Drosophila_melanogaster Locus Dys
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Dys
Drosophila_melanogaster
Dys
3R
snoRNA:Me18S-A1374
126109..126176
136308
ATATGAAAACTATATGCAATACCGAAACACAATTAAAGTTTGAATTAAATACAGTAAAG
TAAATCGAAAAAAAAACACACTTAAACAAAATGGAGTCTATGTGTAAATGCATTATAATT
AGAATTGCAGTAAACCATACAAACAGAGGCGAAACGAAATTTAAATAAAATTTTTAACAT
TCCAATGATGCTATTTCTTTGGTGTGCTGTTTTAAACAACAAACAATCAAGCGAGTTTTC
ATTGATGCAATGGGGGTTAAATATGGTGTAAACATTTAATGCTATTTACATGCTTATCTC
CTTATTGATTAATAGTTGAAAATAATTAACAAGTTCCAAGTAACCAATTCCCGTTTCATG
ATTCCTATCGCCGAATTTATTAATGGCTTTATCACAGTTTTTTTTTTTTTTTGTAGGTAT
GGGAAAACCTACGAACATTTTCCTTTCACACCTCATAGCTATAATGCATTAATTAATTGA
AGGAATTTCAGGCAGTTGACAGTCGTAAGCTATCGCAGTCCAAGTTATACACAGGTGATA
AGATATGTTCTCTCTCTCACTTGCACTCGCACACCCATTAGGAACTCCCCTAATTACTTT
CGCGGAGAAAGAGTGAGAGCGGAGATAGCACGCGCTCTCAGTGCAAATAAAAGCGTATGT
TTTTATACCCAGTATTTTTAAAGATTTTAAGGGTATAACAGACTATACTAGTATAAATAG
GTTCATGGATAGGTTCCAAAATGTTCGTAATACTTAATTATTCCATTTAAAGTTAAAAGT
ATCTGAACTTTTGGTATATGTATCCTTTATAATTGCAAAGAATGGTGTGTGTAAAAGTAG
AGGGTATTTGCTGTTCTACAGGCTCGATCTAAGATTTTCCACTTGTTATACTACTTGATA
TTCTAATCAGTCTGTAGATTTGTTTTGTTGTTTTTGATAGCCTTCGTAGTATTTGCTCTT
GATTAGCTGAGAACGGCGGCAGAAAATCGTCGGCTCGCCTTAGTCGTGTTTAAATTGGAA
GCGCATGCGGTTGTCGGTGCTCTCGGTTCTTGATCCTCCATAATCGGTGGCTCCGCGTGC
CATAAATACCCCACCACTACTATTCCACTCAACTGCACTTACTGCAACCTGTGCCTTCAC
CAAATAGTAGGTTTTCAAACAAACCGTATACCCAGTGTTTAATCTAAGCTGCCGAAGAGT
ATGCAATAGTGTTCAGTGCCTATCAGTGATTAGGGAGCCAGTTTAAAAATAATACCTAAA
AATGCACGATCCCAGTGACTACGACTCGGTTTACAGCGAGGAAGACTTCGTCGACACCGT
GCGAGGAGCTGCAACTCCTCCGCTGATGGACTACGAAGAATTTCGGGTGAAGACAATGGG
TGAGTCTGCTTACCATTTTGGCCATGGCCAAATTCTTTCTCGCTTATCTTGTATTTGCTG
TAGGCTTATGAAAGCGAAACTTTTTCGTTTTGATACGAGACTCATGATAAAATGCCAGCC
ACAGCGGAAAATTCGTTTGCATATCGAAATTAAAATTAAATCGGTGGAAATTTTTACTAG
ATAACAGTTAGAAAATATCTCAATATCAATATTTTGTAATCAAAGACGTTACTGCAAGCA
CCTAGTTTTGGGAGCTACACCAAGAAGGTTTTATCAAAACACTACTTAAACATTACTTAA
ATATTAAAAAAATATATTTTTTCTGTTTGTTATGTGTTTAGATATAATCCCATTGAACTT
CTTCATCAATTTTATAATTTAGACTTCGAAAAAAAAATAAAAGAGATATTTTAGCAATTT
AAAGAGCACTAAGTTAGTTTATTGGCATCAATAACTTGTTCCGCCACTCCTACTTCTTCC
CGGCCTGAGCCTTCTTTTTGTTCGGCTTGGGCACCAGTTTCAGGCGGATCATTTCCTCGA
GGAGCGTGGAGCCCAGGTGGCAGGGATTGGCGGTCATACGGACTCCCGCTTTCTCCAGGG
CGGCCACCTTGTCCTTGGCCGCTCCCTTGCCACCGGAAATGATGGCGCCGGCGTGACCCA
TTCGACGACCCGGTGGAGCAGTCTGTCCAGCAATGAAGCCAACTACTGGCTTGGCCTCGC
AGCCAGTGTTCTTCTCCTTAAGGAAATCGGCAGCCTCTTCCTCGGCGGATCCGCCAATCT
CTCCAATCATGACAATGCCCTTGATCTCCTTGTCGGACAGAAACACTTTGAGGGCGTCTA
TGAAGCTAGTTCCGTTAAAGGGATCCCCGCCGAGGCCAACGCAAAGAGCCTGACCCAATC
CCACGTTGGTGGTCTGATGGACGGACTCGTAGGTCAGGGTTCCCGACCGCGAGACTATGC
CCACCACTCCTCGCTTGTGGATATCTCCCGGCATTATTCCGATTTTGCACTGATCCGGCG
AGATGATTCCCGGACAGTTGGGTCCCAGCAGGCGGGACTTCTCCTGGCAATTCAGCATTT
GCGATATCCGCACCATATCCGCCTGGGGAATACCCTCGGTGATGGCCACAATCAAGCCAA
TTTCACTCTCGATAGCCGCGCAAATACCCTCGGCGGCGGATGGAGGTGGTATAAAGATCA
CCGTGGCATCTGGCTTCGCCTTCTCCACAGCTTCTGCCACCGATTTGAATACGGGCTTGC
CCAGATGCTCCGTACCTCCCTTTTTGGGATTCACACCGCCAACTATATTGGTTCCGTACT
TTATGGACTCCTCCGAGTGGAAAGTGGCCTGCTTGCCGGTGAATCCCTGGACTAGAACCT
TTGTTGCCTTGTTGATCTTCAGGTTGCACACCGTCTTGCCATAGTCCGCCTTGCCACGCC
TCAAAATTTGGGGCGTTAACGCCCGCAGGAGCATCTTGCTTCCTCGATTTAGTGACATTT
TGTGGGAATTAAGTCTTGGATTGCTGGTGGATTTGTTTTTGGGCCAAAAAATTAAACTTT
TGGGGCCTGATTTAGAATGGAGTTCTTACCAAAACTGTTGACCGAATGTCAGGTTTCAAC
AGTCAAATTATCAGGGAGGTTTGGAAAAAGGCCTGCTGTGTTCTTAACAAATCCTTTTCT
GGTAATTTACGTACATGCATGTTTAAGTGCATTTTCTTTTATACAACATTGAGGTCCTAT
AACTCCTAAACCTTGCTTTGTAACTTCATGTTATTAAATTTAAAGAGTTATTATCTGTTA
TAATATAAATTTGATAGTAACTTGTTAAAGTAAAAATGAAAACAAATTATCTACCCCACT
GTGCCTGCGCTCAGCCCTTCAATTAATTCCGATTCGATTTTAATTGAAATCCAATAGAAA
CTCCTCTTTTATCTCGCTCTCACTCTCTGAGCGCGCGAAACAGCTGAACTGAAACGCCCG
CTTTGGCCAGTTGGGCTGCAACCCGTTCCAATAAGATCATCGTTCAAAGAGAGCGAACAA
GAATAGCTACGTTACGATCGCGTTTCAGATCGCTTTCTGACTTCGAAGCGTAAAGACTTA
AAACGCGTCGGATAAACACCATGATGTTACTGGTTTTTTTCTGCGCGCCGTCGTTGTGAG
CCGAGAAGAAAAAGTAACAAAAGAAGCAGCGCAGGAAAATCAAAATTGGCTGCAAGTGCG
TGTCCCGAAAGTTTAATAACCAAGAAAAGTTTGTAAATTGAAAAAGGCACTTAAAGTGGT
TACCTAAAATGAAAAGATAATGGGAAAGAGCAAAAAAAAAAGCTGACGCAAGTTCAAGGT
GTAGAATTTGTGCGCGTGTGTGAGTGTGCCACAAGTTGTTTGAGCAAAAGTGGAGAAATA
ATATAAATTCCGAAGGAATTTCAACAGCAAGTGCTTGAAATCGCAATTGGTGTGCCAAAC
TTAAGGTTTTGCCTTGTCTTTAATCGAGTTTTTAGAGGTTTTAACTCTTTTTTTCCAACA
AACACACACATTCACGCATTCTTGATTCTTTGACTCACAAATTACCCACGATAGCAACAA
CAAAAGTGTTGTCTGTTCCAATAGCCACACGTTCCATTTCTGGTTTTCGCTTTTAATGCC
GCACTGTTTCGGACGTTTCCAGCGTTCCTCGTTAACCGGTGTTTGCTTTTTGATGAGCGT
GAGAGCGGGGAAAGATAAAAAGAGAGAGAGAGAGACTAAGAAATTGATAAAGAAAATGGA
AAAAAGTAAATAAAACAATCAAATTGGTAAACAACGCTGCTTGTTAAAATTAAAAATGGC
AGGCAAACACAAAAACTCATTAAAAGCAGAGGAAAACCTAACGGTAGTTTCCTGACTCCC
GCTCACTTCCTCTCTCTCGCTCATTCTCTTTGCCGTTGCGCATGCGCAAAACATATTTGT
TTCTTGGTGGGAAAGTCAACACAAAGTCTAATAAGAAAACAAACATCACAGGTGTCACCT
TTAATATTCGACATTCTGCAATTGTGATTTTAGGTCTTTGTAGAATTCTTGGCACACCTT
CGATTTCTGGAAATTAACGCGAAATATTACGAAACGAAGCGGTAAACAAAACCAAATGGT
GCGAAAGTGGTAAAAAAAAACGAAATGCGGCGATATCAGTTGTCTTACCACGAAGCATAC
ATATCAATCAAACCGAAATAAATAACCCGAATTGTGTCCATGTGATTCAACGATTTTGTA
ATTCAATTCGATACGATACGACCTTGAAAAGCATAGGTTTTTATGTTGGTGATTTTAAAT
TTTATCGAAACGAAATCAATTCGCTACTGGGATTAAGCGAATCAAGGATTATACGACTAT
GGAACCCGGAATTTTAATTGGTAAGATTGTAGATCTTTATATGGGTTTTTAAAGAGAAAA
TCATTACTGACTTCAAGGCAGATGTTAAAATACAAGATGAGATAAGTCATATTTCTTGTT
TGGAAAATCATTAAAAATTCGATCCAATAACAGATAAATCAATTTATATATACAATTTAA
TGTATGTAGTGTTCTTTCTCTTAAGTTTATTGGTAAATATTCTTAAAAATATTTTGCTTA
GTTTGCTTTGTAGCATAAAATTAAGTCAAAAAGTCGTTCAAAAAGTATTCTGTATGCATT
TATTCCCACACATGTTCGGAGCTAATTACAGAAAAAATCCACAGATCATCCAACTGCACT
CCCTTCTCAAAACTTAACCCCATTGGGGGAAGAGCAATTATTTCGAGGGCTCAGAACTCG
TGCCCCCATTTCACATATCTGAAATAATTTCCATGCTTTCTTCGCTCGCAGAAGCGACTT
TAAAAACGGAGACAAACAGACGACCACATGTTGCTTGTAGTCACAGAAACATATGCAATC
ACTGGGAGAAATTTTTCTAATCTACAGAATATTAAAAAGTGTTAAAGAAAAGAAAATAAT
TATAATTAGAAAGTAAGTAAAGAAGATGAAAAATACATTTGCAATTGAGAAATTAAGCTA
GTCAGACAATTTTTCGAAGCCACATTGTATCTCAAGAACAAAGCGATTTAAATTTCAAAT
CCTAATATAAATCGAACTGAGCTAATTTTTTCGCCCAGTGTCCTGGAACAACAAAGTGAT
GGCACACACCCCATTCAGAACCACAGATACAGATACATCGCTTTAACTCATTTGGTTAAG
CATTTAATGATCGGGCAAATGCAGAGTCGGCCGAGTTCTGAGGGGACAGCTGGAAAATGC
GAGTGAGGAGCAGAGGGTGTGGCCTGGTCTGTAGACGGCGGTTGCTAACGCTCCCAAGCC
GAATGCTCTGCGTAACCCGCGCTCAGCTAATGAGCACCCAACCGCTGTGGAGGGGGGTTG
GGTGGAAAATCGGGGGAGCGGGCTGCGAACGGGTGTAATTGAGACTCGGTTTAGACACCG
AACCGCACCAATTTGTGCGAGAAATCTAATATGTGCGGGTTTCCATAAAACCCGGCGGCG
AAAATGCCGAGGGTATATTGTATTTCTTATAAATATTAATAATATGAGTTTTAAAATTTG
TAGACTTACAAAAACTTCAACGCAAATAAACGATCATTCGATTTTTATAAATAATATATA
ACTATTTCGACAATCTGTAGTTGATAAACCCCAAGCAAGGGTTTCGAATAAAATTGCTAA
GTATTCTATTTCGTTTTTAGATTAAATGTAAAGTATTCAACAGTTTTCGAATTCCAAATT
CGGGCTTGGATGGCATTAGGCGTATCCATGAGTGTCGCTGGTTTGTCTGCGGCTTAAAAC
CGGCAAAGCCACCAGTTCGGATCGAAATCCGCTCGACCAGCTGGGCTTGGAATGCGACAA
AATGCGCATTTGCATTTGGCCACATGTGTCGGTTTTATTTGATATGTTTTTGTATTTGAG
CTTAGTGGGATCTGGAGCACACATTACCAATACCAGTGCAGCCGGTCTTTTCAAGTAACA
CGGACACGGAGTCAAAAATGCGCACGCCCGTAAAAAATTACTCCAACTACAGCTCGCAAT
TTGTTATTCCCGCTATTTTGCTCTTTTTTTTTTTGGCTAATGGGTTTCCATTTGTTTATT
GCTTGATTGGATTTTGTAGCTGAGTTGCGGGGAAAAAAGGCGTTTATCTGGTAGGTGCCA
TCTGTGGGGGAGTTTTGGGGTTTCAAAGTGGACCGAACAAGTTGTTTTGCAATTTTCAAG
GCTAATTTAACAAACTATTACCTTTTATTACCTATTACCTTTACCACTTAACAAGCTACA
TAATAATCTCAATAATATATGATAAAATATCTAGAAACTATAAATAAGTAGAACATATGA
AACCAAATTTTGACAGTAACGTTTTTCAAGAACAATTAGACTTGATAAAAACTCCACTCA
AGTAATTGAAATTCCTCAAATAGAGACTGCCTATCTGAAATGGATCTCGATGTTCTTTTG
CGCGAAAGAGCGCCAATAATTTCCCATTCAATTATTATTTAGGCAATCAATCTATACGCC
CCACAAAATAGCAGCCACGCCCCACTGCGATCTTGGATTGCAGGCAACTGCCCACCCGCT
GAAAATCGAATAATAAATTCAATTCATAACTCAAACTGTCTTATCATTGATCGATGTTGC
GTGTGCCAGTGAGGCGGAATCGGGGAAACAATCGCTGATGTACACATATAGCTGGATATA
TTTTATGAAAAGAGAAAGGGCGCCAAGTTGGATAAGTACATATACCTATAAATACATATA
CATATGTACATCCAGCACATAGTACGCGTGTGCATGCATTGATATGTCAAAATGGTAAAC
GATCAGTTGCAGTCGATGATTTTTAACGCCTCAACGGGTTTAAGCCGCGTGTAAAAAAGT
TGGTGATAGCTGCTGAATGAAGGAGGGATAGGGGTATACCCAACATTTTTTGGTCAAGTA
AGTTGGCCAGCATTTCACTCGCAATCAATCCCTGCCTGCATTTTCTCTCTCTTTTTTGTT
TCTGCATTGATTTGCTTTTCGATTTTTACCTTATTGGTTGGGAAAACTTTCTAATTAGCT
AGCGTCCGTTCGTCTGAACTCGATATTGTTATTGTTAATGCCAACGAGGGTAAGCAATGG
CAAAATATTGATTAAAGCCGGTCGACAGTTTGTGCCATGTTTATTTTTAGTTGCGTATAC
GTACGTACATACCCACATTGTTTGTCTACAGCGACGACGACTTGTCGTTTTTCGAGGTGC
TTGTCTAGTGTTTAACAGACTGCCTCGAGTGCACCTGAGCAGACGGTGCGTTTCGCAACT
GTAAGGCGCTGGCAGTGGCGAATCTTATGCTTGCCGCATAATCGAAACTTATCACTGGAT
ATGACAGTCAGTTGGACAGTTGATTGAATTCAATTCAAATAATGTCAAGTGTTGATAACG
AATAAGGTCACTTGGCGCCACTGATAAAAATATATATTAGCAAGTTCAATGAGTGAATTT
TAAGCAAACATCAAGTTACGTAGGTGAAGAAGTTTATAGATAATTGAATTTATTTTTAAA
TATTTTATTGAATAAGTAAGTCTCTCAATATTCAAGATTTTTATTTGGAATTTATTATTA
ATATTAATATGTAAAATTCAGTAATGTCATTTCAATAGATCTATGCTAATAATCCTAATA
AGTTAGTAATTGTGTGAGCTTAACAAATGTATTTGCGTCTGTTTTATTGGTCTTAAATCT
CAGCATCTTAAACCAACTTTCTTTAAAGAAATACTTGAGCAAATTGTGTGAGCTTTTGTG
TGGCTTATTTCTGTTAAGCTCTGTTTAAATTTTATTCGGTTGATGCGTGAATTGTGTATC
CAATGGCAAATAAATAAATCCTCAAGTCCATAACTGATAAACAAACATTTTGAGCGAGAG
CCTATCGCGCTCCATCGGTCAGAGAATCCAATTAAAAGGCCTCCAGGAACATGAACAACA
AACATACCCACATAATTGACATGAATTACAAACTATCTGTATTTCCCACACAAGACTGGG
TATTCGGCCTGCCTTTATGTGTCCAATCATTTTCACTAGCGAAACACTACATATAGTAAA
TAAATAACACATGACTCGATTGCTGCCAATTCTCACGCTTTCAAGGGCGGGGAAAGTAGG
GATGTACATAAGTATGTACATAAGTATGTACGTATGTATGTATGTATGTATATGCGGATA
CTTATACCCCTATCAATTATGCCGCAAACCAAGGGCCACAGGCTCTTTGGCTCACATAAT
GTTCATAAACATAACAGCGAAGCCATCTCGGCTTGAAGTAGCGAAACTGGCAGGAAAGAG
GCAAAAACAGGAGCCAGGATCAAGTGCTCGAAGCAATTGAACCGGCATTCAAGTAAAGTG
AGCTTTAATAAGCCCTGAGAGAAATAAGCCGTTAGGTAAAGTAAAGTAAAGTAAAGTACA
ACGAGCACCGGCAACCATTTTAAATTACAGTAAAAGTTCCCTAAGGCGAACGTTTGCTGC
TTATACGATACAGTCGAAAGACTTTAATTTGTTTCGAGAACTACAAAGTGAAAAGTTAAT
GAACTTGAAAATGTGAAGACTGCACAAGGGCTTTTAAATGTGGAATAAAGAAAGATACTT
TGACTTCTTTTGCAAAAATTTCAGAGAGTAATGTGAGTTTTTTGTAACACAGTTCCTACG
AAAGTTAGGTTAATAATTAATTAAAGCAAGTGTGTGCACCTAGAAACATTTAAACGTTTA
GAAGTAGGCAATTAATTTACTTGCACTTGCAAAAAACAAGTCATTTATCATTTAAAATAG
GTCTGTTCCGACTTTTTGACACCATATTCTTTTTTTTAATGCGCTGTCAGCAAACAGAAT
TTATGAGTCAAAAGATTATAAGGGGAATTGAATAATAGGTTAGGAAAATACATATATCAT
TTTAAGAAAAGCTTAGTCAAAAACTAAAGAGAATGGTGTAGTCGAGTAACTCGAATAACT
TAAATACATACTTATCTAATTTTTTAATGTATTTAGTTACTTATAATTCGTTTCTAACTT
AGTATGCATGTGTAGATACATCTTTAAACATCTCCAAATCCATTAGCAAATCTTTTCTTC
CATGACGGTGTAAATATTTTCAAAGCACTGAGGCCGATTTAAGAACCAGTTTAAGCTCTA
AACAATAATCAGCACAGGGAATTGAGAAATTTGTCAACCAAACTGGCGATGATGATGATG
ATGATGGTGATGATGACGATGCAAAGCCTTGTCGTTGCTGCTTGACTTGCAATTAATGTA
TGAATGAATGAATTTCGCGATAAGTAAATTCAATTATCCGTAACATTAATGAATGCGTAA
AATTTAAGCAGCGAACGGCAGCCAAACCGGTGGCGGCTAAGTGATTTTGTAATCAATTTT
CAAGCACCGTCAGAAAGACAGACAATCGCAAAAGTGGGCAGTCAGCTAAAGAGCAAGTGA
GGCAAAAAAAAAAAAATGAAAACTTAATAAGGCGTTAAGCGATTTTAGTGTGTGCCATTC
GGCTAAGATATGACTAAATAATTTCATAAATATTTATAGATAAAGTGTTGTGCAAGTGGG
TAGCAAATGAAGACTAAAGGAACACGTAAAAATCGATTTGTTTTCAATACGTTCAATTCG
ACAGATGTGGCTTTAAAAGTGATTAAGCTTAATAGCATTAAATTAAGATGAAAATATATA
GTTGATAAGAAACCGGGTCTTTAATTTTAGCCTATTAATAAATTCTAAACGCTGTTACTT
TGTAATCCTATTATATACAAATGACTATTATAATCTATCTTAAATTAGTAAATTGTATCT
TGAAATGCTTTAAGGCTACACTGCACTTAATCCGTTTACCTTGATATCTAGTTTAATGTG
CACCATGACACCATCTCAGCCAGCAGATACTTTATTATTTAAATTTTTGAACTTTGCGTA
ATTAACGCCCGTAAACATTTTGGCCATCCGGCTATAACCGACGGAAGTGTTGCAAAAATA
GAAGTGTTGACCGAAATGCGCCAAAACAAAAACAACTTCGAACAGCGAAATAATATGAAC
AACAAAAATGAATTAAAACTTCCGCTTGCAGTTCGGTATCTAAAAAAAAACATAAAAAAA
CAACTACAAAAGTTGAGGAGGCGGACACTGCAAGTGGGAAAATGGGGGTGATGTTTGTTG
GTATCGCAGACATGGCCAGGTTTTGTTATTTTTCGTGTTGCTGGGTCTCCCACATTGATA
AAGCCTTTTGAAAAGAAACTCGCTCTTAAAGTGTCGGACATGCTGGTGTCTGCTAGCGGC
ATTTTCTTGCTGGAAACTGGTTTTCCCAGGCATTTCCCCGTGCTTCAGACATTCCTCTCT
ACCATTTACATACATATATACATTCATATACATATATTCACTGCGGTCTTTTTGGGCCAT
TGAAAGTGCACTTTGGTCTATTCTAATTTATGCGGGCTAAAGGTGGTTCGAATGTTGGCT
CGAATGATGCATTTAATTTCGAGTTTCAGGCCTTAAATTGTGTCTTAATTTTGAAGTGAG
TGTTTGAAGAACCTGTAAACAGGCCGTCGATGGTGCGTAAAATATATAAATAAATAAAAT
GATTAGCGCCATGTGATAAACTTGTTATTAAGTGAAATGTGCTATATTTGTATTTAGTTT
GTCTGATATAAATCGCTTTTTATGATGACTTAATATATTTTTTGATTGTTTATACGACTT
TTAAAAACGAGGAGAAAACATCATAGGAATATATTTTCTGTTGAATTTAACGACCAACAA
TTGGGATTGTATCTAAAAATAGAATAAGTAATTCTACTCTCTCCAACTATTTCTATGGAA
AAGTTTGCCAATCAACCGATTGAATAAAACATTTTGCACTTGAAATTACCAATTGGTTTC
CCTTCAATTCCGGCAAAACTCAATTTGCGCACATAACAATGACGCAAAAGCTGTTAAAAT
AAAATATGTACATATGTTTTTGCAGAAAAAAAAAACGCCAAATAAAAACCAATTCAAAAA
ATTAAGCGAAAAGCTCTACACACTGTATAGTATGAACACAACCTTCAATCGAAATGCATG
TCACATGCAATGAAATGTCGTAAGAAGTCACGTTCACAGCCATACAGAAGTAGCCGGTAA
TCGAACTTAACGCAATCCCTGAGATACAAACTAGCGGGAAGTTGATCGAAAATTTGTAGC
TGCCAAACGGAACTTCAGTCTGCGAATGGAATTTTAGACTTTAGACTTATCTCAATTTCC
CATATGGCCTGTAAAGCAAAGCAATTACTTTTTTGGCCTCCCTTCGGCGCGTAAAGAAAG
CTTAAAATTTAAATTTCTATTATACCGTCATGACAACAGAAGTTCATCCAACCGTGTGGG
GGATTATAGAATATTTGGTGAGTGCGGGGTTTGGCTGGGAAATAGAATGCACTGAACCAG
AAGAATAACCAAATTCTTATATTTATACTAAGTGCTAAATATTGGAAAAAAGTTAAATGC
TTCAATTTACACATATCTTTCGAACGAAGCCCGCATATGGATAAATTAAATTATGCAATG
TGTAATATAATTCGATAAATAATTAAAATTATAAATGCCACATAAATACCCTTTAAAAGC
AGATTGAGCTATTTCAAGCTTTATATTTAAATCACATACCAATATGAAAGTACATTTAGA
TTCCATTTGAAAGTACTATCCCACCCATTTGAGTGTTCAGCCGAACGGAACGCTTGCCCC
TTAATTTTCCAGCCAATGCGTTACGTATTGTGGGTCCATATATTTGTATTTGTACATGTA
CATGTACGTGCTATTTCTCTCATTTGAAAACTGATAAGAGGTAGAAACTATTGCATGGCT
TATCAATTTGGTGGCCATATAACTCGTAAGAGAGTTCCTTCACCTCGTCGAAGTTGTGCC
CGACACACATGCCTTGAAAACAAATAAATATTTGCTCAATGGCGCTATAGTTAGTGCCAC
ATTGGTGTGTGCACTCCGATGCGTGCTGGTGCTGTCTGTTGACCCACAATAAATGAGGGA
TCGGATCGGATGGAGGCACCACTGGCACTCATTTGGCGGCACAAGCCAAACGGGCTTCCA
ATAATAAACAAACCGCGAGAAGTTGAGGGCAGTCTAGTTCCCAATCCCCACTCACCATCG
ACTTCAGTTCGCTGTGTTTACATATATAATTTTTGTTTTCATTGCATTCGATGCGGGTCA
CGCTTTGCCACAATAATACCAATATGCCATAAAGAATTATTCGAAAAAAATATTACAATG
AGACAGATTGTCACAGGGCAAGATACCAAAGGGGTGAATTACAAATAAATTCCAATTAAG
TAAATAAAAAGTGATTTCCCTTTTTTAGTTGCCTAATTATCAGTTTAAAGCTGCTATTAC
AATAATTAAACTGACTTGTTAGGTAAAGATAGTACAAAACTGCACAGCAAGAGTCCTTGA
AGAGCGCCACAAATTTTAAAAATGAGCTCACAAATAGTCATTTTATTTCAATCGGATATT
TTTCGATTTCTGCCCAACAACTTTATTGCTCATAAATTTGTCTACTATAGTCACCGCTCC
CCAAATTGCGAACTTCACTTGATATTCCAAGCCCAATAACTGGCTTTCAACGGACTGTCA
ATAAATCAACGAAATTGTTCAACAAACTTTTCACACTTTCGTATAGCATTTAAAAAAGCA
TTTCAACACACAATGGAGCTGCCGAAAGAATAATGCCATAATCTAACTTTATATCATGAC
AGGTGGCGGGGGGAAACAAAAATCGAGAAATCGAGTAACAGACAAATCGACCGGCAATCG
ATATATATATATTTTTTTTTTTTTTGCTTAACGGCTTACACATCAAACCATTTAGCTCGG
CTCCTCTCGATTTACATATCGCAACGCGGCTCACAAACAAAAAGCTATAAAATATCAATT
TATTGCTTTATAATTGAAGGCAATAAATGTTTGTAAGAGCAGCCTTGCAGCTTTGTGGGC
GTTTGCGGGTGTCAACCAAAAGGTGGGGACTTGTGGTGTGCCAGACGAGCAGAGAAAGAC
AAAATGTAATGACATCAGTACGTCATTCAGCAAGTTGATCCATTGAACGCAATTCCATTG
AATTGAATTCGAGTCAGCACACAATATTTCTGTTTTGCTTGCTTTTTCAATTTGCAATAA
ATTTGCTTCGAAACTTAACTACATAGATATAGAAAATAATGGGGGAAAAAACCTAAAACA
AAAATCGACAAAAAATGTGAATTGCAAATTTGGTTGATTGTTTTGTACGCCAAGGTTATT
GCCGGCTGCCTTTTGTCATAAATATTAGAAATAAATTGTTTCGCATGCTTTTATTGATTT
GGCTTGGCTGAGTTGTGTAATCGTTGTCAATATAATTATGTGAAATTTAAAAAAAAAAAG
GGACAAATAAGCAGATAATTAGAAAACACTATTTCATTAGGAACGCAAGTATGTTTAAAC
TGCAATAATTTTTACTTTTATATAGAGTCATCTCTTTCCAGTAATCAAAATTTCATTAAA
CTCTTCACAACTTAAGCCAAATTATTTCCCCTTCATAAAGTCGAAACAAAAGTTTTTGAA
ACTTTTCACAAAGAAAAGCAATAAATATCATTTGACTTTTAGTTGCTTTATGTTTTACCA
ATGAATTTAGTTGAATTGTTTTGGTTCCCATTGAACCAAGTGCAAACAGTCAATAAAAAA
AGGAAAAAATTAATCTAGCTTTGGCAAGCCGATGCTTATATACCGTATTAATATATTTAA
AAATAAAGGAATTATTTAATTATAAATTTATATAATAATTATTACATATATTAAAACAGA
CAGACTGTTGATCGTGAATATATATTTATATTTTTTTATGGTCATGAATGCCTCATTTAC
TGCAAAATTCTTACTGCAATCAGTTTACCCCGTGTAAGGGTATAACAAGCCTCAACAACA
ACAACAATAGCGGTAGACAAGACTTTGGGTTAGCCAGCTATGAAAGAGTTTTTCCGGGGA
AAACAATTTGCAAACAACTTTGGCAAAACAAACGGCACACCAAACGATGATGCCTAATAA
CAGACACTGGGCCAACTGTTGGTCGGTGGATTGGGATTATGGATAAGATGGAATGGTCAT
CAGCACATATTCAGAAATACACTTCCGGGTAAACAAAAAAGAAATGCTAAAACTGCACTT
CCAATTTGAACTCGATGGTGTTTTGCGATGGGGGGGACTCCAAAGAAATTGCAGTAATTG
ACACTGAAAATGTGGCTGCCGTTCGGAGCTGGCAAATGTTGATGGCTACGATGAAGCTGC
TGTGCAACGCTGATGATGCAGCAGTTATCTATGGCATGGCAAAATATACGTAATTGCCAA
AGGACAGGAGCGTACAAAAAAGGGGTTACCAAAGAAATAATATAAATAGCATACTAAAGT
AAGACATAGGCTATTAACTTTCAAGGTTCTAAGTTATATCAAGGATGCCACAGCATTCAC
CAAGAAAATCACATTGAATAAAGTTGTTAGAAAGTATATCTTTAAGTATTTTCCATCTCG
AATGTAGGAGTTTTATAGCCGAATTATGAATAGCCCATTTCCACTGCATACTTTTAGACA
TTTATGCAGGTAATCTATTGGATTTTTGCGTTCAATCATGTCATCAATATATGTAAATCT
TAAGTCTAAGTTTATTTTATAATGCGTTTAATTTAGGAATACACCCATTTATGATACGCC
TCTGTCATCTCAGCATAGGCATTTTCAAATGTAGCCGTTCAATTTGCTTTGGCCCAGCCC
CGTCGCTTGAGAGAGTGTGTAGTTAATGAATGCAAAGAGTCTAAGGCTCAATTAATGAAA
TTTCATTTAATTACCAGCGGGTGGCATCCAAAATTGGTTGGTGCGGGAGACAAGTTGCCC
CTTGGAGAATAATTCCCAGGGAATTCGCCATCTCTGTTGAATGACTGGCGGCAATCGTAC
GTGCGGCATTGCGTCAAGGACCATTAGAAGTAGGCTCAGTTTTGCTAGGTCCTGCGCCTT
GGTGCCCATTTTACAGTTGGCCTCATTTGTGGGTCACATGCAACAGTTTGCGCCAACTGG
TTGAGCGCCAGCATCGTGACTTGCCACATCGATCAATACTGTGTGCTGCGTTTGTAGCGC
TTGGCAATTAGTCTTCGGGGAGGAGGCTTTGGCTCCACTAGCTGTCCTTCATTTATATGG
CAATTAAATTCCGCCTTGAATGCGGGTGCGGCTATGTCTTGAGTGCCTCCTTGTGTCTTT
GCCGCAGGCCTGCTATTCCTATTTGCCACACTGAATCAGATGAGATGAGTTATGTCCTCC
GAAATGGGATGTCCCTGTTTGTGCGAGAGTGTTTCTCTTTGAATTGGTAATGAGATGTTT
AAGTTGGCAATTGAAGTTCGTAGCAGTAAACAGGACTGGTTTACCTAATAAATAATATAA
GTCATGATAATGGTAGCTATAAATAAACAAGATAAATTTGATTATTATTTAGATAACGCA
AAAGGTTTTTGCTATAGATATCGATAAGATTTAAGAGCCTGGATACATTTTTTTCGGATC
ACTTAAAGCATGAACTTACACATTTTTATGAACTTGAAGCCCGCTGCTTAGTGGTTTACA
CATGTGTAGTAAGTTGTAATTAGCTTAAGTCGCCACACACTTTGAGTTTTGCCTCATCAC
TGCGTCGAAAACCGATTAGAACAAGTTAATTACAGTAATCTGTTCGGAAAGTTGTTCAGA
GCGTGACATAGTTGAGCTTTCTGTGCATTCCGTGAGTTGTCTAGTTTTCCAAAGGCCACT
TCACCTGTCAATTTGCATATGTGTAATGTGGAAAAAGCCAGTCAAATCAAGTCCAGCATT
GCAGTAATTACTCACCGCCGAAAAGAACAAAAATCGATCACTAATTACACGCAAGCCGCT
GCCAATTCATATAATTGTCTGCCCAAGTCGGCCCATCAATCAGAGATTTCTTTCAAGGAG
CGATGCAAATCGCTTTCGACCAGAATGCTCTGCGGTTTCGCACAAAACTGACAAATGACG
CACACAAGAAGGTGGTATATCATAGTCATGCACATGGAGAAACTCTTATTTATTTGATGA
AATTAAAGTAAAATTATTATTTAGTTCTTATAAAAATAATTAATCATTAAAAGAGTTATG
AAACGTAATTGCAAGATATTTGTGGTTAAGGCGTATTGGCGAAGGCTAAATGAAGACTCA
TAGTCTGTTAGCTATATAAATGAATAGCCTTAAGATTCTTTTCGGTGTACTCCGCACTTA
AATGCTGACTGACTCTCGACTCTCAGCGATCGACTTGGAAAACTGCAAGCGACGTCTCCG
CTAATTGATTTTGAGCGAGTGATTTGGCACGTTTGGCTGCAGTTCATTAGCAAAGTTGGA
CTGCTGCACTGAGTTGCGTTTTTGGGTTGGGCCCTTGCGATAGACAAGACTCGAGTCTGA
ATATCGACTTGGCGTTCCAAAGACTCTTTTGGGTTGGGCGACGGCGATGGCCTACAATCT
GGCACTGAAGCCGGCCGACTTGGCTCGAGGTTAACTAAAGAAAGTTGGCAACTATTTTGG
CACTAATGGATCTAACCATTTCTCCGCATTTTTTTCTATATTTCTTCGCGCTCCAGATGA
AAGACAGCACATACAGAAGAAAACATTCACAAAATGGATCAATTCACATCTTATCGATAC
CCAGTGTACACCAGTGAAGGATTTGTTCTTGGACCTGCGGGACGGACATCGATTGCTTGC
CCTGCTGAGCACGCTGACTCAAACCAACCTGGTTAGTATATTTCTCTAGTGATTAATGGT
TAGGAATGTGATTTGGGGCTCTGAGTATAGGTAAAATCCATTCTAATTTAAAAATTATGT
GGCGAATTACAGAGTGAATTTTATGATCCGTCTTAGCATTCTCCCAGTTCATAATCATAA
GTTTACCTCCTTTCAATCCATTTAGAAACCCGAAAAAGGCCGAATGCGAGTGCACCACAT
AAACAATCTGAACAAGGTGATTACCGAGATCCAGCAGCATGGTGTCAAGTTGGTGAACAT
CTCCAGCGATGACATAGTGGGTGGCAATGCCAAGTTGACCCTAGGCCTCATATGGCTGAT
AGCGCTGGAGTTCAATGGCCAGCATCTAGTCAAGAGTCATTCGAGCAACGGGGTGGAGAA
GTCCCTATTGGCCTGGGCACGTCAGTATACGGAACCTCATGGCCTGCAGCTAAATGATTT
CTCCAGTTCGTGGTCCGACGGAAGAGCCTTCCTCATGATCCTGGATGCTCACGTGGAGGA
GCTGAATCTGCAGGCGGCTTTGCAGCAACATGCACTGAAAAGATTGCATTTGGCTTTCGA
TTTGGCACATAGGCACTTTAAGATTGAAAAGCTATTGGATGCCGAGGATGTGCACACCCA
CAAGCCAGATAACAAGTCAATACAGATGTATGTGATGTGCCTTTACCACGCCATGGAATC
CATGAGGACAAGGCAGCAGGAGCAGGAGCAGGATGAGGGACAGGATCAGGATCCAGGGAG
AGTGCCCTGCACCAGCATCACAGACTTGGATGAGGTGCCACTGGACAATGATCAAACCAG
TTTGGGGCTTTATACTTCAGACAGTGCTGGCAGCATGGAGCAGCGATCTTCGGGGGAGCT
AAAGACCCACTCCATGCGTCCGTTGAGTACGGCCACCAATGCGAGTGTGGAGATCAGTGG
CTATCAGTCAGCTCTCGAGGCAGTACTCACCCTCCTATTGGAAGATGAACAGCTGCTCTC
GCAGAATTTGCCGGATCCCCAGGATTTTCAAACTGCCAAGCTGCAGTTTCACGAAAACGA
AAGCTTCATGCTGAAGCTGACCGAACATCAGGAGTATGTGGGAGAAGCTCTGGAGGAGGG
TAGCAACCTCATCAACGAATCCCAGAAGGCAGGAGCTGGTTTGAGTCAGGAGGATCAAAA
CGAAGTGAGGCAACAAATGGTGTTGCTCAACGAACGTTGGGAAACCTTGAGATTGCGAGC
TTTAGATGTTCAAGCCAAAATTCTAATGAGATTGGCCGAGTTTCAGAAGCAAAAACTCGA
ACAGCTTCGTCAGTTTTTGACCAGTGTCGAAGATCGTATATCCCATATGAGTGATATAGG
ACCAACCCTAGAAGAAGCGGAAAAACAACTTTTGGAAGCTCAAAAACTCAAAGCAGATCT
AAGTGAACAGCAGGAATTGGTGGATAGTCTGAGCAGCATGGTCGTCATTGTAAACGATAC
CTCTGGCAACTTTAATGATCTAGAAGATCGCTTGAGTGCCTTGGGGGAGAGATGGTCGCA
TGTGGTGAAGTGGAGTGATTTGCGAAAAGAGAAACTGCAGCAATATAAATGTATATCCAG
ATGGCTGGATGCACGCGAGCAGGATCTGAAGCTCATGGAGAGTCGGGATGTCACAGATGT
GGGCGGCATTACACAGCGCATCAATGAGCTAAACTATTGTGCCAAGGATCTGTTGGAACT
GCAGAGATATCTGATAGATTTGCGACAAATGGTGGCTGCCACTTTACAGGATGGTGATGA
CAAGGGCGAAAGGGTGCTCATCCAATTAGAGAGTTACGAAGATCGTTTAGATGCCTTGAA
GCAGATTGTTGAAGTGCAAACTGTGCGAATCGAAACGAAGGGCTTTAACTTTGGACGAGA
TCGTGCTAGCTATGATGACAGCAGGGTAGTGCGTCCAGAAGGATGGGTGGACTACCAGAT
GATCATACGTTTCGGTGAAGATGATTCTCAAGAAGACGATGACGAGCATGACTTGGCCAG
CAAGAAGCGAAAGCTTAGAAACGCTGACAATTTCAATGCCCTCGAGAATCACATCATGGA
GCACTTCGGCTATGTCCAGGAAGTGGAGCAAAAGCTACAGCAGTTGCAGAGGCAAAGTCT
TCGGCAACAGTGTGAATTACTCAAGGAACTTCAGGCGGAAAATAGTCGACGCTGCGGTAC
TTTACCCGAACTTAAGAAACTCTACGAAGTCTGTGAGCTGGAGGATCCGTCGAGGAACCT
TCTCCTGGAGGAAACACACATCAAGCAGCTGGAGCAACGATATGCGAACTTGTCTCAAAA
ACTATCGAGCCAACAGAGCGAAAGCCATACGCTGTTGGCCAAAGAAAAGTATTACAATAG
TCTGACAGGATTTAAATTAGTTTTAGCTGATTCCAGAGATTGGTATAAACAACACGCTGG
CTCAGCCAGTGGCAACGAGCTAGAACAGCGTTTGAGCCACATGGAATCCCTGGCATCGGA
GATTTCCGAGGCCAAGACAGCCACCGAAGAGCTGGATGATAATCTAATAGAATGGAAGCA
GGACTTTGGTCTGTTCTACGACAGTTGGCATGACATGAAGCAGGCTCTGCAGGCTCTAAT
TCAACAGAGAGGCGGCGAAAGTCTTTCCAGACAGTTGAAACAAATCCAAGATTTTGTTAC
CAAAGTGTCCAATCAAAAGGTTCGCGTTTCCAATCTGGAAGTCATGCAGGAGCAGCAGCA
TTTTCTAAACCAATTGTTAGACGAAATGGAGTCCCTTCGGCTAACTTATGATAATATACC
AAAACACCTGATTGGCGAAGAACTACAAACCGCTTGGAACCGACTTCCCGAACAGCTAAA
TGAGCGCGTGATTAAACAAACCACAGCTATAGAAAACCTAAACCACTTTGCTGCGGAGTA
TAATGCCATTATAGCCATGCTGCGAAGTGCAGCCGATTCCAAGTTGAACGGAAGTGATGG
TGCTAGCAGTCAAGATCTTCGAAAACTGGAGATCGATGTGATAAGCGCTCGAAATTTCAG
CGAAATTCTGATCAAGGAGGCGGAGCCAGCCCAAAAGGAATCGCTACAATCACAGATAAG
GGCTCTCAATACGTTGTACGATCAAGTGGAACAGGTTCATCGGGAGAAGAAGGAACAGCA
GACGGTTCTGCAATCCCATATTGATCTTATCCAGCTAAGGCTCAAGGAAACCGATCAGTG
GTTAACTGATCTGGAGAGTAATACACCCAAATCGGGAATCAGCGATATAGTAAACTCCAA
CGAGTTGTTCCAGAGCAAGAGTCGCTTTCAGACTCTTAAAGAAACCTGCGAAAGGGAAAC
CACACAGTTTAGGGATCTCAACGAACGTGGTGGTGAGCTGCTGCTCCAAATGGATGAGCT
TCAGGACCAGGATAGGGAGTCCCGATACGGATCGCTAGCAAAGCAATTCACACGCATCAA
TGCCAGATGGACGGAGGTCACCGAGCTGGTTTATGCGAAGACAGCTCTTCTCGAGCATAT
ATCAACGCAGCTGGGGGAGTTCAAGAAGTTCATGGTTAGCGAGACGGGTTACCTGGACAA
GTTGGAAAACAAGATACGCAACACACCAGAGAATGCAGCCGACGCAGAGGAGATCATGGA
GGAGCTTGATGTAAGTTTGTCGACATATTCATATTCCATTCAAAATCCCATTAATGACCC
CATTTTCCCTCAGGATCTGGAGAACGTTCTGCGCTCGCACTCTGAGGAATGGCTGGACAA
GATTCAGGAAATTGGCAACGAGCTAATTGACAACGAATTCATGGCCGACTCCATACGACG
CGACATTGATGAAACCGTTCAACGGTGGACGCAACTCCAGCAGCAGGCAAAGAAGCGAAC
CGAGCTCCTGGAGCAAAAGGTCAGCGAGGCGGAACAGTCCGAGAAGTGCATCGTGCAGTT
CGAGAAGTGGCTGACACGTGTGGACGACATACTCAGCGATCATCTGGATAACGATGTGAC
CATTGTAGATCAGCCGGAGGAATTCCAGGTAGATTTTCAATAGTTGAGGAGTCTTTTTAG
AATTTAATGAAACTTGTAATTGATGAATAGCGCTTGGCACACGAGTTTGTGGCCAATGAG
AAAAACTTTAAGGAGATCAGCGAACTTATTGACGAGCACACGAGGAACGGCAAAGTGGGA
GCTGCCAATCGGCTACAGGAGCAGCTTAACCTGATGGAGGTGCGGTTCAAGTACTGTCAG
GCAAAGCTGAGCAAGTGCACCGCAATCCAACATTCCTACGAATCGCGTTTGAATAGGGCC
TATACGGATCTTCGAAATGTGGAGCGATCCACTGAGGTAGTAGATGTCGCATCCGCCGGA
CCCAACACGGTTCAGACTCAATACCAAAAGTGTCTGGTATGTATAATATATGCTTAAGAA
TATTTAAAAAAGTAGTTTCGAGATGTTACTAATAAGAAGCAGCATAGATGAAATACCAAA
GCCTTAAATGAACCAAATATTTTTGTAGCTTTTCACAAAACTTTCTTCATTCTTTCACAA
TTCCCAGCAAATTTATCGCACTCTATCGGAGATAAAGTCGGAAATAGAGAGCACGATTAA
AACCGGTCGCAGGGTTTGCGAGGACAGGTACACAAAATCGCCGAAGCAACTTAGTCAGCG
GATTGATGCGTTGAAGCATCTGTACAATACCCTCGGAGAGAATGTGACCCAGTCAAAGGC
GACCCTGGAAAGGCTGCTCACATTAGCGAGGCAATTAGAGGAGTGTTTCGATTCGGCAGA
CAACCTAATCCGGCGCTTTGAGTCGCCGCAAGAGGTCCATGACAGGAACTCCATACTCCT
GGAGTTTGAGGATGTGCTGCGAAGGTGCGAGGACCACTACAATGAGTATAACAAATCCTG
TGACCAGAGCTGCATGGTGGAAACCCGTCAAAGGATCGATGGATTGAAGGCTACGTACCA
CAAGTTGACCAGTGCGGACATAATCAAGCGGCTCACCGAGATGAAGACCACCCTGCAGAA
CCTGGACAACATTTCATTGGAGACTTTAAGGTACAAATCAAGCTTAAGTATTTAACATTA
AAAACAAGATTTTTTAAATTAATCTTTAGCTAAAGGAATTTATCAGTCTGAATCCCAAAT
TCAGTAATTCTTATTAAGTTTTAACAATTGAGTTAGGCGATTCTGGGTGTGTGGTGAGGA
AGCTTAATGCTACATTAACTTAATTAAGCCTTCTCATGTTCAGGATGCTGTAAACCCCTA
ATCTACTTCTTCACCTAGTAATTGTAATCTTTTGCAGGGCAATGGAGCACGACCTGAAGG
AGATAAATGTGCCCTCGAATCCGGAAATTGAGAAATTGCAGCAGCAAGTAATTGCAATTG
TCGTGGTGAGTCGGAGCAAGCAAACCAATCCTCTTAATTACGCAAAAGCTTCCTTTCCGC
CTTCCACAATGTCCTTGCCACCTGTACATAATATATGGTCCATCCTTTCCTCTTTCTGTG
CTTGTTATCGGGTTTCAGTTCTTTGCTTACATTCGTATTTTTTTTTTTGTCTTTATTTGC
TTACCTCACATTTCGCTTTTACATCGGAGTCGCCTCACACTTTCCATTCCATTGAGGCTG
ATTCTACTCGGACACCTTTTGACCCGGCTCGAAGCAAATGGAATTGGGTTTCAATTTTCC
TTTACTTTTACTCCTTCTGTTTCACATCATCGATTCTACATCATTTGATTTATCAGAATG
TACAGCTTGATTTAATGTGGGATGATTTAAAACGTAAATCGTACTCAACAGCAGGATGAA
TTGGGACTGGAGATAGATTTCTTGAAATAAAGATATATGTTTCTCTACTTCAATTTTGAA
CCATAAAATCAAAATTAATAAAATTATTTTTAAATTCTAATTGACAACAAACTAATCCAT
TTTATATTAATACCAATCAGAAATCAAGAAACTCGTGAGTTTAGATATGCCAAAACCAAT
TGCTTCTGCTTAATAATACGCTTCTACCATACTTAATTTACTCAACCCATTATTCTATTT
ATTTTGCCAGTTTCATAAACCATTAAATAATCTTTCCACCAAAAGCTAATCCAGAACCAA
CAACATTTACCCGTAATGGTAAATGCCAAACCATCAAATCTACCACATCACCCCAGCTAG
AGATAATAAACCATTATTATAAATATTGAATAAAACCAGAAATCACCGTATCACTAGAAC
TCTACGGGGTCTAACTTTGGTGTCATTTTCACGCTTCAAATTTTAATGTGTAGAGTTTTA
CAATTGATTCCCCTCTAATTGTTGTTGTGGCGTTCGATTGGTTGTGGCTGCGTCAAATGT
CCAAACCATCCCAAAAACAACATAAAAAAAAGTAATCCTTCCAATCCACCGCTCACCACC
ACCACCACCAAAAAACAAAAAAATATATATATATAAATCCACCAATTACCACCGCTCACC
ACCAACCAACGCTAATAAATAAATGGCCACTGCTTTTTTAATGGAGAATATGTACCTAAA
TGTAAAAAAAAAAATACCTATATACCAGGCTTCATGGGCTTTCAGAAATGCATTTGTTTA
GTTTTGAGAGTCTACAGAGCTTTGTAATTTACACCAAACTATGCATTTGTTGTGCAGGAT
GTGCTGAAAACCCGTTTCAATGAAGCCACAACGCTTGCCGCTCGAAATACGAGCTCTCCC
GACAATGACGACACGGAAATAGTTGTGGTCAGCGATACAGTGCGTCAACGACGTGCCAGG
ACACCCCAATCGGGGGAATCGCCGTCATCCGCCCACACCAGTTCCTCGGAGTCGCCAACG
AAGGGTGTGGAGAATAGTCCGGGAGCGGTTGGCGACCAAGTCATGCCGGATCTCCTTCCA
CCACAAACATTCCGGCTGGCCGAGTCCAGTACTCTGTTCTCGCAGATTTCCCTTAATCCC
CAAAAAGTAACCAACACTCCACCACCCAAACCGGCGAAAACTAAGCGAAAGGCCCCAAGT
TCTCCCGCCCAAGTTGTGGAGATCAGGGTGAAGAACATCCAAAACGATAAAATGTCTGTG
CAGAATATCGATCTGGAACCACAGCAGGGTGAAATCGTAGACACCGTCAATATCCTGGAG
AGTGTGGAACCATTTGTACCCGAATATGTGGAGACCGTACAGATTGTAGATCTCTCCGAG
GACTCAGATTCATCGGTCAGAGTTGATAGTCAGGGCAAGGAGATGCGACGATCGAAGAGC
AAGCATTCTTTGAACGAGACTCCACTGCCCAAGGTTTCGGATAACGATGAAGACTCGGCG
GAACAGGAGGAGGACCTCCTGCGTCCCTCGGCAGAAAATACAAGCACTCCGTTCCTGAGG
GTGGAAAAACGCCGCATTTCCTTCGATGAGAAACGCAAGCGAGTAGCTAATGAGCGCGAT
ATCCTGCGCGATTCCGAAGAGGAGGAACCCAAAACACCGGATACTCCACGGGCAGCGCAA
GTCTCCAAGCCAAAACGCTGGCGCCAACTCCAGCCAGAAATGGATGCTCTGGAACCCGAA
TCACCCGGTCGCGATAGTTTCTATAGTCCCGACAAAGAATCCGGTTTCGATGCTGAGCCT
CTCGTATTTTCCGACGATGAGGATATACCGCGTTTCTCGCTGGAAATGACATCAACCATT
GACTCCGATAGTGATACGGTAATTTGGTTGAAAGGCCTGGCAAATCTTTTTCCCACAGTG
TTGTAAAGAATCAATCCTAACTCGAGAAATATTATTCTTAATTATCCACACAGAGTCGCA
TTATGACGCCTTCTACCAAAAATCCCAATCCTTTCCTGAGCAAGGTCCTGGAATCATTGT
CTTCTCCGGTGGATGACTCAAATGTAACGCTCAAAAGCCCGATCAGCGAAGAGCAGCCCC
AGAATCTGGATGATCGTGTCCGAGAGTTCGACAAGCAGGCCAAGCAGATGATCTACAAGT
TGAAGCTTACGAAGGCCAAGATTGAACAGTGTCACGAAAGCGAAGCGTAAGATTTATTAT
GTCTTATTTGCCATAGAAGATTGATTTTATGAATCAATTTAAGATTTGAAATTTAGGGAA
AGTCTTTTAAATAAGCTATTAAAAAGCCATTTAAATTTTACGCATGTTCACTTTTGTTTT
AAAATACCAAATAATATAATAATTTTGGTAAGCTGGCCACTCTGAAATTTACAAATGTAT
TTACTTATTTTACAATGTACGTTGTAGCAACTTGCTCTAGATTTTATTAATATTACGAAT
AGCTAATTATCATGAAGATGAGAAATGACAAAAATGTACATATGATATCTTAAACAAGTG
ATATTCGAATCAATTATTACAGAGAGGACCTGCGGCTCCTAATAGCACCTGATGCAGCCA
CCTTGATATCCCAAGGCGACTCATTGGTTCTGGAAACTCATGGAAGACAGGGCAGCATAT
CCCGCCTGGTGATGCGCACACAAATAATATTGAGGGAACAATTCCGAGAAGTGCAGCAAG
CAAGGTATGTCAGCATTCAAAGACATCTGTAGTTTTCATTTACTCATTAAGCTCAATTTC
CATAGATCCAAGACCTCGGGAAGCGGGGCACCAGCTCCTCCACTGGACAGCGTAAACATC
GAGGAGCTGGTCACCAAAGGACTGCGTCGCATCAACGTTCTCATAGAAAAGACCGTCGAT
CTAAAGTCTAGCACTGATCTTGAGAAGCGCATGGAGGATATCAACGTAAGTTTACATGGC
CACCATGCCAATTTAAACTGTAAATTACCTGTGCAAACTACAATTAAATCACTTTCATTT
AATCGCCGCAATTAGTCATGCACGTGGACATTTCGAAGACAGCGTCACATCTTTCGGCGA
TAGATGCTCGTCTCTTGCCGCAAGTTAATTGCCCTCTTGAGAATTTCGATGCACACATCT
ATAAATCTATAGGCAGTGGCCACCATAGCTAAATGGGTCCATTAGAAGCCCCAAAAATAA
ACACGACTGACACAGTTACACATCTGCATGCAGTTGGGCGGTGGAGGAGATTTGTAGTAT
TTAGTGGGTCAGAAGAGAGATCGTGGAGTAAGAGAAATTTAAAGAGTTTTTTTCCTGTGC
TGCTGCTCATTTTGTTGAGGATGCTGTCTGTTCTGAAAGGTTGCAAGATATGATGGTTGT
CATGTTCTATTAAATTATCAACATGTTCCCTTTAAACGTTATGATGTATTTAAACATGAA
ATGTTCTAATGACAAGTGTCATTTTGTATAGCACTTGAATGCATTTTGTTTTCAAAATTT
TAAACACCTGAATAGTAGTGAAGATAAATAACTTGCTTAAGAAAAATGTACTCTAGGTTT
AAAGGCAACTTTTTGAGTAGGACCCATTTCGAATACGTGCCATTCATAACATTCATAAAA
AAGAGAAAGAAATAAAACTTTTTGCTAGCAGCTACGCAGCTTATAATAAATGTAACATTT
TCAACAAGTTCCATCCCTAGGCAACAGAGTCATTAATCACTGCAATCATTTGTTGTTTAT
TTTTATATGTATTATTTATTCAGTTTTTTGTTTGATTTTATGGCACCAGCGAGCATGGCG
ACAAACGCCAGCGTTTCAAAAAAAAAAAAAGCGAAAAATGAAATCAAAAATAGAAAAGAT
TTTGTATTTTCAGAGAGGGGAAGAGATAGACAGAGCGAAGCGTTTTGGGGCCGGAAAAAA
GATTGAAAATGGGAAAAATTTACTTCGAAGAGGCGCAAACATGTAAATTCGTCTCTTTGC
CGGCGAGATGAGGTCTTTTGTTTTTATTTTTCCCCATTTTTTTTTTTCGTTTGCGCCTCT
TCAGTAGCGAACCATCTCGTTTGGGAAGCGGTTGCAGCAGAGCTTTAAAATCTTTTCAAA
TTTTCCGATGTGTTTGCGGGCGTTTCTTTGTTGACCCAGTGATTGATTGTAAATTTTGCG
GAAATTTCAGTTTGGCGCGAAGGGAAATTTCGGCAGCAAAAACCGTATCGTCTGCAACAG
TTTGCATCGCGCTGTATTCACGACCCACAAATGCAATTTTGCTGGTTGACAAACGCCGTC
AAAGAGGTGGTAGGGTTTTTCGCCCACAGCCACGCCCACCTGCGTCCCGCCCATCCTCGA
CCAGCTTCATTTGTTCCTTACCCTAAGAGAGAGAGAGAAAGAGAGTCCCTGCATGATTGC
AGCTGAAATTGAATTCCAATCGCCGTTGGCTGCTCCTCTCCCAAGCGGTGGTCATTTTGC
TCGCCCGTGTATGTGTTTGTTCAGCTTCCGTTTCCGCCTCGAATTGCCATTTATTTTTCA
GTTGCCGCAGCTCAAGAGTATCGAATGCATTTAATATCTGCTTTATTATGCTCTTGCTCG
ATTCCATTTTCAGTCGATATGCAGTAATGCAATCGAATTTAATTTTTAAAATTTCCTGAG
CACCACACTTTCATTTCAAATACCTATTTCCGTATAGTCATTCTATTACTTCAAATAAAA
ACAATTACAATTTGTACAAACGTTAGATTTTAATTTTGTTGACTATTCGATTGACGCGAT
AATTGTATACAATTCGAAATAATTAAATATAGAATATAATTTGCTGACAATAAGCTTAAC
TACATCTGTGTAGAAGATAGTACGACTGTATGCAATATTTATTTTACAATCTCATTTAGA
TAGTTTAAAGAGATTCACGAACAATGGCATAATGTCATGTTATAAACAAAAGCAAATTCG
TCTCGCTAAAGGGAAATGCAGAGGCAATCAATAAGCTATTAAATATCTTTTACTATTAAA
ACTCACTCTTTTGTATTTTTTACAATACATCTCCCCATTTTGATTGCAGGAGCGGCACGA
CGATTTGCAGGTGATTGTCAGCGCCATTGGCAAGAACGCCCAGATGCCGAAGGTCACGCC
CCTCATGATGAACGAAATTGAAAAGGTTTGCCCACACACTTTTCGCTACCCATTGAAAAC
CCTTACGTTGAGAATGCCTTGCCATTTTGCAGACGAAAAACAATTTGATAGCTCATGCGG
ATTCCATTGAGCTCTCGTTGACGGAACTTAGAAATGGCCCCCGAATTTCCAATGGTAAGG
AGCGCCCAGATGCATCCAGTGCGGCCACCATGAGCTGTCGTTCCGGTAAGCCTGCCCACT
CAACTGTTTGAAATAGTTCCTTTTATTCTGGAAGCTTAGAGAGATCGCATCCCAACCTAG
GCGAATAGTAACGTTCGTAATGTTCTTGTTGATTGTCGGCAAGTTGAATTGGCTTCAATT
GTTTGGCTTACGCTCGAGTTGACTGCTTAAATGTAGACAAGCTGTCAAAGTGGACTTGGT
CTAGTGGATAAACTTTGGGATGAGCACTATTCGAGTGTGTTCATCCTGCCAGAAGGCATT
TATTTGCATGCTGTCAGCACAGGATATTAATAAAGTAATCTTTCAATTATTTACTTCACA
AAAGAGAGGACATTTTAACGTATATTAAACAGTTATTAGTTATTGCTTTAAATATGTAAT
TTGGAATAATTTGAAAAGATAGCAGTACATTGCATTTATTTTAAAATGATTATTAATTAA
TAATTATTGAATGTAAGCATTCAAGCACACACGTATGCTAGCGTCCCATTGTTTATGCAA
ATTACATAAAAATTTCTATATTTAATTTCCTGTTTTTTTTTTTTTACCAAAAATAATTGA
TATGCTTTGTGGTTTTATTACAGCACACAAACGTTCACATAATTGAAATTTAATATCTTT
TACTGGCTAAATAATTCGAAAATTGGCGAACAAAATCCAAACCAAAACTCTTGAAACAGC
ACGTACAAGTTTTTGTTTCATTGTAATTCTATTCTATGCGTATGTGCACTTTCATTTAAA
TTGTCTGTTGATTTACATTTAGCGTTTTAAAATTTTTATGTGCAACTTAAAAAGAAAAAT
TTCTTAGGCTACAATGCATTTTGGTGCAAGTTACACTCGTCTCTATATATGTTTAATAAC
TAAAAATACAAAGGACATCGATGTTTCCCGATGTTTTTCCTACACCATTTCCGTTTTTTG
TTTATGTTTTTATAGGAAAATGGCAGCCAGATACCAAATGTGCCATGTCAATGGCACTTT
TGACATTTTATGTGAATGTTTTCGGTGTTAACTTACCCAGTGGGAGGTGGGTGGCCATGC
CATGTTCCCCATGTTGTAGACCCCTTTTCTAGATTCCACAACAGATGCAGACATATGTTG
TTGAATACATATTTGGCATGCCAGCTACTTGGGGTTATGTGGCAGAAGTTAAGGAAGGAA
TTATTTAGTAAAACTTTCGCTTTGTTCAAATCGTTTTATATATATTTCAATTATATTATA
GAGTTTTTGAGAAGTTGACCACAATTTACATATTATAAAATCCAAATTGTTGAATATATT
CAGACACCACATCGAAGTCTCATATCTCTAACCAGCAGGAGTGCAGGAGGTGTAGAGATC
TCTCATCCTTTGGCAATCCTGCTAGCTAAGCTACAAGAAATTGCTTTTGTGACCAGTAGC
CATGGGTTTTTCGTAATGGGATCAGTTCATCTGCGTCGATATACGGGCCATATTTCTGGT
CATGGTAACCTGATCGTTAGATATTTTGACCAGGCCCTGCGATCGCATATACCTCTCCAT
TTCTAAACTAGCTTTTTTTGCGTAACGCACACTTTTGTCGTCAACCTCCTGGTTTGCATT
TGGGGCCGCCATCATCACATCGCTCATTTTGCGGCCGTATTTCGCAATGGTGTACTCCCC
CTCCTGGGAAATCTTGCGTCGCTCTGCGAAACTCAGCTGCGGCTCCTGGAATTCCTCGCT
AATCGAGCACAACGTGCTGTCGATCTGGGTTAACCGCGGGCTCACACCATCACCGACCAG
GTCTCCATCTGGCGGTGCTCCGGGGCGGTGTAAAAACTCCGATTCTCGACTTTCCGCGGG
CGTTGCCAGTAGGACCTTCCTTTTCCCCTTTAACCTCTTCGGCTTCACCAGGTTTGGCAT
TGAATGTTCGCTCATATCGGTTGTTTTCCATAACATTTCGTTTATGTCGGTCAGCCGCCG
GCCCAGTACTCTGGGATTCAAGGCCACGCCTTTTTTTGGATGCGGAGTGCCAACGGCAAC
TATATCCTTGATACTCCTAGTCAGCGACTGGCGACGAAATACGGATACAGAAGGCTAAAG
AAAAAGTGCAATGGTTACAGTTTCACGATTTTAACTGGCTTGAAATAAGTTCGTAAATAA
TTATAAACAATACTCCTTGAATGTGTTGCTAAAAATTAAATGTTGTTTGAAATCATGCAA
ACATTACCTTAGATTTTGGCAGGGTCTTCGACCTATGAGAGCTCCCATCGCTGATACTTG
GACTTCCGTCGTCCGGCCTTTCCGGTCTTTCTGGCCTTTCCGAGCGTGAATTGTTTCGAT
TATCAGAACCAGTACGCATTATGAGGCGGGCCTTTAGTAAACTGGCATCAACTCCTTGCT
GCGCGCGAGGATATGGAGTCGACGACTTATTAGAGGACTTCATTAGCCCATAGTCCCTGG
AAGCGATGGGTAGGGGCTCCACGGATTTGAATTTAAGCTTCGGTATCCTCAAGAGAACAG
ATAGTTCCCGGTCAACCAGATTCAAGGGGTCATTTAGCGAGTTGTGCGGCCTCCTAGTCC
CACTCCCAATTTCTTCCCTGAACGAATCTTTCTTTGAATTTCGCATCGCTTCAGTGTTTT
TTGTTGTCTAACGATTTTTTTTTATGAATTGTTTTATTTTTCAACTGTTTTTCTTTTTAT
TTTTTGAGTGTATGGTTTTTCTCTGGAAAAACATGACAAATATCTAAATGGTAATTATAT
GTGTTTCTTTTAATTTGTTTCTTTTCCAAGTGAAAGACTACAGTTTTAAAGCCATGTATG
CACCGCTTGACAAAAGCTGGATGCTGCCGAACTAATTTTGGTGTGTTGCAATGCCTATAG
ATGTCGCTAAAAGCGATGTATTTGCCGAATGTAGACAACTTTGTTTATAGGCTTAAATAA
CAACAATTAAAAAAAAAATGGAACCAAGCTTATTTGCTTTATAAGTGATATGGATTATAT
CTTAAATTCAATTTTTATGTAATTTAAGGCTAAAAAGAAAACAAATGTGCGTAATTCTAC
AATAATTTAACATATTTTTAAGCTTGAAGGATATAATTTTGGAAATTTCCGCTTTGTGCA
AGCTTTTCCTCCTGAGCTTTTCAAAGCTTTTTTCGATTTAACCGTTTTTATCAGCTGTTG
GACACAAAGAAGGAAACATTTGAAAATAAATCGTTCAGCGGCAAGGAAGTAAAAATTCTT
TAAGGTGGAAGTGATACTTATAATGCAATACGACAGAAAATAATAATAAATGTGAAAACC
TGAGTGTAAATTAGCGCAATTCAAATTAAAAAAAATAGCTGGAATACTATTTTAACTTTA
ACTTTAACTTCAAAATTAAAAATTAAAAATTAAAATAAAACGGAACGGCGCGCAAATAAA
TGGAATAAATCATATAAAAAATGCAAATAAAGGAATGGAATGAAATCTAGAGATATTTGT
GAGATATAAATAAATAACAAATAATCAAGGTGCTGAGTCGTGTAACTTGTAGGTGAATAC
CAAAACAGCGATAAACATTTACCATATAATATAAGTAACAAATTAAAGCCCATCAAGGTC
ATCCATCACTTAAAGTGAAAACTTTAAAACGACTTTTCTTTCCGCTAAGATGTCACTGTG
TCTGTCTTAAAGACTTTTTCGGAGTTTCCACGACCGAGGGAAAAGGAAGACGCTCCTCAG
TTGAGTGACAACTGAAGGGGAGAATGGGAAGGAGCCCAGAATTTCACGCTTTCTTTGGCT
TTTAATGAATTATGACATTTTCTGGTAGAGCCCGTTTACTTTTAACGATAGAAGTCGGGC
GCGTGGGAGTATGAAAAATGGAGGGAATGTTATCAGCTCTTTTCATTTTCTGTGTATTTT
ATTTTATTTTTTTGTTTTATTCTTTATATGATATTTTCTACCACTTTGCACCTGTCCTGT
GAATGGCACAGCACAAAGCAAAAGGGGTTTGTGTATATGGAGCCTACCTGAAACATTCAT
CAGAATGAGTGAAAAGAAATTTTACACTTAACGTGTTTCACTGCTACTTCACCGTGTTTT
CCGACCATGTGTGTGGTTGTCAGCCATGTTATTATTGCTTTCTGGTTTCCTTTTTTTATA
TGCACAGAAAAAAGTACTTCACTAAATGAACTTTCGATGATATGTACGTTTAAGGTTTCT
TTGGAAAATAATGAAATGTGTTTGATTATCATGGAAACTGATTTAACAATTCTGATTTTG
TCCCATTTTTGAGATTTCTCGGGATATAACAAGGCTAAGCCCTTTTCTAAATAATAAATA
TATCTAATAATTGTGTCACACTGAATATTTTTCTCAGTGCATATATTTGCTTAACAGCTT
CTTGCGGGCTTGGAACTCTCATTCATTCAGTCGCTCACTCACAGTAAATGCTTTCAGACG
CCACAACTTGACGCGGCCTGCGTTCCGGGTCCCATGTCCTGAATCCCGCTGGTGGCCAGG
ACCGTGTTAGCTGTCCTCCTTGGACTTGGCATTTGTCGCCGAAATCCCCTGTCCTTGCAG
ACCGGCCTAATCCTGCGAGGGACACTGCGAAAACTACAAACGAAAATAGCAGAAAAAAAA
CCAACGTGTCCCTCCATTTTTAGTTTAGTTTGTTTTGGTTTTGTTTTCCCGGATTATTGG
CAAACTCAGGCCTGGAGAAACTTTCATAACTGTCAGAAGGAGCAACCCGCCTCCACCCAC
CTGGCCATTTTTTCAGTCTCCTTTCGGTGCCTTTGCTCTGCGCCTACTTAAGCTTTTCTT
TACATTTCCTTTCTACTCTTTTTTCTCAAGTATTTCAAGTGTTTCTCCTTTACTTCTTCG
AGTTTTGAAATATTTGCACCATGGTTTGCTTTGAATGGCTTGCAATTGAAAATTGTCATT
TAATGGAAAAAGTTGGGGAAATAATGCAAAGGGAACCAACTTTAGTCCAGGGGTTAAAAC
AATATTATTATGCGATGCACTTCATTGTCATTCGCTTTCATTGCGTTGGCATCAGTTAGA
TATTCGTTTGAAGTTGGCAAAAATACGTTACTCATTGTTCCCCTTTTAATACTATATTCT
AAAACTTTAATTATTGTGCCAGTATATTTAATTTAATAGCCCTAGAAATTTAATTTATTT
GTTAAAATATATTTATGGAATTTTATACTTAAATTTTATGTGTATCCCATCGTACAGCCA
TCAACCAAGACACTCGAAACTTTTGCTTCATTGAAATAGTTTTTCATTTACTTGCCTTTT
GCTGAAATGTGCAACAAAGTCAAGGGGGCAGTGGCAAACCACACCAGAAATAAAGAAAAA
TAGTTGGATGAGTAGTGGTCGAGAATGAAAATCCATAATTCAATATGCAGCTACAGTGAC
CTCGATAAGTATACCACGAGCAGTGGTCAGTTGGCTAGGGTCAAAACCGCAACTGGTGCT
GTTTAATGAGTAGTAAGTCATCATCAGCAGCGACACACAGGATGATTGTGTGGGTCTGTT
TAAAAGGACAGGCTAATTAGCAAGAAGTCCTTCACCACGCTCGTTCCTCTTTCATTTTCA
ATCCCATTTCAATTTGTCACATTTTTTTCCCCTTGCAGAGTACAATAACGAGCCGAGTGG
TACTGGAGCGTTGGCCGGCAGCTTCGATAAGTCGGTGCTGCAAATTTCCGACTGGCTGAC
TTGGGAACAAAACATGATCAAGATACAGAGCGTGCTCGTCGACGATGGCGATGCAGTGCG
ACTGGCCATCGAGAAGCAGGAGGTGCGCCCCATGAAATTCAACACACCCATTCTGGTTCA
CACCCATATCCTATTTTCTCACATCACATATATCTCCCGTTCACAGAAAGTCCTGCGTGA
ATTGAAAATGAAAAAGCCGCAGCTCAACGAACTGGTTCACACAGCGGAAGTGCTCAAAGG
CGACGTAAAACGGCAACAACTGCAGGAAAAAGGTGAGTCCTTTAAGAACTATGGGGGTTT
TAAATGCATTGAGTTTGGTATGGCATTTTCAAGAGGGTAACTTCTTAAGATTTCTGATGA
TCATCAATCTTCTGCGCCGTATCTATAAATTTATTTTATTTTATTTTTTTATTTATTTTA
TTTTATTTATTTATTTTATTTTATGTGTGTATAGAATTTATAGAATTTCTTTTATTTTAA
GTGTGAGTTCTGTGATTTATTACAAATCTAAAATGCTGAATAATTATCTAAGAAGCATTA
TAATTTCTAATGCATAACTTATTATTCGTCAAATTTAGATCTTAAATCTTTGCCAACCAC
AATGTCGACTTACCACTTAACTCTCGCAAAAGTAATTATTTTATCTAAGGCATTGATTAG
ACTCTGCAAATAGTTTTGCATCTTGCCCATTCGTGAGTGTATTTTCGAATCTCAATTAAT
TTCTGAATGAAATTGTGCAAATTGGCTCACATATGGAAATTTCATTAGGCCTTGTTAGCT
GCTCTGTCTCCGCTGCCAAGGGGATTGGATACGGCTGATGGCTGTACAACACGGATCCAT
TTCCTCTTTTGGAAAACCCCCGGTAGCGAAACCCAGAAATCACTTCGGTGCAAACAAATT
TCCGCCGGTCGAGACAAAATGCATGCAAGGATATGGGTAGGTGAGCGTATGAATGTGGAA
AAGTGGGAAAGGGGAAAAGCGAGACATTTGAGTTTTGTACTGAACAGCAACAGAAGCCAG
CGAATGGCCACTTAAATTTTGCTAACTCAGTCAGGGGAATGTTTTCGAAGGGGATTCGGG
AAGAGAAGCGGTGGCAGTGTGGTTAAAAGGACTGTCAACATTTGCATAAGGGGGCCGTGA
ACCTCGGTAGCCGGTTTGTTTCAATTCGAAAACGTTCTCTTTAAACTGGCTGACTCAAAA
CAATGTCAAGAATAAATACTCACACTAAGGTGGACAAAAGAGGGAGAGAGAGAGAGTTTC
GCTTGCTTGTTAAACAAATGATTGCATACTTTCAGGTCGTGGTGAGTCCTGCAGTTTGAC
AGCCACTGTATTAAGAGCATTTGCGGGTAAAGAGCTCTCCGTTGAGAGAAAAGTCTCATT
CCCATACATGCTCTCCCGTTTTTATTTGCTTTATTTTCTCTGCGGAATTTTAATGTGGCA
GTTGAGCAAGCGGCATGCAACATTTATGCCAGTTGACATTTAATTGACAAGCGAGGCAGC
CGGCGGGGAAAATGGGAAAATATCCAGCCAGCAGGATGCTAACTGAAATATTTTCATGCT
CTTTGGGATCGGGGTGGCATTTCCCGGGGGGTGGTGATGTTAGGGCGAGAGGAGCCAGAT
GAGCTGGGAGTTGCCTGCACTGCTTGTTACACATTATTATGATGTTTGGTTTGTCATAAA
CATTTGTAACTTGTCGGCCACGTTCTCTCATCTCGGCCATTTGTACGTGCATTTCTGCCT
TATTTTTTTCCTGCTTTAAGTGTGTGTTTGCCTCTGTGATTGTGTATATGTGTGTGGAGA
GAGGGGGTCGGAGGAGGGCATCTGTGTGGGCCTTTTGTAATGGAGATGCCAACAGTTGCT
TGCACCAAGTGAATTTTGCTTTTTTGTGCTTTGTAGAGTGCTGTGTGCCCTGCAGTTGCA
CATACATACTTTAGTATTATAAAATGCGAAAAAATAGTCCACATAATAGTTCTGAGCTTG
TTAGAGTTTTATTTGTATTGCAATTCATTTTATTTTGCCCTTATGCACACCCAAAGTTTG
TTAAAGGTTTATTATTTTAAATATTACATTTTAGCAATCTATTTAGTATTATTAATAATA
ATATATTTCCATTTATTAATTTTATGTAAAGTACGTAATGCTTTACATTTGATTTTACTT
ATCTTCATATTGAAGTGCTGTTCGCTTGAATAGAGTATTTTGTAGTGGTACAATGTTTCA
ATTTTGCCTCAAACTATTGGCTAAGAGCCAAACTGAAAATATGTCCATTACGGCGGCATT
GTATTTCAATTTGCTTTTCAAAGCCCGTTTAGGATTTCCACGGAAAACTCGTCGCGGCCA
GGCCTAGTTTATTATCGGTAAAAGTGGTTGGAAATGAAGCAAAGAGCTCCAATTAATTAC
GTATTTCGTAAAGTGAGGCTTAATTAAACCATTATTCATTATCTCGTTGGCGGTTTGTCT
TTTCCCTTTTGCTCCGTCTAGCTGCACCTTATTTTCGCTTCTCCTTCCCGTCTCTCATTT
TTGGGCCAGGAGTCGTACAAACTTTTCGCCAACCCAAATGACCCCAAAGTCCTTATCATA
AATAAAATGCCAGACCGCACGGATGGGGGCGAGTGTAGAAGTACAAGTGTGTGTGTGTGT
GTGGGTTGAGGTTGGCTCGTAAATCTGTCTTTGACATGCAATTTCAGTGCAGCGGCTGTT
GCTGCAACTTGGCCAACAACTGCCACAACAGAGCAACACCAACAAGCCAGCTGCGAGCAT
ATTATCTGAAAGGACAACGCACTCAGTTGGCCAAGCACAGGCTCAGTGGCTTCGCACCCA
CACCTCCTCCTTTTGGCGTCCAAATTGCCTTTAATTGCAGCCTTTTGCCTCGCAAACGCC
TTCAACTTCACAACCCATCCAGCTTTCCTTTCCTTCTGTTTTGGTTCTACACACGCCCGC
TTCACGCCATTACACGCTTTAATAGGCCTTGCCCCTCTTATACCGCCCATTCCCCGAATA
ATAAGGGAGTTCGCCGCCCCCTCCCTTCCTCGCATTTGCAAAAACCCCTTCTTTATCCAA
AGTTAGTGCTCTACACCCCCCAGTCAAGCGCTTTCTTTTCAATGGTTTGGCATAGCTTCC
TGGCATGTGTCTGCGCTTTCAAGAAGTTCGTTGCTTTGGCTACTCCGCTTTAAAATGCAA
GTTCCCTCAGCTTGTACAGTGGGACAAAAATTGTTGGAAATATAAATATGAATTTATGAA
CTTAATTTAAATAGGGTAATGCTTACACCATTTGACAAAGAATTGATATAATTGGCTTTT
TACTGGAATCTTGGTAAAAGTATATCAAAAAATGTTCACGAATCATGAATCTAACAAAGA
TGTAATTACAATATTATAAAGCTGTTTTTAAATAAAAATTTAAGTGTATAAATTTCTTAA
AGAGCTCATAATAATAACTATAAACGAAACTCACATTGTAAAGTGTGGCTATTAATATGC
CTTAGAAAACATTTCTACTTTTTTCAATAGTTTTTATTTTAAGTAAAGGGTATCCAAAGT
CGCTATTTGCCGCGATCATTTTTCCGCGTCTTGTTTCTTTTCTTAATTACTCAAAAAGTG
AAGTGAAGCCGAGTCTCTCTATGGCTGCTTAACCTCAGACCTTTTATGACACAAAGGCAC
CTCGGTACGCCCGATTTGCCACGCCCCCTTGTTCGTGGGATTTAAGTAAGCATTAAGTGA
AATTATTGTCATGGTTGTTAGACTTTTAGCTCCGGCTTTTAAGCCTTTTTAGCCTTTCAG
CCCTGTAAGTTATTTTCGCTAAAATAGTTTTGCGCACAAACAAATTTTTTTGTGCAACGA
AAGTATGTGGGAAATTTGTCTAAACATTGCAGGTTATAGGTGCTTCAGGGAAACTTTTAA
AAAGTGTGTTCGTTTGCGTGTGTGCCATTGTTTGTTTGTGCGTGCGTGTGTATGTTTGTG
TCACCCCGAATGCCCTTGGGTGTCCTGGTACATCTTGCCCAGACTTCGCTTGGGGCGAAG
CCAAGTTGTGTGCTCCTCTTTCAGCTGCGGAAAAATGAAATTCCAGTTCCCTGCTGCAAG
GAGTGTGGGAAGGATAAAAAGGATGCGAGCGGAGAAAAAGGTGTGGACTCCATGCACTTA
CTCATTACGCAAATTGTCCTGGGCCAGCACAACCGACTACGTGTCCTGTGCCTGGACTCC
TCTCGGTCTGTTTTCTCTGTCTTTGTTTTTGCCCCTGGGCATCTCATATGACCGAAATGC
CGTTAACAATTTTCGTTGTCTAATGAATTTTAATTAAATTCATTAAAAAGGTTGCACTTG
CTGGGTGCCCAAGGACATAACAATGAAGTTCCTTCAGTCTCTGCCATGCCGCACGAAACT
TTACATTTATACAAAAATGCATGAATATTTCAATTGACAATTGCTTTTTCAGCTAGTGGT
TATCAACCTTAAAATAATAAAGTATATTCTTTTTTAAATCCAATTTGCATTCTAATCAAA
AAGTTGTCCGCGATCTCGTAACAACCTTTCAACTAATTCTTCAGCTAGTTTCTTGGCCTA
CTATCCCATTAATGACTTTCTTATCACTCGACAGCCACCCTCCATTTTCCTCCCATATTT
TCTTCAACTAATTAAGGCCAATGCACACCAAGCATTTTTCCCGTTTGCGCAACCCATAAA
AGAAAATCTACATCTAAGACCACAATAACATAAACATCAAATTCCATCAATGGCACAACG
AACCGCTCAAGCTCCTCGCTTCGCTCCCTCTCTCTCGCTCACTCTCTCTCTCACTCTGTC
CGAATGCATCCATCTCTTTCGTGCGGTGGGTGATGCCGCAACCCTGTGCAAAAATAATCC
TTATCAGTTGTCAAGGTTCAGAGACGTACGCACAACATGTGGCAGGAAGGTTGAATGTCT
TCCGGCTAAATCGCATCGCCCCATGCGCATGCTCCCCACGGAATCCTAGCAAAACAAATG
CCAGTGGATCCGGAGAGCAGCCGGAGAAAACTGCCGGAATGCCGGTGAACCCAATATACA
CAGAGAGCATCACGGAAGTCGGGAGAAAGTTTGGTTAGGAAAGTTACAAATGGGTGGTGG
GTGGCGAGCACTGCAAGAAAAAAACAAGAATTTAAGATCTGAAAACTATTTCATACATTT
GAAGTAATGAAAATTAAATTCTTACCTAACTTAACAAAATATTCGGGCATTTTTTCCCAT
TTACACTCAGCACGATAGAGTGTAAGCAGCTTAGTAAATTTTTCCAGTGCACTGGTAGTA
AACTTGCTTTGGGGTTGCTATATCGCCCACCGAGCCCCACCTCACCCCTCGCCCCACCAG
AGCGCTCCCCTTTTGGCCGCTCACCTTTTGTTTACCCATTTGGGGGTTGCTGGTCGGCTG
ATTGTCGCTCTTTTGGAGAGCTCGACAAAAGCGGTGCCGTGTTGAATTTACGCCGTGACT
TTCGCTCTCTCTCTCTCTCTCATTCGCTCTCTCCGTTTCTTCTTTGTCCGCTTTGTCCGC
TTTGGGGGTCCGTAGTTCTGCGAGCAGCTTGTCAGGACATTCGTTGGCTCTGACTACGTA
CAAACGGTTGTGAAACTCCTCCATATCCAAATCCATTCCGTGTAATCCCGTGGAGCCATT
CACGTTTTCTCTGCATGGTGCGCGTCGCGTAAGAGCTTCCGGCAGAAATATAAAAATATA
AACAAGAAATTGTAATTTAGATGCAACATTTTCGTTGCTCGACTAGCGAACCAATCGAGT
GTGTGTGCGTGTGTGTCCAAGAGTTTAAGTGGGGCTAACAAGCCAAAAGCCAAGCAAAGT
CAAACCACAAAACGGCATTTAAAGTTTTGTGTCTGCGGCGGCTTATTGCCCTGCCCTGCT
CCCCTCTCGCTCTCTCACTCGCTCGCCCACTCTACCCCTCTCGCTCGCTCTCCGCCGTAT
TTGTAAATCAATAAACGTGAGGGTGGCAAAAAGCCGCAAAATGTTGTTCAACAAAAAAGG
GAAAAGCGTCCTGTGAAAGAAACAAATAACGAAAACTGCGTGAAATTCGCAAGCTAAATA
AACAATATTTGTTATTATTCTGCATAAAAAATGAGCCAGGAATGAATACATGGAAAAATC
AGTGGGAACACAATGTTTCATTAATTTCACTTAATGGCATAATAAAAAAATATGCTCTGA
TTGGTATCAGCAATCCATAAATTCAAAAATCATAAAACCATAAAACCTATAGAAATGTAA
TTTAATTTATTGGATTTATTCCAGTACCTACTTACAGCTATTAAGTACAAAAATGCGTAA
AATTATTAATCCCGAATAAACAAGTTCAATCCACATAGCCATTAAACGCTTATATAAATT
ACAAAAAGCACTTTACAAGCCCATCATAAATCCATAGAAATTAATTATTGAAAAATATGA
AATTCCATTACAAATGAATAATCAAATAGGATAAACAAAAGCAGAAAAAAGACCATGCAT
TCACGAAATCGTCCGCAATTTGCATATAAATATTCAATAAACCAAGTTTATGCGATACAA
AAAGCAGACGAGCAACAACAACTGGCTAAATAAAGTGGGCGTGTTTCTGATGGCGGTCGT
TTTTTGCCCTTTGTTGTTGTTGCTATTGCCCACATCATAGCGAGAAATGAATGTGTTTCA
ATAAATTACACGGAACGAGCCTGAAGAGCAGCAGAAAAAATGTGAAGCATAACTTAAGGC
GTGCGAGCTTGTTTCTCTCTGTGTGTGTGTGTGTGTGTGCTTGAGCGCACGTGTGTGAGT
GTGTGCGTCTAGGAATTCATTGGAGTCCACTCCGTGCGAAGCACAAAAACAGCAACGCTT
GCGAAAAATGGAAAGCGTAGAAAAATAACACAACGAATCTTGGAGCTCCTCCAATGGCAA
AAATAAACAAGAACTAAAACAACAAAGCGGAAACTACTGCAACAAGCAGCGCAACAACTG
CACTGCGAGAAATTTACGTTAAATAATGGTTGATTACGGCCTCCTGTAGTTAATGAATCC
ACAATTCCGTGAAGGTAGTTTAGTCCCAGTAAAAGCAGTTAAAAAGTTCTTGGGGATCTT
GTATGGAACTATTCATACTTCTAGATATCATTGTTAACTAAGTTAGTCAATAGTTTTCTG
TTTCCATCAATTTATTAACCACGCTTTGCTTGAAAGCACATTGTTCCAATTTTCTTGTGA
GATGAAATAGTTTAGCCACCAGAAGAATAACCATTTTCTCTTGAGCATTCTTTGTATATC
CTATAAACTACTCTGGCCGCGGCTAAAACTTCAACCGCAGCAAACTTAAAAAATAACTTG
AGCAAGAAATACAAGGATACTTTCATCAACAAGCGCCACAACTCAGCTGAGAACTTGATT
GCATACTTTTAGGCGGAGCAGTCAAACATTTCATACGCCTGTATCGCCCGCATCTCTTGG
CAGAAAACGTGTCTTGTATAAAAATAGTTTATCTATGTATCCGCCCCCCATCGGCCCCAT
TTTGAAGCCACACCTCCCCAAACGCAAAGCACCGAAGTTTCATCGCATAGCATGCTTTCT
GACTATTTATAAGCAAATTTTGCCAAGTCTTAGCTGAAAACTTAAAATGAGAAATTGTCG
GAATTGTCTGGGCGTCGAAAGTAAAGCGGGGGAAATATGATTAATGATTGGTGTAGCCTA
GAACAATGGATGTGTCAATCGAGTGTCGTGGAAAAATTGCTCTCATTATCGAAGCCATTA
TTGTGTTATTAGGGATAGCTAGGCAATAGAAAAGCCAACGCAAAATGGATGGAGAAGGGT
CCAATGGGTATTGAATTTATTGAGCCCTATTTGTGAAGGGCCGGCAAAACGTATTTGCTA
TTGTTGGGATAATCAAGTTGGCTGTCGACTCAATGTGGAGCATATTGTCGATTTGAGGAA
TTACGCATACTTAATTCATGAGTTGTGTATGCAATTGATGGATAGCAGCTTGATTACATA
GGCAAATCAAATAACCATTAGTTATTTACTGCAACATAAATGGATCCTTTAACTAGTTTT
CGTCTTTAATTTCGTATTTCTGACATATTTTATTTACTTTCTGGACAAATCAGCAATCTG
CCAGAAGTTTTTGACAATCCATTTCCATTAGTTGTCATTTCACAGCCCGCTAATCCGCTT
TACATAACTTTCTGCAAAAGCCTCCAGCTAATTGAGTGCAATTGTGAGGCAGTCGAAAAA
GGGAGCAGAGAAACTTTCTCCAGCTGCGAGTGAAGTTTTAAATAATCAACTTTTGTCATA
AATTAAATAGATCTGGCAACGGCTGCATAATCAAGAAGCCGGCAGACGCGGCCGTAAAAA
TTACAGCGAGAAACCTATTAACTATAAGTCGGTGACGGAAGGAAGGAAAGACTCAGGAAC
CTTCAGTTGCCAGGAGGGGTCGTCAGGATAATAGTTTTTAGTCCTGCCACTGCTGCTGCA
ACGACAGAGCCAGTCGAGCCGGGTTGAATATGCAACAGAGGCGCACACGGGCAACAAAAG
AATCACAAGTGGAAACTGAAAATGCCCCGTATGCCAAATGGCCATCGTCCCGACATTGTT
GTCTGCACTTGTTCGCCAGCGTGTCTGTGTTTGTGTCTGTGGCAGAAGTTAAATGCACCT
GCCACCAAGGAAGTGCCTGGACGGGCTTTTCCGCAGAAGGAGCCACCGGGCGGGGGGCCA
AGGTATCACAATAAAGCGCACTACATGTCTGCGTTGGCGTTGTTGCAGGTGCCAAAAGTT
AAATGCAGCAGCAGGACCGACTTCGAAATGCGTGAAAGCATTGCCAGTAGCCCGCTGATT
TCGTATGCGGAACGGCCAGCCAAGAAATGTGCAGTAGACACTGGATAAGAGAGAAATAGG
AAATATTGAAAACTGACTTGTGCCACAGAAAGTAACATACCCTTGAAAATACCTATGTAG
GTGTTTAGAAGTATGATTTAACTTATTTGGAATCCAAATGTTTCAGATCGGAGAATCTTA
TTTATTTTATCTTATTTTTCTTGTCCCTCTCAAAACTATTATTAAACAATTTAGAAAGTC
TCTTTTTGAAAATTGTTTTCCTTTTTAGTTTTTTTTCGGATATCTTAATCTGTCTGTATT
ATATAAATAGTCGAGAAAATATATAAAATCAAGTAATTTGAGCTTCAGAATGACCCCCAT
TTATTATAAGGCAGTGTTCTCATTAGTTGGTGCCCACTGTTTGTATATGCGGACAAAAGC
ACGCAGCGCCAAGAAGTATGCAACGAGAAACAGCCGGCGCAGGAAAATGCGCAAAGTGTG
GTGAAAATCAAGAAGTGATTGTGTGTGTGTGTGCGGTGAAGAGAGAAAGTTGCGAAGATG
ACGCAAATGGAGTGCGAATTTAAGAGTATTTTTCGTACTCTCTTTTGTTTATTTTGCTCT
TTGAAGTATTTACTTGTGGTAGTTGGTTGTGTTAAGTTTCCGGCACGTTTTATAAACAAA
CTCAAATCTAAAAGAGAGCGAGAAAGTGGGATAAAGAGAGAGAGAGAGAAAAAGAGGGAG
AGGTGGAGTTTATGTTTACCATTAACATTCAACGTTTTACCAATGTCAACAGTGCCGTTT
TTTATACACTTTTTTACACATTTATTACGGCGAAGACTGAGTGAAGAGCCGCTGGCCAAT
CGAACATTTAAACGCACATAATGCGCAGCGTGATAATGCAAATCAAGTGAAGTGTTAAAA
TCCCGCAAAGCCAACAACACAAAATATACAACATAAAAGCCCCGGGAAAATCCTTTAAAA
CGCACAAGGCTGTGAAGAGGCGTGGAAATCAATATGACTGCCAAACCACCGCCTCCAATC
CCGCCCACTTTGGGTGGCGATGATTCCGGCACACATGGACCGAAACTCGCACCCGAGATA
CCTCGCATCAACTCGGAATTGGCAGCACAGGCGGCACTCAGAGGACAGCAATTGCTGAGG
AAACAGGGATCGCAGGAGCAGCATGCGACTAACACGCTGCCGGCCCACAAAACCGGTGCC
CCGCCCCCCTTGCCGCCCACCCAAAGTCGTCCGGTTCCGGCGATTCCCGCCAGGGGCGCC
AGCGATCGTGCGGCACCACCGGAAATACCACCAAAACGTCACAGCCTGAAGAGCATGCCC
GATGGACAGCCGATGATGGTGCCCGGACTACCGCCAACCATGAGGCAACCACCGCCGCTG
CCCAGGAAACCGGCTTCCACTCAGAGTTCCGCTCAGAACTCAGCACAAAGTTCCCCGTTG
GCAGGCATGAAGTTCAAGGATAAACCGCCGCCACCGCCCGAAAAGCATTCAACGCTCTCC
GCCGAGGGAATGGCCGCTCGGCGGTGCTCAAACCCCTTTGAAATGCCACCACCACCGCCG
CCACTGGTCCTCCAATCCGCCGTGGCGGCTCTCAGCGAACAGAGCTCCAAAAATGGCCTG
AATCCCGTACCCTCGCCAGCGCCCACAAGAGCCAGTGAGGCGAAGAAAATCAACCAGCGA
TCGATTGCATCGCCCACAGAGGAGTTCGGATCGGAGGATGCACTGCGGGGAATTGAGAGT
GGCTTGCGCAACATGGAACGGGCCATGCAGGAGCAAATGAATCTGAGAAACATGGAGGCT
GCAGTCCAAAACAATTTCGATTTGAGCTTTAAGGCTAGCCTAGCGGCAGGTGCTCGACAT
CTGGGCGGTGGCTCGGTTAATCTCAGAACGGCCAACTACGAAAGGAACCTATCCTTGGAC
GAAGGACGAGCAGGTGACTCGCGACAATCCCTGGAGGAACTGAAACAACTGAGGGCCCAG
GCCCAGCAGCAATCCCTGCTCAATAATTCCTCCTCATCAAGCTCCAATTCCCAGGTGGAG
CAATCCATGCGCTCCACCATTGAGCACCATATGCGCTCACTGGATCGCAACTTACCACTG
GAGCTCCAATATAGTCGCCATCGCTTTCAGAACAATTTGAATGCCGTGGCCGCTGCTGGT
GGTGGTGGTGGAAATTCGTCCACCGGAAATGCGGTAGCAAATTCAGGAACTTCCGGTTCG
CAGCAACCACCAATGCCGCTGAGCAGCGAGTTTCGCGAGCAGATCCGCCAGCAATTGTTG
GGCAACATACCGCCACAGGTGGTCCATAATATGGGCCAATCGCCGGGTTCCGCTGCCGCC
GCCGCCTTGCTGCAACATCAGGCACAGTCACGAGCTGCCGCTGCCGCTGCTGCTGCGGCT
GCTGCAGCTGCTGCCGCTCAAGTGGCCGCCGGAAGTGGGGCTCTGTCGCGGGAGGAGCTG
CGCATGCGCAGAAGGTCTTCGCACGACGAAACCCAGCTAACCCAGAACTCAAGCGGTGGC
ATTCAGGGTAAGGTTTCTAAAAGGTGGCTTTCCTCTCCCTGCCCTTTAAGCATCTCCCAG
AAACGTTTATCAACGAAATGTCCATAAACACCTTATAAAAAAGGGTTTGTCCAGCATAAA
TAATTAACCAAGTATACCAGCATTTGTACAGAGAATAATAGCGCAAAAACTATAGACCTA
AACCTATACCAGTCCCAATACCAAAAAAAAAAAAAGAAATACTTGAATGCCAAGAAATTT
AAGTAGTGTTCATATGTACATACATAAGTGATGTTTTCTAGGAAATTGTTATTTACTGAA
ATTACCAAAAATTATATTTTACTATTACGTTCATGTCGAAAAAAAAAATATTCTTTTACA
AAAATATTTTCGACAATTTTTCTTATCATCTTAAGCCTATTTGGACTATTTTTGAATACC
TCCTACTCTTTCCATATGTTTGGTTAATTTATTTATTTCTTCTCGATCCTCGACTTCGTA
GAGCTGAAACAGTTTTCCCTAGCACCGCACTGTTCAGCGGACTTAGATTATATGCGTTGC
TGTCTGAAAGGTAACCACACCGAAGGATATAGCTAGTGTGTTTGTGTTGTCACTTAACCC
CAACCTGCCTCCCGCACAGGGCTGAAGCTTAACCCATAACAGCACACACACATGACCCTG
AACCAGCAGAGCTGACAAAGCAAATTGCTAACGAAAGTTATTATACCTACTAAATTGCAT
GGCCGGGCAATAAACCAAAGAGTACTGTGATAAACTCGGGCTAATCTTTGTTTACCATTG
ACATTTAATATGGTTCTATTTAACTATAACATAGCAGATTTTCACTGACACCAATAACTA
ATTCGCTTAATTGTTCAACAGTGACCCGATTGCGAGAGCACTGGGATGAGACGTCCCAAT
GTGTCCTGCAGCGAGCTGCCCAACTGAAAAACATGCTGAGCGACTCACAGCGGTAGGTTT
TCACCCCTCTTAACCGTTGACCGACCAATTAACCCCCTGTCACCATCTTAAATTAACCGC
AGGTTCGAGGCCAAGCGCCTGGAGCTCGAGAAGTGGCTGGCCCGCATGGAGCAGCGGGCT
GAGCGGATGGGAACCATCGCCACCACAGCCGACATCCTGGAGGCACAGCAAAAGGAGCAG
AAGGTATGTGCTAACACTACCATCAACACTTGGTATTTCTCACACTCACTCTCTCTTTCC
CTTGGCAGTCCTTCCATGCGGAGTTGCACCAGAACAAGCAACACTTCGATATCTTCAACG
AGCTGACACAGAAACTGATTGCCGTCTATCCCAATGATGATACCACCAGGATCAAGAAGA
TGACGGAGGTCATCAATCAACGGTGAGTGAAGTGAAATAGTGGGCAAGAAATGGTTAGAT
TTCTACGGGTAAAAAGGATAGTAAATTGGGAATTTGTGAATTCTTTGCTAACCGATTCTT
GTCCTAATTGGCAGATATGCTAACCTAAACAGCGGAGTCATCAATCGTGGCAAGCAACTC
CATGCAGCGGTGCACAGCCTTCAATCTTTTGATCGAGCCATGGATCAGGTGAGATTCATC
ATTAAATGCCATAATAAACACATAAGTTTAATGATTCATATTTCTTTTGCAGTTCCTTGC
TTTTCTTTCGGAAACGGAAACACTTTGTGAAAACGCCGAGTCTGATATTGAACGCAATCC
ATTAATGTTCAAGGTAAGTCGCCGACTTAATCTTTGGAATCGTTTAAATATACCCTGCTG
CTGTGCTGACATAATGATATATGTGTTCTGCAACAATTGAACGACACTTGAAAGATTTAT
TTAGTGTATGAAGAGCAATCTGCTCTCCGTGAAAAGTTCATTGCCTTTCGCTTTTGTTGA
CTTTCCCTCTGCGAATTAACTGCGAAAGATGATGAACAGTCGCGGGATACAGTGATGCTA
AATAATGTGAATTTTTTACGAATGTGAGGGAAGTATTAACTATATAAGATTTATTTATTC
CAATCCTTGTATTTACTATATTTTATATAGTTAATATGAACACGAGAGATTTTCTTAAAA
AGAAATTATCTTAAGAATGATCTTAAGAATAATCCAGATAAACGCGTTTTCTAAACATTT
TCTTTGCCGACTTTTTAACAAGTTATTGAACTTTAAATTATGTTCGATCGTTTCCCTTTG
GTCTTAATTAAAAAGTTTTTTTTCAACTCTGTGTATTCCCTTTATCTATTTCGATAAGCG
AAAGCAATTGGCCGCTTTAATTTACTGTAGCCGATCAAGGGCTGAGTTTGAACCACTTGA
ACTTGCCCATTATGAGTATTTGTATCCGTATACAAATTCGTTTTCAAAAACGGAACCGTA
CAAAGTATTCCACTCGGAGCACTCAGTGTCTCGATTGCAGTTGCAATCAAAATTGGCATT
GTGGCCACAAATGAGTTCTGCCCACTTGCTGGATGCACTTAACAGTGACACTTATCTGGC
AGCGGTTTTCCCCGCCCCATTGGTCTAGCAATTTCCCTATTTTCCGACCCTGCCCCTTTT
GGCACCACTCTCAATATTCTTAAGAGTTCAGTGTGCCGCGGGCGCTGCTCAAGTGATGTT
GCGGCGTCTGTTTGTTTGTTTATTTGAATGGATTGAAGGAGGGGTGGGTGGCCAAGAAAA
TGAGTGGGGAGGGGTGGCGTCATCACCAGCCCCATTTTCATTGTTTTGTGCGCCTGCCTC
TTTGTTGTAATTACGTTCGCCTATTTAAGATAATTATTTTAAGGCGCTTTTCTTTTCAAT
ATTCGTGGCTTTGTCTGCAGCATTGAGCTTTTCGGTTTTTTTCCCCTGCTTTCTATTCAA
TTATTTTATTGCTTCCATTGTTAATGGTTAAAATGTAAATTTTCTGCAATAGGAAGTTAA
GGATTTAAAGGGCTTGCGATAAGCGTTTTGTTAATGGTATTTTATAACCTTTTTACGTCC
AGAACATATATTCTCATACACACTTTTGGAGCTTAAAATAACTTTTTAGTTAAGTGGTAA
CTTATTAGTATTTTGTTACAGTATAACTTGTTATTTGAACATTTCAAGTACACGGTTATT
ATTTAAAAGCTATTTGAAAATCAGTTTCCTTCGAAAAGCTTTCATTGAAAGCTTTTAATA
TGGGTTAAAAGACAGGATACTTTCCAGGACCCGGACTGTTCCCATTATTATTCAATTCTT
CAACAAAATATTCAATGCGCAAGCGCATTTCTGATTTAAAGCTTTACTAAATATTTGTTG
GTTATATGGGGAAGAAAATGTCTCCACTCTTGTATTTTTAACTGCCCTTTTCGCGTAAAT
ATTTATATTTAAGATTGTAATTACATTTTATTTTAAATAAGGTATAGCATGAAAATTGAT
GAGAAATGGTTGTTAAATAAAACAACAGGAATGTTTTGAAATTATATAAAATAGCGGTTT
CCAGATGTTTTAATTTTATAATTTCTATAGAATTTCATTTTTTAGTAACATTTATCCCAA
GTAAGGGCCTTCATTAGTCGGTTACGTCTTTTAGTGCTTTGTTTTTGTTTACTTTGCCGG
CAGGTAATAACGGTACCTACCGGCTGATTTTCGCTCTCCCAGGTGCACCAAAAGTCTCTC
GCAAGTCTCTCCGTGTCTCCAAATTCATTTTCAGTCCGCTCTGTTGTCGTTTTGCCTCTC
TGTTGTTGTTATTATCTCGGGAAATGGCCGACTCCCACATGTGGAAAACGCGACCATTCG
GCCCCGAAGTTCGCTGTCGATGCCGATAGAACGCCGAACTTTGGCTATTTCGGATTCCAT
TCCGGATACTCGCTACCTCTGCCGCCGCCTCAGTCGGCGTCGCTGCCGCCGTCGACTGTG
GATGCTGGCGTCGAGTTTTCAGTTTCGGATTTCAGTTCGTGTTTTGAGATGCGCCCGGTC
GCGCGTGCTTAACGGAAAACGCCAAACGGCACAGCTCTTTTTTAACCGGTTCCGATTTAA
ATTAAATATTACCAATTAATTTGCTGCCTAAAATCGAAATAAAAGTAAAGAGAAATAATG
AGAAATTAAAAAAATTAAATTAAATGAAGGGATTTTTTAAAACTTTTTGGATAATGAGGA
ATATGGGCTTAACATACGTTGCCTACTTTGAGGCGTGCATTGCACTCTCACCAACACACG
CAAACGCTCGCACACACACTCACACACACATAACAACATTGCACACTTGCAAATTGAATT
CACCATGCAACAATTAAACACAAATCTCGGCTCAAAGCAAATGGCGGAAAAGGCGTCACA
GCCGTCGCCATTTTGTATGGCAGTGCGAGTGTGTGTGTGTAGCGAGTGCATGTGCATTGG
CGTGTGTTTGTGTGTGTGCCTGTGCATTTTAAAGTGAAATGTGCATTAATTATGCACACA
TATTTCACTCAACCACACATACAATGACCCTGTGCTTGTGTGCGCTTCGCGCAAAGTGAA
ATTGAAATTTTATGTGCAATTTATGAAAATTCAACTCGCTGGCAATTATAATCGCCTTAA
GAATTGTTACAGTGTCAATTAAATCTACCGAAAAATCCGTGCAATAGACAAATGGAATAA
CAAAATGAAAGCGAAAAGAGCTTAACCTGAATAATATATACATAATGCCTAAAATGCCGA
AAAGTGTGTTTGTTTCAAAAATTGTGGAAAGTGTAAAGAAATTTCTTAGGGTTTTTAGGA
CTATTTATTTCGAAAAGATTTTTACAATTTAGTTTTGAATGGAGATGAAAATCAAATTTT
ATAAATGAAAAAGAGCTTAACGAATTCGTTTTTAAAGAGTACAGAAATGAAAATCAACCA
ATATTTGTACATATTTTTCTAAATTCTAATCTCTTAGGCATGAAAATTACCTAACAATTT
ACCACATGTTCCGAAGTACACCAACTTGCACAATAGCATACAAATAAAGATAACTAAATT
GTCATAGTTTATTATCATCTCGACAATGTCTTAAGGTGTCATTCTAATTTTTTGTGCTGT
AACTCATCCTTAACCCAGATAATTATCTACTTCACCGTCTCAAGCCTTTCAAACACTCTT
CACAATGTCGCAGCTTACACAGAAGCTGGAATACATAGTAATCTTCAAAAACTTTCAATT
CTCTTTGGGGGCATCGAAGGGCCGACCACATAAGATCCAAGACGTGTTAACACGATTTAG
CATAGAAAAACAAGATTATTGGTTGGGGGAAAGGCGAAAGCCGATTATTTATCAAATGAC
AACACAATCGAGCGTGTCGCGAGTCGGGGAAATGCTCATTCATGGCAAGATTTCCACACT
TTTCGAGGCGCGCAGCCCGGAAAACCAGACCCTGGGTGTGGGAGACGACATTGGTCAACA
CTCGACTCAAAGTCGGGCCAAACAACAAATGTCAACCCGGCGATTCCAAATGCTTGTCAA
GTCTTTTTATTTCCTCTGGCCGTGTGGGGCATGAGATCTTACCTGTTGAAGCCCAGAAAA
ACAAAGCAGAAACAAAAGCAGCGGCATCTGAGCAACAAGTAACAAAAAACAAAAAAGATA
CAAAAACAAGTTCACAACAAATAACAACGGAATGCGTAGGCTTTGAAATTTGTGTGCTAG
AAGCACTTGAAATTGTCTGACCGAATGTCTGAAGCGTTTGTTGATGTTGATGTTGCGTGG
GTTTCTCGAAAAGTTGTTTGATTAGTGGCGCAACTCGACATTTTGGCCGGCAGCTCTTCG
GCCATTAATTGTCTATTTAGTTAAAGGTTATAATCAGCGAATCGGATTTCCTCGCCGTTT
GTAGACTGGCATCAAAACAGTTTTCACATTCGTTATATGCTTCATTAAAAGCGATTTTAG
GTTTTAATATTCAAATGCAACCTATCAAACTATTAAACTTTGTGGGTGTTAAGTGTGTGC
TTTAAATATAGTGTTTTAAGGCAAAGGAAAAGGTTTTAATGCTTTAATTTTGTCTTTAAA
GCATTACTTTATCTATGAAGCTGAATCATATATTATAAATAAGTCAAATGATTATTTAGC
AATTATCGAATATAAAAATACTACAAATAAAAAATCCAAGTGATTTTAAAATTGATGTTT
TTAATAATCATTATTTAAAAGTACTGCTTAAAACTTTTAAGCGTAAAATACAACTCCAAT
ACAAAAGTTCTCCATTAACAGAACTCAACATCAATATTTTCCACAAATTCTCAATTTTTA
ATTTTTGTTAAAAGCCCATTACCATTAAATTTCTTGTGGAGATGTCAAAAAAGTCAACCG
CTTAAAAACGTTATGCTGGCTGCATTAGGAACACTCCAAACTTTAATGATCGTCCGGCCA
GAAATGGAAAACTCCGCGGAGCCCAAAAAACCCAGCAAGCAACAAGAACACGTAAACTAA
CAACTATAACAACACATGCCCGCAGCACAATTGAAGTGCACTTTGTTAGACCAATTAATT
TACATTTCCGCGCAAAGCGTTGCCAAAAAATGAAAGCCGGGGAAAGAACGTGAAGTGTGG
GAGGGGGCAAACATGCAATGCAAAGCGAAGGGCGGAGAAAAAGTTTACATAGAAGCAAAA
ATAAAAGAGCGGAGTTCCACTTGAGGGCAAGGCAATGGTCCTTGACTTGGACGTTGAACG
CCGACGATTGACCAGGCTTTGCTGGTCCGGTTTGTTGTTGTTTGTCCGGTTTTCCCTTTT
ATTTTTTTTTTTTTTTTTTGCCATCCCCATTTGGACGGGATTGACCACAGCATGCGGATG
TGTGCGCGATGGTTAGTTGGTGATTAGTACCGCGGACCTGAATCCACTGTAGCCAGTTTT
CAAGTGGCTCTTGTCAGCTGACGGTTGCAAGGAAGTGGGAAAACGAATCATCAGTGTTGC
ATACTTTCGAGCCTTGCCAGGATCAGCGAATCGTGAAAATCAGGGGAGCAAATGCACGGT
TGACTTCTAATTGATAAGCTGCATTTTGAGGTTTTATAGGAAATATTACAAAACAATATA
ACTATATATATATATGTCGTGTTTTATGCAAGAGCAACCTGATTAGATTTCATATATGCA
CACATCTTTATAAGGCTGAGTATAATTTCTCTTCTTCATAGGCATACAGGAAGTTAGATG
TTATAAATTCCTTAAATTTTCTATATCCAGCATTATTTCATGAATGTTCTACTTAGTGGG
TACACTTCTAAAATATCGTAGGTCATAAATAGTAAATTTATGTTAAGCGTCTCGACTTTA
CAATCCACTCCAGCTCGCATATCTTAGAATCAGGCATCCAATTTCGTGTGTAAATTTCGC
AAGGATACTTGTAGCATGCCACCGCCGCCCATTTCTCTTGCATGGCAGATAGAGTTATTT
GTCATTGCCATCTGCAAGAGACCCACCAAAGATTACAACTTCACTTTGACTATAATTGCT
TGAACGTGGCACTAGTTCCAGTTCCGCCCCATTCCGCAGGACTCGGCTACCCTTTATCCT
GCACAGCGCTTCCGTTGCGGCAACTGCGAGGTTCATGCCAGTCTGCTCTCCTTTGGCTCT
CTTTTATTTTACGTTTTTCTATATTTTTTTCGTGTTATTGCATTTAATTTGTGCCAGTGT
TGGGCTGACTGCTTCCTGTTTGCTTCAAGCAAAAAAAAAATGGGAGCGGTGGGAAATGGG
GCTGGGAAAGTGGGAAAGCTGCAGACGCCGCACAGACACTGTGACATGTTTACAGTGTTT
TGTATGGCTCTATGTGTGTGGGTGTCTCTAGAAATGATAACTCGCGGCCAAACATGCGAT
AAAAACAACAACAACATCAAGGAGATATTTGTGAAAAACGGCGAAAAAAGTGGGGAAAAC
TGAAAAAAAAAATGGAATGAAAGCGGGAGGAGGGAGCCTACGGAAAAGGGGTTGCCAACG
AAATTAAATGCGAACTTTATGCAGCTGGAAATGCAGAAACCGAGACAGACAAAAAACAGC
ACAAAAGATGCTCCAGCTCTTTCTATTTTTGAAGCCCATCTCTTTCGTTCGCGGACATTT
TGTCTAGCACTTGCATACTTTTGTGCTGAAGTCCTTCCTCCCCTTCTAAGTGTGTGTGTG
TTTGCGCTTTCAATTCCATTTCCACTTCATTCGTTACTGTTTTGCAATGTTAACTACATT
TTCGCATGTTCTCAGCGCTCACACTAAATGTTATTTATTCCGCTTTGCCACCGCATTTCC
CAACGCTTTTCCGCACCCTTTTCATTCTCTAGGTTCTATTGTAATTTTTTTTTCGCCAGG
TCTTTCATATCTTTGTCCTTTTGCGAGAATTATGTGCATATTAAAAATGCATTATCATTT
GTGGCAAAACTCAGTGTGGGCGGAATTAAAAGCGGGTTTTTACAAGGTTTTCTGTTTTTG
GGCCTCAACTTTTGGATGTTTTGAAGGGCCGTTTTAAGAGAAAATAGTTTACATTTAATT
AATTTACACAGAAACGGAATACTTATTTATAGTTATTTATTTGGTCAACAATTTAAAGTC
AAATGATTTGATTCGAGAAAAGAAATTCTCTTTAAATTCCCTATTGGCATACGTATTTGG
CTCAGTTAAAATTTTTGTCATTTAAAATTAGCACCTCTGCACATTTGTTTATGTCCAGTG
CCATCAATCCGAGAATTTGCATTCCCATCAATATTTGGCTTGGAAGCTGTACCAAGAAAT
ACGTTTTACCAAATAAATCAACACAATCTTCCGACAGTTGCACCGAATCAGAAAAAAAGG
AAAGAAAAATCCCAAATTCTTTTCCAGAGGCCAGAACGAAAAATTTTCGACACAATTCAC
TCACAATTGGCAAATGTCATGACAGCATCTGCGGAACTGCAATAAAAACAAGAAAATGGA
AAATTGTGACATATAACTTCACTGAAAGAAATACACTTTCAACTAGAGATATTTTCAAAA
AGTTTTTAATTTAATGTTAGTTTTTATTATAAAAAGTTTTGCTGTCCCTACATTTTCATT
GAATTGCTGGAAAAAAGGGAATAAAAAATCGTGAAAAATATATTTTAAGGGAATACTGAA
TCCGCAAATATTTTTGCAAACATGCGATTGTCAATCAAAAATATGAAAATAAAAAAAGAA
ACGCAGATATGCCAAATGTAAACAGAAAAACATGTTCCAGACATACGCTAAAATAAGACC
AAAGGCAGCCAACCAACAAAATCCACACCAAAATTTCAATGTCATCTCCGAGGCGGCGAC
ATACATAAATCGCAAAGTAATATAAAGTCTCTATGTGTACATTTTTTATTATATTTTGTC
ATGTTTTAGCTGGCCAAATTAGCGTAAAAGAGTCACAGTAACGAACCGCAAAACCAAAAA
ATGTCAGTTAAGAGTGGGCCAGAAAGTTACAGCAGATTATAAGCGACAATGTGGTTCAGG
GGGGATGATGGGTGGTGCCAGTTGATGTGCCCTTCCAACCACAAAATGTGGGTGATGGGT
GGTGGTGCTGACTCTGATGCTTGTGTACTGGACCATTGTGGTTCGTTGTTGTGATAAGAC
TCACAACTATTTGGAAATGCCAGCGGCAGAAAAGGCAGCAAAAGCCGCACAAGCCATACG
AAACACATGGCAGATAAGGCTTATCACGCTCCAAGATAATAAAAGTTAAATAAGATAAAA
ATTGTGTAAAAACGATGAGAGAAAAAGAGAGAGAGAGCGAGGTGGAAGTGGAAAACCCAG
AAACGAAGTTTTCCTTCTAAAAGTTTTCCTTCAACTTGGATAATATTTTTAGTTGTAGTA
GGATTAACCCAATTCTTCTCTGTCACTTCGTATGCTTTTCCACACAGTTTTCACTTTTTC
CACCGGCAACTCTCGTTGTGCGGTTAATTAAATATTCAGTTAGATAAAAGAGCTTAAAGA
AAAGGCGCTTAAATTAGAGACCCAGGCAGAAGGGTAAATAAGCTCATAAAAAATATGCCA
GCGGTGGCGCCACAAATTATTCGCCCTCATCTTAACGACGCCATGAAAGCAACTACAGCA
ACTCCAGCAACGAAAGGCAATTTAAATTCTAATGATAATACCGCAAAAGCCTTTGCCAGG
ATCTTCCCTGGAGGAACCCCCTTTTTTGGAGGGGGGACAGAACTGTACTTTACCCAATTC
CAATGTGTAAGCGAGCTTAGCAAATTAGCGCGCCTGGCAACCGACTTCACGTGCATCATC
TCATCCCAAGTCGGCTCGCCGGAAAATATCCTTTGGGATTCCTGGCCGACATAAATCGCA
GCAGCTAGAAAATTTGTACTTCATTTCCGTTTTTCCCTCTCTAATGCGTAATTTTCAACA
CCTTCAGAGAAGCTACTCCCTCCTTATCTGCTTCTTTTGCTAATTATGCTTTGTTTACTC
TGCTTGGGATTATATATATAAATATGTATAAATATGCTTGGGATTATGATGTCCTAAAGG
GATTTGCACTAGAGCATAACACATTATGCTTTTTTATAAAAGAAAAAGAAACGAGGTGAT
GAAACATCAAGGAGGTACAAATAGATTCTTACCCAATCTTACAAATAATGTTTAACCTCA
AATAACTGAGTTTCCTTTTATTGGTCAATCAATCAATTGCCTTTTGTCTTGGATTCAATG
ATGCAATGGGCAAGAACCATCCCCAAAATAAACATTAGTTGAATTACTTAGCGATCATTA
TCTAGGACGCCTTTCAATGAGTTTCAATCAGAAAACCATTTAAAATGCCACTTATCATTG
TGGAAATTGAAATTCATTTGGAACCCCCAAAAAACCCCAACCGCCTAACTGGTTTAATTA
ACCAAGCAATTCAAAGCTCAAAGCAAATATAAATCATCATTAAGCGTCTCAGCTGAAGCT
CACGAATCTCAGACCCCAGAGACTTCGAACCGCTAATAGAAAAACCAATGGGGAAAATAG
TTGAAATTTCCATTTGCCACCGAAGCAATTTGGTAAATTGAACGTAACGAAATGGAACTT
AAGGGTGCCCGACAAAAGCTTTCCGCAAAATCAAATTCCAAAAGGGCTAAGAACACGATA
ATAATCCCATCAAATGGCCCGAACAACGACCAGCCATTGATCCTTTTTGGCCAATGGTCG
GCCGAAAGTCAATTTTTTAACACTTTGTTTGCCTTTGGGCGAAAACAAAACAGAAACTTA
AATACATTTCGGCCATCCATCGCTCAGAGTGCGTGTGCCAACAATTATTGCGTCATTAAT
CAGTCGGCATTTGCAAATTCCCTGACACTCCGTTTCCCGTCACCCTCGCTTTTCATATAT
ATTCCAATATATATATTGTACATATATATATATATGTTTGGGGAGGATGAATCCGGGCAG
CAGCTGGCATGACTTTTGTGTGGCTGGGCGAAAAAGGCAAATCTTCAATTTTATTGATTG
TTGTACCCGCTTCGATGCCGAAATCCTGGCGAAGGAAGATGAATGAACAATCTTGACGCA
TGAGTCTGGAAAAGTGGTAAAAGAACTTTTTGACCGGAACACATTGAACATTAGATACAC
TTTCAAAATAGTTTGTAATTTAAAGAAAATATAAATCGCTTTAGTTTGATTATGTTTGTA
TAGTTAGGAGTAAAAATACAAACCTGAGCATTTTCTATCTTATAAATCAGTAAAATAGCT
AAGAAATTGAAGTGAACTCTTTTGTTACATGTAAGTGCCACCGATTTTATAACATCACAT
TGTTAACAAGTGTAAAGGCTTACGAAAGAAGTGAAAACTCAAAGAGTTTTCCATGTGACT
TGCGAACGAAAGTCCACAGCTGACTGCAGCTGAATATCGAGTGGCGAGTGTGGGTGATTC
CACTTTTAGTCTCTGGCCAATGGCCATTTATTGGGCCATTCCACTTTTGTGTGCGTAAGA
CTCCTCGAGGCAAGAACCCGAAATGCTTGCGAAACGCATTAAAGGCCTCGCAACACATTT
TCATTTTTATTTCCCACACTTTCCCAGTTTCCCTTCTCCTGGCTCCTGGCTCCTTGCTTC
TTGCTCCTTGCTTCTTGTGTCCAATCGCCCAGCGGCACTCACAGTTGCGTATCAATAAAA
TATCCATACATGCATGTTAAGTAAGTGCTCCCCCACCGTCCATCCATGTGCCCGATATCT
GAGCTGTGATTCCTGCACCCGAAACGAATTGGGATTTAAGTGTTGTACAAGGAAAAGGAA
AACGGCATTGTTGCCGTATAAAAATGAAATGTACATGGTAGATGCGATACGAGTACTGTT
GGGGAGGTTAAGGGAATACAGAACCGGACTTGTAAGCAGTTAGCCGAGAAACGTGCCCGA
GGTTATTTGCAAAGAGAACCGAAACCGAAACCGAAGCAAACCAAACCCAACCCAACCCAA
AAAATAGAATAGCAAAGCCAGAAAAAGGAAACTTGTCGTTATGTGCTTGTTCGAGTGGTT
TTCACTTGATATTGCGTATACGCCACATTGAACACTTGGATTCCAGTTGCAACAGCGGAA
AAATACTGCGAGTGTCTAGAGAAATTTTTGAAATTATGAATTTATATAATAGATTAATTC
TTTTACATAAAAAATCCTCTTGCTAAAATTCTCTGTTTTATTATTGTAACTTTCCACTTG
CACATTTTCTATCATCATTCAAATTCACTTCACCTGTCAAATCCCTTCGCTTTTAGTTGC
TCGAAATTCGTTGTTATTGGACGTTCAACTTGGTAATTGTTAGTTGTACATAGTTATTTT
CCTTTCCCAGTAGTTGGGGATTTTGCATAACAATTTCATTAATTTAACAAGTAAAGCGAA
CTTTTACTTTGCTATCAGCGGCAGGCACTAAAAAGGAAACAGGACCTTCGAGAAAATCAC
GTAACAGCTGGCCAGAAGAAAGATTTTCATTGTGCGATTAAATCTCTGGCCAAGTTTCGC
CTCTGCTTCATTCAATTGTTGCCGTTTTTATTGTGCAAATTATTATTGTTAGCCAATTGA
ATTAATTTCGCGCACTGCTCTCATTCGCTCCACATTCCAGCCACTCCTATGGAAAACGAT
TTGCTGAATTCAATTAGTTTATTGTGATTTTATTTGCGCAAGCAAAAAAGTTTTTCGCAG
CCAGCGAGCAATAGCAGCGTGAAAATGCCAAGAAAAAGGCGAAAATTGAAATGGCAAAGA
GAAAAGTTTTTCGAGCATTTCCATTCGTCCAAAATTAATGGAATCGTCTTCATCCACACC
CCTTTCAATTAGGTGTTTGGTCCTTTATACATAGTTCAAGTTTCGATAGTACCTCTTTTA
ATGTTTCTTTATTTAACGGCTTCCTTTCGTTTCCTTAAAGTTTGAAATTTGCTTTCGATG
CACGTTCGTCCCAGAACTTTTATGATCGAAATAATCAAGTTATAATGTCCAGCTGTGAGA
CCCAAGAAATGGTCGCATAATAAATAAATAACTGCGTTCCGCCTTTAAAAAAATGGAAAG
ACCCAAAATGGCCTTAAAATTCGGTTATGGTTCTTTTGAACTCAAACCATTATCTAGATG
ATTATTGCTATTAATATTGAAATAATGCGGGAGTTCTAAAGTACTCAATCCTATTTGTCA
TAACTTTTGTCGTCCGGGGCGTGTACATAATAAATTTTATTGCAAGTGCCCTCGAGTAAG
GACTTTGAATTATCTATCCAAGGTTAGCCAAATAAATTTGCACATAATTGCCTTTGTTTA
GTCATGATTAGTCTGGTTGTTTTTATCTAAAACAAGCTTTAATTTGTGGTTTAAATTTGG
TTCTTGGCCCAAAAGTTTTGCTTGACTTGTTCGTCCGTCTTGGCTGCCTTATTTCTTATT
TATAACTTCCATTAAGAGTTTATTTTATAACCCACACACCTTTTCCATTTTCACACCTTC
ATCATCATAAAATGCATACGCACACACACGCACAAAGAAATGCCACAGTGGAACAACGTA
TCAATGGCACGCCAAAAGCCCATAATCCTACTTCGGTTGGCTTTTAGCGGATTAAAACTT
TTCAGTTGAGTGCCTAGAACGGATCCCGGACCAAGACTGCTCCGTTGCGCCCCTTCTTGG
CATAAGAATTCTGATTGTGTTATTAACTAGCTTAAATGGGTGTTAATTTCCAGGCGGTGG
ACAGTGCGTATCAAATGATTAACGAGACAGAATACAATTCAATCGGGAAAAAGTGATTTG
CCAACAAATTGGAAATTTTTGAAATCGTCGGATTTAAAAATATTTTTTGACACTTGCGAC
ATTTGTGTGAAAACCAAGCTTAATTGCTTTCCCGTGGTTTTATAGTGCCGTTACGCGCTG
TACTATCAACGTATATGGCCTGTGGCAGCTCATTTGTTGCTTGTTTGGCTATTTCAATTA
AATGTTAATAAAATTGTCCAACCGAAAGAACTTATTTCGGTACCAAATGCTGGGTGGTGG
AAAAGAGAGGGAACGACCAGAGAAAAATGGAAAATTAGGGGAAAATGCGGTGACTGCATG
GCCTCCAAATTGGCTAACTTAAGTACCGTTTCGTTCTAGTTTGGCATTTCCTTTTTCTTT
AGCCGTCTACCAGGGGTTTCCCTTTTTGCAGGGAAAAACTTTATGGAGCGCTTACATTTC
CGTAGCCATTAATTCTACCTTGCTTTTCAATTAGTGTTGCCGTTTGCCTTTGGACCGCTT
TCCTTTGCCCGTTTTGTCTTTTATCGCTTCCCGTCTCCCGTACTCCTTGTCCCTCAATCC
TCTGCCTTCACTCTCTTCGTGTCTATATATGTATGTATATCCTGATTTATGCCGTCGTCC
TGCAGGATTTTCTTTGCACCCCCACATCCGTTGCTGGCCAGATGGCTTGAGGTGACTGCA
GCGGGCTTATCTATCGCCAGCTTCACTCTTTCCCCGGTTTTCCTGACCCCCTTCCTCCCC
TCTTGCTCCTTCTTAACTAACTCGTCTTCATTTCTCACTTGGCTGCGTATTTGCTAGGTG
TTTGCATGGTTATATATCTATGGATGTCGGTGCCGTCCATGGGTTTGTTAGTATTAGCCA
TGTTGGCCATGTCTATTGGCCAGAAGGTGTCGTCCTGATAAATTGCCAAGCAAACAGGGT
TGGCAGGTGGTCTGTATCGGTCAGAAAAGAATACTAGCTATTACTTTAAGTTATTTTGTC
CAAAGCGGTTTCCATGCTATTTTCCCCAAAAGAGTTTTCTTATATTCCATACAAATAGTT
TTTTTTCTTTTTTGTTATTGTATGCATATTGGAATTCCTTAAATAGTACTTGATGAAAGA
CTCCGACTTGTAATTGTAGAATATTAGTTAGTTCATGAACTGACACCCTGACAACCCTGT
CAGTTTAGCATATTCCCGACTATGCAAATGGCAAATCGCTGGCATTTCAAACACGCTAGC
ACCTGCTGGAAGGCTTAACCAAACAAGCCAGTTGCCACGCCCATCGGGGCTTAGACTCCA
AACCCTTTGCCATGCCCCCCGCCACCTCCCGTCCCATTTCGCCCATTCGCTAGGACTCGC
TTCTGCCTTCTATCAGTGTCGTTTGTTATTTATCCTGCGTGCCTCTTGACGCCTTTGGGG
CATGCCACTTAACACACATCGGCCATCGCCGCACCTGCCACGCCCCTTTGTCAGTGGGGC
GGGAGGGTTGAAAAGGGGCGGGAGGGTAGGTGGAGTTGCTGTAATCTTTTCTTGAGATTT
GCGTGCAATGCGTCGCGTTATTTGCTTTTCATTCCTTTTTTTCGCTTGTGTTGCTTTGCT
TTCTGCTTTTTTAATTTATCATGTCTATTTGCTTAGTGTTTGAGCCTGGCCCTTGGCGTG
TAGTACAAGCACGGAGTCCTTTTTCCCATTTTTTTTTTTTTCTAGCTGCGAGTCCTTGCT
CCTTCTCGTGTTCATTTGTTATCACTGTTTGTCTGTGTGTTGCTCCTGCAGCTTTTCACT
TTTGAATGCGGCGAAGGATTCACTTTTAGCTCCTTTGCTTTTTTCTCGGTTTTTCCGCTC
AGTCGATTGGTTTTTCTTTTAAATGAAAGTTTTGCCCGGCTTTTCGGATTTGGTTTACAC
CATTTTCTCCCTCTGTTCCCCTTTTGGTGTTACCCATACCCCGCAATTTATCCTTTTTCA
TCGTGTAACCGCCTTGCGGTCAGATTTTGCTGCTGCAGCTAGTTTGTTTAGGTTTCAGCA
CTAATTGAAAATCATTGAATGAGGTTTTCTCATCAGCATGTGTCTGGGTAATTTGTTTTC
TTTTAATTAATTTATGGTGAGTTTTATTAGCGAAAGATGCGGTTACAGCTGGCAAATTGA
AAACTCAATTATTCAACTAGCCAAACACTGATTTCGATTTTGAAATGGTTTCGAAACAGA
TTTATATTTTGATCAAAAGTACTTCGGAGTGTGTGTGGATTGATTAAAAAATGACATTTA
AAGGTCGTGTAACTGGAGGAATATTTCTTCAAAGGACTATTTATCTGTGCCAACTGAAAA
CTCACTTTCTAAACAAACCACGAACAACAATGCAAACAAATGATGGCAAAAACCAGATAG
AAATTCAGCTCAAGACACTGCTTGCCACAAATTAAATCAAATTCCTCGTAAGACAGTGGG
GCAGATAAAGACCGAGGAAACCGAGGAAGATTCATCAGCCACACACTCAAAGCCACAGTT
GGCAAACAACAAACGCTGGGCTCGTGACAGTGACAGGACATCTTATTTAATTTCCAAGGC
TCAGGACCTGATTCCGCATCAGAGAACTGGAAACCGAGCATAACATTAATTTTTGTTAAT
CTATTTTCAAGTTGCTCTGGTCAGCAGCAGCACCAGCTGTGTTCCCCTTTTCTTCGGTTT
GGGCCGCAAGTAAATATGCTGTCATTAATTTAAAACTTACACAAACAACCCGAAAACTTC
TCTGCTGTCTGTCGGCCTTCTGTTGGCAAGGAATCCTTCCAGAGTTATGTTCATTAGCAG
GCAAATGCAGGACGAGGCGCAGGGGGAGGCGGCCAGAATTTAGTCGGAATTCCTAATGAG
CAAGAGCAGCAAATCTAACCCAAATATGTCAAGACGATGGCTGGCATTTTGTGTAGCCTG
CGCTGCTGCAGGGTGCAATGCTCCAAGAGGGTCAGCAGGTGGATCTACACAGGGGAAAAA
GGCTTGTTAGTTTCCAATAATTTATATAAATACAAACAGAGCAAAGAAAATCTTGACAGT
ATCAGTTAGATCTCTGAAAAATAAGAGTTTCTTTTAGGATCTGTTTTTGAACTGAGTTCT
ATGTATTACTTAACTGATATGCTGCAAAACGGACACCACTTTTCTCTCGGTGTCCACATG
TGTGTGCAAAGTGGGTCTCTTCAGTTTGCTATGCATGTGCTAAAGTGTTGATACAAGTTA
CTTTTGCCATCCGCACCTCATTCCCGTCAACCCTTCGCTGTCCTAGCACACTGACACACT
ATCCATGTGAAGAAGTCCTGGCTTTCTCCGTACCTTTGCCCCCACAGCTAGTCATAAACC
ACAAAGCCGGAGAGACGGTGAATCCCAGGACCCCGAGCTCAGACAGCTGAGCACGTAGCA
TGACGAGTTGACAAAGTGCATCATGGTGCAGCAGCTCCTCTTCTCAGTGTTTACACAGCT
CGAAAAATGCCCCACCTTGTTTGCTCTCATTTCGGAAATATTTCGCACATTAGCAAATTA
ATGTACACAAGATTAGCAAATGCAGGTCTCTTGGTGTTTTTGATAAGGGGAATTCATGTC
AGGTTGGTTCTTAAGAAAATAATAATTGTTAAATTGCCGTTTGATTTTCATTGATTGGAA
TTTGTAGACGAATGTTTGTTGACATGAGTGTTTGTTTGCCTTTCGGTCAGCCAATGTTTA
CTGAACTTCACTAATTTGTGATAGGTAATCCAAAATTGATTAAAATAATGCAAGCTTGAA
ATGAAGTGCCACTCACTATTTACTTTTCATTCATTGGATTAAATATTATTGGATCAAACA
TATTTGATAACTTGATTGACATAACAAAAATATAACTATTTAATTTTGATTTGAATTGAA
TTACTACTGAATTTCTGTAATCTTTCGTAACCCTACGTTGGTCAGAACATTGGAAATTTC
GGCCAGTGCAAATACAGTCACCACGAAAATTAATCTTCCCACTCGACACATGTAACTCAC
TGTACCCGTCTCACTCCTTCATCGCGTCGTCTCGCTTTATCTCCATATTCATATGTGCAT
TTTGTTACATGTTCGCGCGTATTTCCCTTATGGCTTGTTTTGCCCGTCCTTTCCGCTTTC
CCGGCCATTTTCCCTTCGGCCGCATTCATTTGCTGGTTTTTCTTATTTTAGCTCGAATTT
GTGTGTTATAATTTATGCGCATTTTTATTAAATATTTATGTTTGTGCCGAGTTCTAAGCC
ACACAACCGCACTCCCCCTTTGCCGGGTATCATTTCCCTTAATGGTGTATTTACGCTCTA
AAGCGTGTAAATGCTTTCCATTCCATTGTTTTCCCTGCTGTTGACACTTCGGAGACGGCA
AGCGAGTGGTGGTTGGAAAAGGGTCAGGGGTCACTCCCTTGCACGCACACATTGTCATAA
ATAGTTTTGTTCAAAGAGACCGCAGCAACTAACATTTAAGTTTTCAAACATTTCAGTGTG
CAAATTCTTGGTCAACTTGGTGAAAATTCACTTGGAAATTTGCTTTCCCTGCAATGTTTC
TGGCTCTAGTTGTTCTGGTTGATATTTGACTTGGCTAATGCGAATGCTAAATGAAAATTT
GCATTCGTACAATGCAAATCCTCTGGCATTGGTATTGAACAAATTGCTAGGTTATTATAT
TCATGTAAAATGTATTACCGGCTCGAGTTCTTGTCGATGCTATTTGCATAATATATTCCC
CATTTATTCAATGATATTATTTGTGGGATAACATGTTGAAATGGGAGAATGTTAATATTG
TCTATGGAAATGAAATGGGACATCAAATCTCAAATGAAATATTGCTTACACTTTCCACAA
GAATAGTTACAAATACCAGATATAATACTATAATATAAATGAACAAGCAAAATGTAACAA
TAAAACAATAAAAATAGCCACAAAAGCATAATTTACATTCATAAGAGTACGAAAATTAAA
CAAGCTCTTTTGAATGCAATGTGTTAATAATACATTTTCCGTCCGTGTCCAGTATATTTA
AAGTGAATATTCACTAATTGCACCTTGTAGTGCAATTAAATTGAATGTCAAAAAAGCGAA
TATAAATACAGCCGTCTGAATGATTGATTGATTGATTGACTGATGGTTTGATTGGCTAAC
GAACAGTTCATAGCCGGGCCAAAAGGAACGAATGCGCCATGACCACGACAATAACGGCCA
AGATTGCGCAACGGCAACAGCAACATCAACAGCATCAACAGCAGCAACTGCAGCATCAGC
AGCAGCAACAGCAACAGCAGCAGCATCAGCCAACGAGCAGTATGAATGGTTTTCGAATTA
CCGGCTATCCTGCAGCTGCCACGCCCCCCGCCCGAAGCAACCCCATATACGCGAAGCCCA
ACGCCCACGAACTGGACCTGCACATCAGCGAATCGCTATTGTATCCAGGTAGCACCACGC
AACAGCAACAGGCCCTGCAAAGCTCTCCCGGTCCGCCGCCCCAATTGACCAGCATGTTGC
CCAGTTCCGGATTGCCAGGAGCTGCCCAGCCGATCGCACTGAAGGGCAATAATCCCTTCC
TCAATAGTCCGTCGCCCACAGAGGCAGCGCCCGGTGTGCCAACAGGCCTATCAAGTGCTC
AGCCAGCCACATCTGCAAGTTCTGGCAATTATGAAATGCCCGAGTATGCGGAACCATCGC
GATTGCGCGGATTGAAGCAACGTCCTCACAGCATCGCAGTGGGCGGTTCGCCCGCCCAGT
CCAGTTTTGTGGACTACAATGCCCAGCAGCAGCAGCGATTATTGCAGCTATCCCGCCAGC
AGCAACAGTTGCGTAATGCCGTTACAGCGGCCGCATCAACAGCCAATGGCGGTGACAAGG
AGACCCTGTATGCGGCACTATTCCAGCAGTATAGACAAAGTCCCACAAATGGTCAGCCTG
CGCCACCGGTACCACTGCACCGCAAACCGGCAGCAGCTCCAGTGGTGCCACGGAGATCGC
AGAGCACGCCGCGGCCACCACTGCAGCAGCAACAACAGCAACAGCAGGCTGGCATAAATG
GCCAGATCAATGGTAATGGCAACCAGCGACCCAGAAGCTTGGATCGCTTCAATGGGGGTC
TGCAAAGCGAAGCACCACCCATACCGCTGAGGCGTTTCCCCAACGGAAATGGTAATAACA
ACAATGGAACACTAAGCCGCCAAAAGAGTCCCAAGAAAAGCAGCAGTGCGGACAATATGC
TAATGAGTCCGGCCGGAAGTCAAGTGAACACCATGCGACACTCCATCAGCTTTCATGGCG
GTCAGGAGACGGAGAATGGTAGCAAAGCTGAGCAAACCAGACCCATGAGTTATGCTGCAC
CTGCTCCGGACCAGGCGTACTTGGAGCACCAGCTGCGGGCCTATTCCGAGCAACTAAGAA
CCATAACAGAAAGTGTGCGCAAGTACTCGGAACAGGCCAAGTTACTTTCGGAGCTCAAAA
GACAACAGCAACTGGCCAAACAAAGTCAGACGAATCTCAACCTGCTAACGCCGACAACCT
GCAATAATAGTACGGGCAGCAACGGCAATAACAACTTTCAGCCAAATATGATTTCCCCGG
AGATTGTTAGCAAATCACTGGCTTCTCTCTCCACCAGCCAGGCCAATGAGGCCCAAACGC
CCTCCAATCAATTGCGACTTTTTCTGGACAACATCAGGAGTAGCATGCGACAGGAGTACC
AGCAACATATGCCCGATGATGTCCTGAAACCCACGTCAACCTTGAAAAGGAACGGTACCG
ATTCGTTGGTAACTTCCAATACAGCTGCCAAACCAGAAGTAGAGGCAACGCCCACGCCCT
CGGATCAGCTGAGACAATTCCTCGATGCAATACGCGCCAATAAAATACCTGAGAGTGTGG
ACAAGCCCAAGATGACAAGCTCGCAGACGCTGGACTCGTTCATCTCGAAACCGCTCCAGA
TGCCAGATGTTACGTCCGGAACGCCGGGTGGCGGAGTAGTGGGCGGACAGGCGGCGTCAG
GAGGAGTAGCGGTCAATGGTCAAACTAATGGCATACCCACACGTCGGAGACCCAAAAGCA
GCATAATACCCAGCAGCAGTAATGGCAAACTGGAGCAAAGGGAACACTCTCTGGTCACCT
CGGAAAGTTTCCATCAAATCTCCGACAATCTAAGGCTCATGAGCGAGGACTTGCAGGCCC
TGAGTCCCAGCAAAGCGATTCCCAGCTCCGCCAGCAGCAATAGCCTCAAGAGTCTAGCTG
CCAACGGCGGCAGTTCGCTGACCACGGAACTCCGGGTCATAACCAGCTCGCCATACAGCA
CCTCCCCCAAACTGCAGCAGATGGTGATGAGCAAGTCGAACAGTTCACTAGGTTCCGTGA
CCACGCCCTCGAGTGCCACCACCACGCCCTCCACTGCGCCCATGATCACCGACTTCAATG
AGATATTGGATAGCTTTCAGGCCATGGCCGACAAGTACAAATCGAAAGGTTCCTACGACT
ATCTGCGCAAGTGCTCGGAGGCCCTGCGTCAGCATTCGCTGCAACTGAAGTTGCAGCAGC
AACACCAGGCGCATCAGCAGCAGCAACTGCCTGCCCATCAGCAGCAGCAGCATCAGCAGC
AGCAGCAACAACAGATTCAGAATGGTTTCGCTAGCGATGATAACAGCAGCTCCTGCAGCA
CAACTCCCGGTAGCATCCGCGAGGCGGTCCAGAACCTGCTCCTGCAGCCGCGAAACGGTT
TCCAGATCCTCGACGATCGCATGCGGCTGTTTATCGATATTATTGACAGCCAGGATCGAT
TGAGTCAGGTGGGTTTGATGGTACTAATTGAATACTATTCTTTTTTAGCATTTCCCATTA
GAAATAAAGTCGTTCTTACCAGTTTATGAACAAATTTAAATATGATTAAATGTACTTTAA
ATGTTTCAGTTGTTTGATTTGCTGGTTCTTAAGCTCAGAATCTCTTCAAACATAGAGCGC
ATATCACAAATCAAATATAATTATTATAAACCCTATGTCAGCAGCAGGCGTAATTAGTTT
TCATACCCCCATTTGCCGTTATGTACGTATGTATTGCTAATTTAAATCCTTATTTCTCTT
GCAGGTATGTACACCCTCTTCCGTAAAATTGCAATTTAATGAGTAAGTCAAGCATGCTGG
CGAATAAATTTAAGAATGGACCACATCCCCCACCCCGCACAACCATAAAAGCACATGTAC
ATCAGATACGATTTTATTGCCTTACATAATTCATCATCATCGGAGTGACCAGGTCCGGGT
CACTGCGCTTATCTCCGGCTGGCCAAAAGTCTTTAGTGCACTCACTGTGTGTGGCTAAAA
GCCATCAAATCAGTTAATGACCCAGAAAGTTAAACTTGCAAGAGTGCGGGCGTGGATCAA
TTTCCATCAATTTTCACCAAATTTGCTCAGAGCCAATTAATTTTAATAAACTACAAAGTC
ATTTCGCTCAGCAAGTAAACTAATCTCGCCCAGGCCGAAATTGAAATTTTAATCGAGAAT
TTCTCGGTGGCACATAGAGGCCATATAGCTTGAAACACGCACACCAAAACCATGATGGCG
ATGCCAAAGTAATCAAGTGAGACGGGCCGGGGAAAACTGGCAAATGTGGATAATCAGAGG
GCATATCATCCTGCCGGTTGATATGCTAAATAAATCAAATCCCAAGCGAGGCTGAGGCGA
AATTGTCTGTCGTCGTCTTAATAACACCTTTTCGGTCACACCAGGTTCAGGTCCTGGATT
TCGTGTCCTTCCGCTCGCATAAAACAATATTGCTAATGACAAATGGAAACTAGTTCTAAT
TGTGGGCTTTGTCGGGGCACGAAGATCTCGGTCCGGTCTTATCGCTCATTGCCTTTTCTG
GGGTTTGGGCCTGATTTAAATGTATGCGGTCTGCGTAGAGGGCTATGAATGTGAAGGGTT
CATGTGTGAACGTGTTTGAGTCCTTTGACTCCTTGGGGACGCATGAAGTGGCAAATTCGA
GTTTATATATCTGCTCGGATGAGTTTGCCGAACAAAGCTGGAAATGTGCCAAGCACAGTG
CGCTTAAGAACTGTGAATTGTGCCTTAAATCAATAATAACTGGAAATTTAACGTAGATTC
AATAATATTAGTAAACTACAATGTATTCGAGTACTGACGTTACGATTTTTATTGCAAACA
TATTTGTATAAGTGATGTTACTTGGTTACTTACTATTTAGTTAGCCTAAAGTTTTTTATT
TATTCAACCTGTATTTCAATATTTTCTACATCTCTAAACAAGATTCGCTTACTTCATTTT
TGCCAATTTGCGAAAGATATTCCTCCAGCACAACATGAAACGAAGTGGCCAATTAAAAAT
GAATGCAAATGTTGTGTTCTCTGCCAAATTCCAGAAGGGAATAAATTGCCATTTATTTGA
GACAATTTCTGGGGCAAACAGTTTTACCAGCCTGAGGCTGGACTGTTTATTTCATTTAGC
CAATTGCCTGAGTATTTGTATTTTTTTCCAACAAAACAACACCAAATGCAAACAATAAAA
GTTTAATGCTATCCATGCCGAAAAGTATGCTACTCATAATGCAATTGCAAACAATTACGC
TGAACTGAAGTAATTGCATTTCCACTGCACAACCATTCGCAATTTACAATTTGCATTACA
AAGTAATTATTTCCGCAACAGTGCGCCCACATTTTTCACCATTTTCGCCAAACACTTTTG
CAAAATTTCCACCACGTTGTTTAGCAAATGAAGTGCAAAATCAACGCGACGTCCACAGGA
ACCACAAGCATTTTGGTTATTCGACTATTGACAGCATGGCCGAATGACATTTATTTTAAT
TAGCTCCGCAAACAACAAAAGCGGACGGCCAACAGCGCTACGGGTATTATTATAGACCAG
AAGGATTGCCGCGCCAGGACCCAGAATTCACTTTTAGCCTCCGAGCAATTAACAAATGCA
ATTTTGCGGCCTTTAATGTTCATTGTGTGCTTGTGTTTGTGTCTGTTGTGCGCTGCGTGT
AAGTGTGAGTGTGTGCGCTGTTTGCGGAGGCGTGAAAACCCAAAAAATAACTTTTTAATT
ACTATAGCGGACATTGCGGTTAATTACACTGCGCAACATGGTTGGCGATAAGCCAATTTG
TATGGATTCAAAATGGAATAGCGTCGATTGAATAAAACAGAAACCAACAGAAAGGGCAAC
AAAAAGTTGTTGTTTTCAGTTTTAATAATTGTCAGTTACAGTTGGTTAAGTAGATTATAA
CAATTCCGTATCGTATCGGATCGTTTAAATAACATTTTTTGTTGTTTTTAGCGAGTGAAA
TCAAAAACATTGCCCATATATATCAAATATTTTTTTATATTTTCCCATTAATGTTTTGAT
TTACTGCCAATTCAACGTTGATTGACCTGCGGGAAGAGTGCTTTTTTCACTATTTGATTA
AAAACCGCAATAGGAACCAGCAAAGTGCGTGCTTAAAATAATTGCAATTGTGCAGTGCTG
AAATCCCGGGACTCAGATGACAAAGTGGGTGGTTGGGTTGGGTTGGAGTAATGGTGGAAT
TGCCATTGTCAACAGCTTTCAATTGGAGGCTCAACGCCGTGGTTGTCGCAGAGCCACGCC
CACTGCACGGCGCGACGCCCCCTTGACCATGTCGCTTATTAATTGCGTGTCATAAATCAT
GATTATGCCACTTGCTGACCAACCGCTGGGCTAGTCGCAGTTATTATTATTAATCTTTGT
CGCCCACACAAACAGGCACTTATACACACACCTACGACATTCCCAGGAGAGGGGAGTGGC
GATCTAGGGGAAGAGAGAGAGAGAGAGAGGGAAATAGACCGGTGGGAGGGTGAAAGGGAG
TTTGAGTAGAGCAAGCCATATGTTGGTTCCATGTAAATGGCGATGTTCATTCCGCCGACC
AGCCTATCTTGATTAATTGCAAAAGTTTACCAGGACACAGGTCCTGGACAGGGACACTGG
ACCACCGACCCATGGACCCATGGAAATATGTCAGCTGCTTCCCTTTTTTGGTTGCCCAAC
AACAAGAAAAATACAGGCCAACAAAAAGCGGGCAACAAAAGTCCGGTAACAAGCGTCATA
ACACGCGTATGTTGTCGCGTAAATTGGTTTTAATATTTAAAGCACTTCATTACTTACGGT
CGAAAAGGGACGGCCAAATGCAGTCAAAGGAAGAGGGAAAGAGCGAGGCAGAAGGGAGCA
AGAGAGACAGTAACAACGTAGAGCCGCCGAAAAGCGGGCGGCTTAATCAAGTGAAATTGA
ATCAACTTTTTCAGTCTCCGGAGACAACTGCAAATTAAATTTTAAAAATTTCACCAATTT
CATCCTAATTGATTTCGAGCAAGGTGACAAAAGTTGAAAATTTCATTGAACGATAAAAAT
TTAAGTTTAATCTAAAATAAGAACATTTGTTGAAGATATAACATTAAATCAATATAGCTA
TAAACAATTTGAAATCAGAACTTGTTTTTGGTGGTAGTTTTTCGTTAGTAAAGGTTACAG
AATTTTAATGCTTTCATAACAAATTACAATGTAAGCTAAAAATGCGTATTGCTGCCACAT
TTCCTTCTTCCAAATGGCTTTCAAATATTGTAAGTTCAATGGTTTTACTAAGATTAACTT
CATCCTCGATTGAAAGAGAAGAGGAACGATCAGAAGAGCAGGGCAAAGTTTGCCATAGAG
TAAACAATTTTATTTTTGTCTACCCCTTTTTTTTAGTACTTTGTTTTCCACAGCGAGGAG
ATATAAGCCGACAGGAGACGAAACGAGACTGTTTGCATACTTTCAGGCGCCTCTGACAGG
GCGTCATATGCAATACACAACTAAGTGCATATGCGTAGCTACCATCTCTTCCATCTTTCT
GTCCCTCTCACACTTCGTCCTCTATCTCCATCTCTTTTCTTGTTATGAGAGCTGCAGGCA
ATCGAAGGCAGATCCTTGTCTTTCCATTTTTTCCCTGCTGATTTTTGACATATTTTCTCT
GGCAGCAGCAGCATCGCCGGCAAACAAACTAACAAACTTCGGGGCGTTTTTCAGGTGCAA
CTGGGTTAACATGGCTGCGATGGAAATTGCTGCAAAGAAATGTGAGCGTCGAAGGGCGTA
GTAAGGGCGAGTGCTATGCAAATGGCGTCGGAAAATTGATACAACAAAAGGTAGAGGGGA
GGGGTGGCGAAAAAAAAAATCTGAAAAACTGTTCGCAGTAAACGAAATGCATTCGCCGTT
TTTGCAATTTGTTCAGACGCCACCAACTCGATTTTTGAGCATATGCAACAGCTCAATTTT
GTATTGAATGGCCCAGAACTTGCCTCAAAATCAGCAGATTTTTCCACTTTTTTGCCCGTC
ATATTGTTTGTTTGAATGGCAGCTTCATTAATGCGAATATTCAGCCGACTGACAATGGAA
TTCGAGATCAAATTTTGCCCATTTAATACTACTGTATGTTACTTCGTTGGCTCTCCTGTG
TGGTTGATGAAATCAAATTGCAAGCAATTACTTTAATGTTACCACTACCACGCCCCCGCC
ATCGGGCCCGCCCACAATTTTAAAAGTGCAAAAGACCGCAACTCGTTTGCGGTTTTCGCG
TATTTTGCGTATTTGAATGGCACCGCCATTAACTGCGGTGAAAGGAGCTCACATATCTTG
ATATACAAAATAAATGTGCATGTGTGCGGCTGGGGAACGTTGAACGCATCGGTTTTGATT
GATTGCAATTGAATTCGAGAAGGGAAAAAACAAGATTCCGTTGGCATTCCTTTTGGGCAC
ACTCGGTCTCTCCTGGATGCCAGGATGTTAATGATATGTGCACGTGTGTCTGGCTCATAA
TTAAGAGAAATGTTCCCGGAAAATTAATGAAGTCCGAAATGGAAAACTGGTGCTGAGAGC
GAAATGTCCGTGGTAAAATGCCTTTAATAATATGTTATATTAATTAATATTGGGGCGCAT
ATTAAAGGGAAGGTAAAAATAAGTTCTGTGTATGTTACAATATTATATCATTTCTAAAAA
ACTTTTATTTTAAATAACATTATATCCATAATATTATATCCACCAAACTTGCGAATAAGA
CATTGTGTGACACTTAATTCTGTTACCGCCTTTCATTCATCGTCTCAGAAAAAAACAACA
AGCTCCTGTTTTGCATGCAAATACACAACCACCCACCGCCTTTCACATGAGCGAAATAAA
ACCATATATTTTCCATGACTTGTTTTCGTTGCACATCTTAGCATCGATTACATTTTTGCC
AAATTGAATTGTGCATGGCAGTGCTGAACAAAAGGAAAATAACGAAAAGAAAATGGAAAA
TGGGTGCAAAAAGAAATTGCTTCCTTGCATGTTGTTTTCCAGCCAGTCACATGTGAACAG
AAAAGAGGAGGAGGGGCGGTGCGATGTCCTGAAAATTGGGTTGCCTGATGACAAGAGTTG
AATTCAATTGAACGAAAAACTTGCAAGAGAAGAGGAAGCACCATTTGCATCGATGTGCAA
TTTACGGCCTAAATGTCAATTTCACTTAAGGCCAACTTTCACTTGGGGGCTATGACAAGG
ATTCTATCTTTATCCTATTTTCGATCCGAGGCTTAGGACGCTTTAAGTTGGTGCATTGTT
GACACTTTAAGTATTATTAGTAGGCAATGGAAGCAAAGAAAGGAGCAGAGAGCAAGGCAA
ACAGAAGGAGAGGGAGAAAGAGAGAGAAAGAAAAACTTGACTTTTCCGAGTGCACTGCAT
CAAAGTCAAAATGGCGGTCGAGTGTGTTTGTGGAGGAAGTGAGACAAATACCGCCATAAT
TCCTGCCTAAAGTGGCATTAGACATTTAATATAGCTTCAAGAATATTAGTATATTACTTA
AGCAATATTTTCGAATGACTACATTTGCTTTTCAAATAACAATACATCATTAAATAACAG
TATGTGTTTAAACAATCTTACTTTGTCAATTTAAGCTCCGAGATTTTTCAGCAGCATGTC
ACGTTCGTTTTACGGAAGCTTGACTGTTAATCATTTTCAGTGCCTACTTTTAGGCTTTGG
TCGGGTTGGTAGAAGGTGCAGGCACAAGGATAATTGCAATCCCCGCTAATGCTGGCGAAT
GTGCTGTGGCTTTGTTTCAACAGCAACAACAATCGTCACTCAATTACTCTCAGAGCTTTG
ATGCATTTTCCTGGAAGCTAAGCGCTACAGCCCCACCCATCGCCGCCCACTGCCCATTTT
CCTTTGTCAATCTGTGTTGACATTTGTCAACGAACTGTTTTCAGCAGACGCGCTTTCGCC
TCTGTTTATTTTTTTGTTTCGGATTTATTGTGTTTAATGTGTTGAAAAGTCCCCTTATTT
ATGGCAACTGGATTTGGGGGCTAGCTGCTCCCAGTTTTCGTCGTTTCAGGGGCGCCAGCT
GCGGAATAGTTGTCACATAGTTTCCATGTGTTGTCATTGTCTTTGTGTCGTGCTCGATTG
TGTGGAAAATTGAAAAAGAAACAAACAAAAACAGAGCTGTGGCAAAAGGAGAAGGAAAAG
CTCGCCAAGTCTTTTGGTATTGGCTATACTGAGTTGTTGTTATGTGGAAAAAAAGAGGCA
TTCGATTTGCCAAACGGATATTAAAGGTAAACATTGAATTGATAGGGAAAACGGCAAGGT
TTGATTAAATGAAATCTCAGTGAATTGGCATACAAAGTATGAGATTCAGATCCCTGGTGC
CAAAAAATAGTTATAAAAGGTTTCATTTGCGTATGAATGAAATTATTTTCAGCTCCCTGT
CAAGTAACGTCATCCATTTTTCCGTCACCACAAATCTGCATTAAAATCGGTGCTCTTGGT
GAGTCTATTTTTGCATTTGATGTATATTTTTCTGATGGATTTCCGCCAACTCGAGTGAAA
TTTATGACAATTTTTTTTTTTATTATTATTTCGTTCGCTCTTCGGