGGCTGTGCAGTATTCTCGATGTTCAAAAGCAGTACGAATTTCTGACGTGAT
TCGGTTGACCTGTTCGATGGTTCCATGTTTTTCTCTAAAGCCAAATTGATGTGTTGGAAG
TGTGTTGTTTATTCTAAGATGAGGGCTAATCCGAAGGAGTAGCATTTTTTCAAACAGCTT
TGAAAGACATGTTAGTAAGCTTATCGGTCTATATGATGATGGCTGCGTTTTATCTTTTCC
TGGCTTTGGAATCATTACTATGGTCGACTTTTTCCATTTTTGAGGGAAGTATCCAAGCTT
GGCGATTGCGTTGAACAACAGGCAGATGTGAAGAATAGCACACTTTGGGAGTTCAATGAG
CATTCTTGGAGTTATTAGGTCGTAGCCAGGCGATTTTCTTGGGTTCAGTTGCTCTTTGAT
AACCTTTGCTAGTTCACATGGTCGGAATTCAAAGGGTTCTTGAGGATCTAGATTGGCTGC
TATTAAAGGAGGGAGAATAAATGTGTTGGTAGAGGGATTTGGTCGGAATACATTTTGTAA
ATGGTCAGCGAAAGCACTGGCTCTTTCTTCATCACTTCGAAACCAGGTGCCAGAGGGACT
TCGGAGTGGCATAATTGGCGCTATTGGAGTCTTTAGGTTTCTGTGAGCTCTCCAAAGAGG
GTACTTAGTGCTGGTGGGAGAGAGTTGCTCGATATATGAACGTTGGCTGTTTTTTTCCTC
TTGTTTGAGAGCATTGGTAAGCCTGCGTGTGGCTATCTTAAGCATGTGCTTAGTAATTGG
TGATCTATTAGACTGCCAATCCCTTCGTAGGCGTCGTTTATCTAATACCAGCCGCTCGAT
TTCGCGATTAGTTTTGATGTAGTTTGGTTTTGCATACGTCACTGGCGGGGTTGAAGCCTT
TGCAGCCGAAACTAAAATGTTTTCAAGAGTTTCCGTTGACTTGTCTATATCCTCCTTTGT
AGATAATGCCGTCGTTAGTTCTATGTGTGAACAGACATACTTTTGATACCTTGGCCAGTT
TGTTCTAAAATTTGTGAGTCTATACGGTGGGTCGACGATGTGGGGGCGAGTTAGCATATT
TAGAAAAACAGGTGAGTGATCTGATGATAAATCTGCTAGTGCTTCGGCGGTGACCATGTT
GCGGGGGACATGTTTAGTAATTGCAAAATCGATCAGGTCTGGGATTTTTCTTGGGTCTGC
TGGCCAGTATGTAGGCTTACCCGGGGATACCGTTCTCAGTCCATAATTATTGAATTGTTT
GCAATGCCGTTTGCAAATGGTCGGGCCAAAAAAAAAAAAAAAAAAAAAATTGGGTCAAAG
TCGAATTGTAGTGCACAGACTGAAAACTGAAGACATGGCTTCCTAATATATGCAAATGCA
CGCAGCTATCTAGATATAGATTCGATTGAGAGGGGCCAGTGGAAGGGGGGGGGGGCGGTG
GATAGAAAAATAAACAATTTTTACTTGGTTTCCGCACGCACAAAGCAACCTAATTGAATT
TCGGAGTGGGATCACGAAAGAGGGAAGCTCGTTGTTAATCAACTTCCAATTGAAGTTGAA
GCAATTTGAAACTCGAAAATTTAATTTGCCAAAAATGTGCACTGTGCGTCGCAGAAACGA
AAATCCCCCGGAGTGCAAGCACGCTCACACACACACACACACACACACGCATTAACACGA
CTTAGTTAAACAACAAAATTGCCAGCGAGTACTCGAAAGTTAATTAAGCCCTTTGAAGCG
GCAGCGCCCATAAGTAGGCAACACGAAAGCGTTTAGCATTATAAATTCTTAGTAGCGTGT
CATAATGCATTCATGTTGGCCAACACTTTAAGGAATTTACAGCGAATGGGCGACAATGCG
TTGCGTTGCATTGTTCGCTGCGCTTTGTGCAGATTCGCTAATTAATTTGCATAAGCCAAG
TGCACAAAAGTTCCATCAATGCCGCAGGAACAATGGAAACTGGGCTTAGGGGCATCAAAC
AAGGCGTGACTGGTGGGCGAGGAACCAGAAATCAAACCGCAAATGGCACTGCAAATGGGC
GGGCAAAGCCCAAGCATTCCCTAGGAGTGCAGCCAGAGCCAAGTTGACGACAGTAATGAT
GACAACAGCATCACAATAACAACCGCAAAGCCAGGACGACCAAAATGTCAGTCGTCGTCG
GCGGCGGCGGCGGCGGAGGAGGAGGCGCCATCGCGGCGATGGCTTCAAGTGGCCTGGCTG
ATGGCGAATGGAGCGGAGGGGAGTGGAGTGGAGCGGTGTGTAGCGCACAAAACTCAAACA
ACCTGCCCAAGTGACTGCAAATAATTTCCCACCATGCCATGCCACAACGCACCGCACACA
CACATACAGCTCTTTCTTGCGGGGATTCCCCCTATCACGATTCACACTCACATTGATGCT
GCTCTAGCGAAATGGCAAAATGTCAGAATGGCTCGGCTGAAAGGCAACAAACTAACGCCG
CTGTTCGCGCTCTCAAATAAAAAGGCACTTCCAAGGCATTGCATGCATATAGCTGCAGGA
TGCGGGGGCCACCGAATGGAGATGGAAACGGTTCGTGTTCCAAGGGAAACTACCCTCCCC
TCCCTCTCCTAAAACGACGGAATAAATCTAGGGGTGAGGCAAGTGCAGTTCAGCTGGGAA
TTGCTCGATATGAACATGCACAGTGCACTGGGAATATAAATATAGCCTAATATAGATGAT
CGATGCAAATTATATCTTTAAGATATTCACATTTAAGGATAAGATTCATTTATATATTGC
AAAGTGGCATTTATACCATAAATTGAATGGCGCTTTTCGGTTGGGTGGCAGGGTGGGTGA
GTGGTGCTGGAGGCGCAGATTGTTGGGATGCTCACCGCAAAACAGCCAGCAGGATCAGCT
TACAAAGCCGCATGAGGAGGCAGAATGGCAGGGATAACGTTTTCGGAAGGGGAACATTGT
ATGCCCTTAATTAAAAACCACATCTATTTAATACTTAACTTTGTTTCATCTACGCAAATA
AACACATAAATTAATTCAATTTTCTGGCAGGCATGCCAAACAAATTGCCATCCATCAGTG
AGGCAAATTAATTTATTTGCCAACAAAAACATTTGCCCAGTCGTTGACCTCATTTCGCCT
GTCAGTCTTTCCGGACTCAAAGTTGCACAATAGATTTATGTAAAGTTCATAGAACTGCTT
ATATGCGTGATGGCAGATTCAGCATGCATTTTGGAAGCGAAAGCTATCGCTGGATTTCAA
AAGCGAATCTCGTGCTTTGGCAGTAAAAGCAGGACGAACAAGAGCCGGGACAAAAAACGG
AAATGCAGCTGCGGAAATGTTAGAAAATCGGAAGTGAGCTGATTCGGAGATCCTTGAAAG
GGATGAACCGGCTGAGATGACTCTGTCTGCATTTGCTGCACCTGCTTTGCCCATACTTTG
CAACAGTTGGACGAACATTTACAAACTCCACCCGAATTTACACTCCGTATCTGCCCCCTG
CTTTTGATTTCAATTGCATTTATTGAAATGACATTCGTGGCACAAGCAGAAACATGTGTA
AATAAAATAAACTTGCATTTAAGCTGTTTACATAATTAATTAATGCCAACAAGAATGGCA
TGAATGTGGGCGATTGGCTGCTGCTTTACAACTGTTGCGGAATTTCTGCCGTCGGCTGAC
AGCAGGATGCATTTCCAAACTTTTTGCTGCATACTTCACGGCGTTCCATGTGCATGTGAT
TGTGTGTGTAAGGAGTTAACAAACACCAACCTACATGCATACATGCATACATGCCAGCAT
TTGTAGATGCACACGTACATAAAACAAACAAGTGCCTTGTGTCTGAGCAACCTGTTAGCC
AGAATTTGTTATCCTTGCCGGCTGTATGCTGCAATCATTGTTTATGCAAATTGGCATAAA
TAAGCAGGCAAAGCAAACAAGCTCAAAAGCTGCTCAGATAATGCCACAAAATGGAGCTTA
TGTTTCGGCACACAAACACATGCTTCGCACACTCCCATACTGTACTGTATTTTTGTATAT
ACATAAATCCTTAGTCGTGCGAGCGCCTGCAGCTGTGGGCAATCCGTAATTTATGCAAAT
CGCATTTTAAATTTGTAAATGTTATTTTAATTGTTAAGCCAGCGTTCGGATGGCCCAGAT
ACGAAAAAGGGGCGATACAAATCGAATTAATCCAACCCCGGCAAATGGCAATCTGGAAAC
CGATGACCAAAGCCGATCTGAACTACAATTTATGATATCCATTTGCATCTGAACTTTCCG
TATCCTTGAATCTTCTGCATACCCGCTGTTTTTGTCCCATTCCCAGCATGATGAAAATGG
AGTGAAAGCGACAGACCAAAGACAAATTGAATGCGTTCACCCAATTTTTTTCTGTTTCTG
CCTCTTTTTCTTTTTTGGCCAAAGCAAATGCCAAGAATCCAATACGGAATTCATATGCTG
GCGAAATAAAATTGAACCAAATCCAGTCAAGCAAACATTGAGCTTCATTTGCAGCAGTTG
AACCCTTTTATTGTCGGAATTGCTTTATTACGATTTTGAGAGCCAGTGCTTTGACACCAG
CCAAAACAGAAATCGAAATATGTATAAATAAAATGTTTTTACACAAAGAACCATATGCCA
TCGAAGTATTTTACAAAATTCAAAAATATGGCCACAAGGCCGGAATGCTATGGACCGCAT
TAACACAACAATTCCATCAAATTGTACATGCTTTCATTTGTAACACAAATAATCCGGCAG
CAAATAGAAAAACAAATTAACAAGTGCTGTTGGTGAAATTCATGAGAACTTTCTATTCAA
TTTAAGAACATTACTCCTCCTGCAATAAAATATATCGCAGTGCTAGGCAACTAGTACTTA
TATATTCATATATTCTTTTATATACAAATTTTACAGCACTTTTAAAATCTTCTTCAATTT
TTTAAGACCAATTATGTTACATTTAGATTCAGAACATTGAAAGCAATTACCAACATTTGC
TTAAATAGGCACAAGAGATATTAAATTCGTTTGCCATTCCGTTAGGCAAATGAACAAGAT
ACTACGCTGATATCTGGAATGTCTGCATTTTATTTGACATCATTTGTGGGCAATGTGCAA
AAAGTGTACGAAAATAAACGCGACGTCAACGAAACACTTTTGAAGCAATTGCACCGTTGA
TGGCACAATTATCAGATGCAACTGCAAGTGTCGTTTGAAATGGTTTCCCTGGTGGGTGGA
GTGGGTGGTGCAGAGTGTTGCTGGGAGGTGTTAGGTGCTGCTAGATGTCATTGCTATGAG
TGGTACATAGATGCAGAGCGAGTTTATTGAACCTGCCGCAGACTTGGCTGTAATAAAGTG
GCACCAAAAGTTGAGTTGAGTAGGTGAACTGAATGAAAGTGCGCACACAACTTAAGCACA
CTCCAATGGACTAGCATATTCACACATCAGGCGAATGAATATGACTGCTCTTTTCAGCCC
CATTTTAAATTGAAAAACTGTGCGCCGAGTAAATACACATGCGAACAGCACATATGTGTA
TATATACATACATATTTCATCCTATATCTCCTGTATTCCCGTGCTCCAAGCCAAAAACTT
TTTCTAAAAATGCTTTGTGCGAACGAGCTCGCTTCTCGTTTTATTTCTTTTTTTTTTTTT
TGCCCACTTTTTGTGCGGCTGCAATGGAAAATAGTTTTCGTGTCTGCCGTAGGTGCAAAG
TGGCCATAGATGCGGAGTTCGGCCACAAATACCGCTCCGTACAGCTGCATAAATATTTCG
ACGCAGTTGTCCATCATAAATCTGGCGCACTAACTCAAACATTGGCCCGCTATTGTTTGC
CCCCCAGGCTCTATCAGTTCTATGAGTATCTGCGATTTGGCCGGCAAAGAGGATCTGGGG
ATGTGGGCATGTTTGTCCAGGGAGGAGGAAGCATAGGGAGAGTCGTCCAGGCATGGCAGC
ACACGCACACACACACACCCAAGACTTCGACAGTCAGTGGTTTCATAAGCCCGGTCTGGG
CTATTGACCGACTCCTACAGTGGTCATCGGGGCACTACAACCGATTTTGAGGTGTGACAC
GCAAAGTGAGAAACGGCAATTGCTTCCATTTCATTAGGATTCATTTCGGCAGTAGTCGCC
CACCGAAGATAACCGTTGAAACACACAGATAAATTTGTCACACATGATTTGATTCGTTTA
TTCAATCATTTGACACTCCAGCGAAGCGCGCAACGATTTCAACTTATTCAAGTTGTCGGT
ACACCGAGAGAAACTAAATTGCTGTTAGGAATATGAAGTAAGAGTTCGAGAGCTATGTTA
AACATTTCATTCATATGTTATTTCAATTTCTTGCACTGTGCATTCGCAAAGTGCTTTCCC
ATCGTACGAATGTTTTTCGAATAAATAAACAAGAGCCAAACTCATTCACCGAGCGGCACA
CTCATAAAAAGCAAACAAAAAATACAGCCTAAATCGTGCCCAAATCCAAAACGTCCTGCC
GGGTCACTCGTCACCATCGCCATCGCTATTGCCATCACCATCGTGGCCATCTCCAAACTC
CAACTCCATTTTTGGGGCAACTATCCGCATTCGCAGCGCTGCTGCTTTTGGCTAATGGTC
TAGGTTCTCATGCAATCTCTGCTGCCGTCGGATTAGTTTGTCCAGCCATATATATTCCCC
CATCCACATCCGCATCCGCTCCGACCAATCTACATCCTTCCTGCCGCTCCGTCTGCATCC
GAATGCGATTCTGTCCATTTTGTGTTCGAGTGTTTTATTTGTCGTCCGGCTCTATTTGCC
TTGATTTCATCTTTAATTTAGGCATCGTCTGAATGTCCATTCGTCTATCCGTTTGCCGGT
TTTATGGCTTGTTTGCTCGCTGGCCGCTTATCAAAACATAATTCCGGCCATGATGGATTC
TCCGTCCGCCCATTTAACATGGCCGCGGGGCGTGGCCGGTAAATTGAATTTCATTGTTAT
GGCTACGGTAATTAATACGCACACATACACACATATAGGGAATGGAGTCGTCCCATACAC
GCACACACAGAAGAATGGGGGTCACTCTGATATGCATACATGCATTTCCGGTCGCTATAT
GTATGTGCGCTCTTCAATGGCAGATTATGCATAATTACAGCCATATTTACAATGCCAGCA
GCGATTTGAAAGCCAACGGGGTTAACCAGTCAGTTGACCATTGAAGGCTAATTTTACTTG
TACGGGGTCGTGAGCCCCCGAGATTTAAGCAGATTTGCAAAGGAAACGCTCGAGGGAATC
CACTATCACCGTTAGTGGGAAGCAGAAAAGCAGACTTTAAAGCTAAAATATTCAGCAAAA
ATTGTAATAATATATTAATGGTAATCTGTAAAATCCGATACCCATAATTTGTTAAAATTG
AAAAGCATATTATATGACTTTTACAAATGGAAATGCATCAGACTAATGTCTTTATCATCC
TTTACAATCCTTTCAAAGCTAACTTATAAATTTGGTAATCTTTTAAGCTGCTTTTTGAAT
TCGGCACCACTGTCACATTCAAAGCAAATTCAATGCCAACCAAAACTGCTAATCAACTAG
CATTTTTTGTGCTCGTCCCCAATCCTTTTGAGCCCCAAGTATTTTTGCTGTTTAATTGCT
TGCGCTTTATTTGCGCACATACTCGTATTTTATTTTATGACACAGCCATTGACATCCGCC
AAAGAGCACAAAAGCCATAAATAACAAAAAGAAAGGACCCAAAAATAACCAGGCAAGCAC
CAACAGAAAAAAAAAAGGTGAAAAGAAAGCGCACTCAACTGACCTCAACAATGGCAATCA
GTCGACGTGCTCTCTTCAATTATTTGCTTTTGACCCACAAAATGGACGAACGACTCTGGA
CTCTGGACTGAATGTTACCACCACACAACTGATGCGTTGCGTCAAGGGTTGAGGATTGCT
GCTTCTGGTTTTCGCACGTATAAAGCGTGGCCCAGAGCGAATAATCAGTTGGAACCATAC
CAGCCAGGCAGCAGGACAGCCGGAGCGATGGTGGGTTTTATTTTTAATTAAACTGGCAGT
TGGCAGTCGCGAGTTCCGGCCGTAGAGCTCATAAAGTGGGCGGGCGGGCAGGCGGACAGA
CATTACGCATACGCTGCGTGACCAGGATTTAGGGAGATAGGGGATTTGGGGGAAAGAGAG
AAAAGGGAAAAGGGAAAGTGCAGCCAGAATGTGTTGAACATTTTTGTGGCCGCCGTTAAA
AGGGTGCGCAACTGGACTCGGAACGGAAACGGATTGCCTCTAAAATGGCACGTTTTGTGC
GTCAGTTCGTTAGTGTGAATGATGTGGGTGGGCTAAGGACCAAGTAACAAGGACCAAGGA
CCTAGGACGGGGAACGAGGGACGAAGGACTCTGGACTCAGGATGGCAGACTATGTGGGAG
GTGGCGACGCTCAAAAATTTAATTACTTTCACTTGTGCGAACTGTTTGTCTGCCAGTCAG
ATGAGTGGACGAGACGGCCAACAGGCATTTAACGTAAATGTAATGAAATTGCAGACGGAC
TCAGACGCACACCGACTGCTTTCCGTTTCCGTTTCAGGAGTCCTTTCCCTGATCCTTCCT
TGCCCGGTTAACGTGCTGTTAGCACTTCTTCTTGTGCGGGTGGCAAATCTTGCGAGCTTT
GTAACGCATTATGCGGCAAGTTTTCTCGCCTGCTGTGAGCTGCGCAGAGTGCATCGTCTT
TTTATTACCACATTCACGTTCACTGCCAAGTCCTCCTCCGTATCCTTGCTCCTTGGAGGG
CTGGAAACGATAACTGGATTAAATGCCAACTGGGAAACGTGTTTTGCTGTAACCACTTTC
GAAAGGTTCTAGTCTAACTTCTGTGTGCCACCATTTCTCTTTTCTTTGCCGGCATTCAAA
TCAATCATACGCCATGTGGGCTGCTATGTTTTAAATTTAACTTTCATGTATGCACAGCCA
CGCAAGCAAAGGGTACATACAACAAATGAACGAAAGTATATATGTATATATATATTTTTA
ATTCACAAAAGGGCACACGTGTTCGCAGTACTGCACAGATTTTCCGATTGTGTATGTAAA
TATTTGCGCAATTCTAGAAATTTGTTTGACTGTTAAATCAAATGTAAATACGATATGTTT
TCAAAGTCAACATGCAGCAAATGCAGCAAAAACAATGGCGAATAGAGCAAGTAGGAAAAT
TGGCGAAAACGTGAGCAGATTGAACACAAAAATCTCGATGGCGTGTAATTTAATTCTGAT
TTCACAGCACATTTCAAGCGAACTAACTAACAGGATTGGTATTTCAGCCAGAGTTTTGAT
CCCCACATCAGATTAAATCATAATTCCGATCCTTGACAGAAACACAGACGTCTCGATGCT
GCGCTGTCTGTCATTTAGTGGGTATTTTTGGGGGCGCCATCACCATTTCCTGTTTATTTG
CTCCTTTTGTTCGAATTGCAGCAAGGCGACCACAGCTCGGTTTACGGTGCGTATGATTGA
CATTGATTGGATCGCAGCCAAACAAACTGTGTGGTTTGGCTGTCCAGTCACTTTTTTCTT
CATTTTTTTACCCTTCTGATTGCCATGCTCTGATGCACTTTCGGGAACTAAATCAAAAAA
CGTTTGCAGCTTGATAAATATGTAATTTGCAATTTTGGCCAAAACCACACGCAGCAGTAA
ACCGAAAAACCCATAGAAGGAGTAACAAAACCTTGGAATCCAGACATGTTCAGCTGCTTC
AGCATAGGGGTTACCCTCAGTACAGTGAACACTTCAAAGAGAAATGCACTTAAAGAACAT
ACTTTACAACTGAGGGGCTGTTTAACATATGTTAGATAGAAAATATTTATGAAATCCTTC
GTTGCGTAACTGATCCCTTCTAAAAAGTGATAAAGTGATAGTTATCAGGTGGAAAGATCG
AAATGAAGGAAAATCGTTTCCCCAGTTTGATTACTTACTATTCGTAAGGCTACAAATTTA
AGATTATTACCCATTGGATACGTGTACAACCGATTGGCATGCGATCGAAGTGGCAATGGA
TTTAACAGTCTGCCCACACACCCACGTGGAATGACCCACTTACCAACAAGTTAGACTCAC
AGTTGCGACTCAAAGATGATTGGTTTTGCCGCTTCAGTTGTAATAATCAAATTGCCAGCA
TCCGTATCCGCATCTGCACAGCGGAGTTTCCCAGCATTCGAGCTCACCAGTTTCCGTGGA
CAGAAGGAGCAGGTGAATTGCGAGGCGTGGTGGTGGGAAAAGGGCGGAGTATGAAGTCAG
TGGTGATGCAAGTTGGGAATGGCAATCCAGGGGAGGAATGTGGGCCACGTTGAGCGGCCT
TCAAAAGTCAAAAGGCGTTAACGTTAATGCCGCCCTATCATGAACTGCCTCGGATCCACA
TCCACTCGAGCGCAGGCTTCACTGTGCCAGCCGTGTAAATAGCATGAATGCAATTTTATT
TTATTTATGTTTGAATTAAGCAGAGCTCTGAGCAGCCAGCCAACCAGCAGCATTTCAGCA
GGAGCACTCAGACAGTCTTTATAGGCAAATGAATTGCTCTATACCAAGCTTATTTGGGAA
AATGTGGAGCAAATGCTTAGAGCTGGCAAATGCTTGTTTTGACATGAAAAATAAAGATTA
ATGTTGCCGAGAGTATGGTTTAAAATGATCTGCTTAAAATATTAAACAGGCAAGCTGCCT
GAACATTTAAACGTAGAGTCTGTACTGGTCGGTATGAGGTATTATTTATTTCCCCCAGCT
TCTATCTTTCTTTTTTTTTTTGTTGTTGAATGTGCAAACGCACTTAATTAATTTTGTTTA
ACATGTCTGAGGCAGACAGGGCAACAATTTCATATTTTGCTTGTTAACTGTTATCGTTGT
TGCTGCTGCCATTTTTACCGACCACTGCTGGCCATAAACTCCCTTATGCACATTGCGTAT
ACGACGCGTGGAGCGTGGACAAACAAAGGCATCAGCTGGGCAGTAACTCTGGACTCCAGC
CATCCAGCCATCCTGCTGATGATGATGATGCTGATGCACTGATTAAATGGATATGCAGAG
TGTGTCTATCCAACGGCCTGGCGAAATGACTGTCAGGGCAGCACGGCTTTATTTTATTTC
TGGGCAGGATGGTCAGTTGGGGTAGTTGGGCCAGAAGATATTGTCGGTGCGAATTATAAA
TTACCAGCTGGGCGCATCGGCCCGAAAGCTAACCAAACGCCAACCAAGTGTACGGATGAG
CGGACCGGGAGCCACATGAAATTTCAATTAAAATAAAAATTTATACGCTTTTCGCCTTGT
CGCTTATAATTAAAAACAATTTGCAAGTTATGGGCGACGGGAGCAGCACTGCTATAATGC
CTCTAATTTAAATCGCTTTATCTCTGGCCTTGCAGGCGGTTTCATGGGCGACATTGCCCT
GCCGGAGGGTGATTCCGGCCCGGTGGTTGCCCACACGCCCATCGACGACGAGGAGCAGGA
GCGCCAGGAGGTGGAGCAGCTGCTGGCTGACTCGCCCAGCCCGGTTCACGACCCCCCTTC
CGTTTCCGGTGCGGCCAACTCAGGGCCGACCAAGTTCAATGCCACCTTCCAGCTGGATCT
GGAGAAGCTCAAGCAGGAGGTCTACCACGAGGGCCTACAGGTGGAGGAGGAGGGCCTCAC
CGACATCATCCGCAAGAAGACCAAGCTGCCCAGCTCAGGTCCGGTCAACCTGAAGGCAGG
ACAAAGCCAGTCACAGAGTCAGGTGAGTAATAAAAGGGGGCATGAAATACGCAAGGGTCT
TTCAGTTAGAGATGAGTTAAGCTTAGGTTTTATTATTAAATATATGAATTCACTAATTTG
ACTATAAATATTGGTATTATTACCAAGTAGAAATTTATGTAGGAGGTCGTTGGTATTTGC
AAATTTTAGAAGTACTTAAAATGTCTTGAAACTCTTGAATCCCTCAGAGTGCCAATGAAC
CCGTGAAGCCCGGTTCGGAATCGCCCTCCGATTACGCGCAAGCATCCAGCTACAAGAATG
AGGTACTGCCTCCGTCGGAGCAGCGAATCCATACGGACAAGCCGGCACGGTTGACGCTGG
CCGAGATTGGACCCAAGTTCAGCAACAAGACGCAGTCGCTGCACCGTAATGTGGACACAC
GCAAGATTCAGTCGGACAACAAGGACATCGAGGACGATTCGGGCAACAATTTTGTGGCCG
AGAGGAGGCCGTCACAGATTGTGCCCACTTCCTTGCCGGAGCAGCGATCCACTCCGGCTC
ACGTGTACAGCAATGCCGGAGGCAATGGCATGCAGTTGGACGACGAGGTGGACTTCTTGC
ATTCCCGTGGAGTCGTGAGGAGGCGTCACAGGCGAGGACCAAAACAGCGGTAAGCCAAAA
ATTACAGAACCATAATAAAGATTCCATAAAGGATTTATGCAAAATACATTTCGTATTAAA
AACACGTTGCATTTTAATTCCAATTTATTTCAAAATATTTAATCTAATTGCATTAAAAGC
TAATTTATTGCTTAAAATAAAACATGTACCAAAAGCGGAATTTAAGTATCAAAAGTCCAT
ATGAAAAGGCTAAACATTAAAATTATTTTTTATGCCGGAAAAGCCGTACAACTTGGGGTC
AAATAATAGTTTAGGTGTTTATTTAAAAATCATTAAATTCAATTTGTTAGAATTCCTTGA
ATTTTATGTGTGATTAATTAGATACATTTAATTGGTTTTTGGCCTAATCGAATTGCTATG
AACTATTTTTACCTCGTTTATTGAAATCTAAACTCAATGGTTTTCCCCGCAGAAGGAGCA
ACCAGCACTTGGAGCACGAGGTCAAGCTGCAGAGATTGAGGGAGGAGCTCAGCCGTCCGG
TCATCGAGGCCCACCATCACCAGTCGCACCACCAGAAGCAGGCGCAGCACCGCCAGCACC
ACCAGAGCCACCATCGAAAGAAGCACCGTCGACAGCAGCAGCACCATCGTCGACGTGGCC
AGAGCACCACGCAATATGTGAACCATTCCCCGCCAGGATTCAATCAATCGCAGCAGGCCC
AACAGCAGTCAGTGCCTGAAATGGATTTGTTGAAAGCGGAGTAAGTTGGTCAATCCCCAC
CAGCTTTTCCCACCTTTCCGTTAACAGAGTACATCCCCCCCCCTACTTCTTGGGCAACCA
CCGCCGCCACATCCGTTTCCGCTGCCATTTCCTGGCCTCACTGTAAATTGCTGGCCATTT
TCATTCAGAGGTTTTTCGGCATAAACTTTAAACAAACAGCAGCCATTTTGGCAGCTCACA
CAGACACAAACAAAAGCTCATTCACACGCACACATACACACACCCATTCACGCAGGCCCA
ATGCTCATTGTGCGGTTGTGTGGGTGTATGCTTGTGTGTGTTTGTGCATGTTAAAAGTTA
TGAATTTTAATAGAAATTCGCGTGCCAAAAGTTGTGCCATACAACAACAGTGAAAAATGT
ATGGAAAACTGTTGGCAATTAAAATTACGCATACGCCTCGTAAACTTTTTGCCCGTCGCT
TTCCAAAATCATCCATATCTAACAAGAAGACATCTTCCCCCTCCATCTGCAGAACGTCCA
AGGATGAGGAGCCACTGCGTCATCGGGTGGCCCGTGCTGTCACCGCCAAAAAGGAACGCA
TCTGGGACTATGGGGTGATTCCGTACGAGATCGATGGCAACTTCAGTGGCATCCATAAGG
CGCTTTTCAAACTGGCCATGCGCCATTGGGAGAACTCCACGTGTATCAAGTTCGTAGAGC
GCGACCCGGAGATCCATCCCAATTACATAGTGTTCACGGTTCGCAGCTGCGGGTAAGTTT
GGTGTCCTGGTTAGTCCCAGAAATATCATTCTATTGAATCCCCAAATTTCCAACTAGATG
CTGCTCATTTGTGGGCAAACGTGGAAATGGACCGCAGGCCATCTCAATTGGTAGAAATTG
CGATAAATTTGGCATTGTGGTCCATGAGTTGGGTCACGTGGTGGGCTTCTGGCACGAGCA
CACGCGTCCGGATCGGGAAAAGCACGTGGTGATCGAGCATAACAACATTATGAAGGGCCA
GGACTATAACTTCAATATGCTATCCCCCGATGAAGTGGACTCGCTGGGCATGGCCTACGA
CTATGATTCGATTATGCACTACGCACGGAACACCTTCTCCAAGGGCACCTACCTGGACAC
CATCCTGCCCATCGAGATGAAGGGTCGCAAGCGTCCTGAAATAGGCCAGCGGTTGCGCCT
CAGCCAGGGTGACATTGCGCAGGCGAATCTTCTGTACAAGTGTCCAAAGTGCGGAAGAAC
CTTTCAGGAGAGTTCCGGCATCTTTGCCTCACCATCTCATTACACGGCCGGAGCTTTGAG
CAATGAGACGGAGCACTGCGAGTGGCGGATTACAGCGACATACGGAGAAAGAGTGGAACT
GAAACTGGAGAATATGGTAAGGACGTATATAGTTATTATATTCTGTTATGTATATCTGTC
AATTTCTTAACCCTCCATTAGTACTAAATTATAATCCCACATCTACTTTCCTAATTTCCT
CTTAGAACATCTTTAAGTCAAACAACTGCGAGACGGACTACCTAGAGATTCGGGATGGCT
ACTTCGAGAAGTCACCGCTTATCGGACGCTTCTGCGGCAAGGTGGACAAGGAGGTGATCC
GCACGGAGTCCAGTCGCATGCTGCTCACCTATGTGAATACACACCGCATCGAGGGCTTCA
GGGGCTTCAAGGCGGAGTTCGATGGTGAGTGGGTGGAATGAATGGGGCACAAATGGGGAA
TGAAAATGGTCCCTGCAAATTTCTGACATTCCGTTTCCATAGTTGTTTGCGGTGGCGAGT
TGTCCGTGGACGATGCCGTTGGCCGTTTGGAGTCGCCCAACTATCCACTGGACTATTTGC
CCAACAAGGAATGTGTGTGGAAAATAACTGTGCCCGAAAGCTACCAGGTGGCGTTGAAAT
TCCAGTCCTTCGAAGTGGAGAACCACGACAGCTGTGTCTACGACTACGTCGAGGTCCGGG
ACGGTCCTGGCCAGGATGCGCCGCTAATTGGCGTTTTCTGTGGCTACAAGCCGCCGCCGA
ACATGAAGTAAGTGCCACTGAAGAGGCGCCAATCCTTTCTCCTCGCCCCCCCCTTTTAAC
ACGAAGGAACTCTGCTTTTGTTCGCCGTCCCTTTGCAGGTCAAGTGGCAATTCGATGTAC
GTGAAATTCGTGTCGGACACATCGGTGCAGAAGGCGGGCTTCTCGGCCGTGTTCATGAAG
GAGGTGGACGAGTGCGAGACCCAGAACCACGGCTGCGAGCACGAATGCATCAACACCCTC
GGTGGCTACGAGTGCAGCTGCCGCATCGGATTCGAGCTCCACAGCGACAAGAAGCACTGC
GAAGGTGGGTTAATTGCGGCCCAAGTGCTGTTCAATCGAGTTGTATTCCATTCCATTTTA
TGTTAATAATTGCCAGGGAAAAATACGAAATGGGTATAAACATTCTAGTCATGGGTTAAA
TAATTTCAGCATAAATTGTTTAAGAAAATGAGGAAACAAAATCAAAAATGAAGAGTCAAT
TAGTTGAATCCCTAACGTTTTCGCTTTTAACTGAAAATTTCCCTTTTTATTAAGATGCCT
GTGGCGGTGTCATCGAGTATCCGAATGGCACCATTACCTCGCCCTCGTTCCCCGAGATGT
ACCCTCTGCTGAAGGAGTGCATCTGGGAGATTGTGGCGCCACCGAAGCACAGGATATCGC
TAAACTTCACCCACTTCGACCTTGAGGGCACGGCGCATCAGCAATCGGACTGTGGCTACG
ATTCGGTCACAGTCTACTCAAAACTGGGCGAGAATCGTCTGAAGAGGATCGGCACCTTCT
GCGGCTCCAGCATTCCGCCTACGGCCACCTCCGAGAGTAATGCGTTGAGACTGGAGTTCC
ATTCGGACAAGTCCATTCAGAGATCAGGCTTCGCGGCCGTCTTCTTCACGGACATCGACG
AGTGTGCCGTGAATAATGGTGGTTGTCAGCATGAGTGCCGGAACACGATTGGATCCTACA
TCTGCATGTGCCACAACGGGTACTCCATGCACGAGAATGGCCACGACTGCAAGGAGGGCG
AGTGCAAGTACGAGATCTCCGCCCCCTTCGGCACGATTTTCAGTCCCAATTACCCGGATT
CCTATCCCCCAAATGCGGACTGCGTTTGGCACTTCATAACCACGCCGGGGCACCGCATCA
AGCTGATTTTCAACGAGTTCGACGTGGAATCGCATCAGGTAAGCATGAGTTTATTTATAG
GTTTCGTCCTTGAAAAGACATCTTCTTTGAGTACTTTTCGCTGTAGTTTCTGCTAGTTAG
CTTAAAGTCCTGTAATTTGCATTGAATTTCTAACAGGAATGCACCTACGACAACGTGGCA
GTTTACGATGGCGAATCTGAGTCCAGTTCGGTCCTGGGTCGCTTCTGCGGGGATAAGATT
CCCTTCCCCATCTCCTCCACCAGCAACCAGATGTACATGGTGCTCAAGACGGACAAGAAC
AAGCAAAAGAACGGCTTCACAGCCTCCCACTCCACGGGTATGATGGTGTTGAAATCCTAA
GCCATCCGCAATTTCAACATTTCGATAATTTACTTGCAGCCTGTGGGGGCTACTTGCGTG
CCACTAGCCAGGTGCAGCAGTTCTATTCGCACGCCCGATTCGGAAACCAGGACTATGACG
ACGGCATGGACTGCGAGTGGACCATCGCGGCGCCGGACAACAGCTACGTCCAGCTCATAT
TCCTCACCTTCGACATCGAGAGCAGCGAGAACTGCACCTTTGACTACGTGCAGGTGTTCT
CTGACATAGACGATGTGTACGGACAGTATGGACCCATGTACGGACAGTACTGTGGCAATG
TGGTGGGTACACCTATTTCGTTTATCCGGAGAACATTTAAGCTAAGCATTATTTACTGCA
GCTGCCGCAGGACATCAACTCTATGACACATTCTCTGCTGGTTCGCTTTAAGACCGACGG
TTCGGTGCCGATGAAGGGCTTCTCTGCCTCATATGTGGCCGTGCCCAATTCCGGGGAGTA
TGACCACTCCGACGAGGATGTGGAGAACTCGTACAGCTCCGAGATGGTTACCCCGTTTCC
GGGCTCACTGAAGAGCATCTACATCGAGGACACGCAGGAGGAGACCGACGAGTACAGCGA
CTTCAGCGGCAATCAACTGGTCTTCAATGGGCAGTATCGTGGCCGATATAGTCTGCCCAA
ACGGTACTACTCCGGAAAGGCATAGGGCTATGGTGGAACCACTGACCGTGCGCCAAAATA
CATGACAATATATTAAAACGGAATTTATTTAACAGATTTAGGCATATCGTCGCGTACATA
AAACAGACTTTCCCGATCTTCCACGCGCACTCTTCTGGCCAAATCCAGGATATAATCAAA
GATCCAATACTAGTTTTAGGCACTCGAAACACACATTGTTAGGTTCCAGTCGGCTAAGAT
CTGCGGTGGCAATTACTTAGACCCCTATGTCATACATGTAATGTACTTTGACTAGACTTC
TCTAGACTCTGTAGCTAAATGTGCAATTCCTCTTCCCCCCTTGCATTTGACTGCTTTTTT
CTCTGACGCATTTTCATTTTTTTCGGATATCTATATTCTATATTGTGCCATATTTAATGG
TAATGATGGAGTGCATTTCCTTAGGCATCTTAGCATAAGTCAATGGGTGGCCCATATCAA
AATCAGAACGGAAGTTAGGATAGAAAAGAGATACACACATATCTTCGGAAGCACCGAAAG
TGGAGGATCCTTACAGATGGATTGAATTTTTCACACAGGCATATGTACAACTCTCGGATA
TTTGACTCAACTTAATACGTAATTATATCTATACATATTAAAACTTGCATAGTAACTATG
TTTTAAAACCAAAACAAAACGAGTTTGAAGAATGTTATTTACGGACTTTCGGGTTTATGG
GCTCATGGATTTATGGCCCTAGGTTCCACCTTGCCACGCCAGGCAGAAGCGCCATGGCTC
TTGAATAGCATTTGAAGGTGGAATTACCGCGAAACGATTCGTTCATGCGGCGGATTTACG
ATCATTAATGACCTGCCCTAAAAGGCACGAACCCGCTTAAGCAACACCTGATCCTGGGCA
AATGCCCCTGAGCCCGGCCAGCGACCCAGGTAGATGGCCACATACGCGTACACGTATAGA
TGGACAATGTCAAGGTGTGAGCAGGAATACCCAAATCAAAATCCATTGAATGCAAACAAC
AGGCGGCAGACAATGGTCATCCCGAATCGCCAATGAGGAGGGGTAGCACTCAGGTCTGGT
TATGGCTCTCGTCTCTCCTTCTATTGAGCCGTCCCTTCGAGCGGTCAGTCGAGATTCTGC
AACGGCCTGCCCTGCCACGCCCCTCGTCCACCGATTCCCCTACGAGTTGGGATCTGTTAC
CTGCTGCTCACTCACTCGATCCGTGGAACCCTTGTCGGCGCACCAGTATAATTCGGCAAT
CGCAGTCCACGAGCACTCAGTTAGAACTTTGAACTGGTTGAAGCAACTTCAGGGAACGAG
CCCCCAGAAATACCCACGCAATGAAAGGAATGCGCCTTATGCCCATGAAAATGAAAGCGA
AATTAGTTGTTCTCTCTGTGGGAGCTCTCTGGATGATGATGTTTTTTCTGGTGGATTACG
CCGAGGGCAGGCGACTGAGTCAGCTGCCCGAGAGTGAGTGCGATTTTGATTTCAAGGAGC
AGCCAGAGGACTTCTTTGGCATTCTGGATTCTTCACTGGTGAGTGGTGGAGTCACGTGGC
CCGACCTAAAATTACAATCTTCAGCATTACCCAACAACAGGTGCCGCCGAAGGAGCCAAA
GGATGATATCTATCAACTCAAGACAACCAGACAACATTCGGGGTAAGTTCCACTGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1043, 9010..9630, 23915..24261, 24467..24888, 25312..25599, 26092..26331, 26397..26955, 27065..27263, 27342..27606, 27698..27903, 28134..28777, 28896..29076, 29139..29401, 29461..30437
9174..9630, 23915..24261, 24467..24888, 25312..25599, 26092..26331, 26397..26955, 27065..27263, 27342..27606, 27698..27903, 28134..28777, 28896..29076, 29139..29401, 29461..29781
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved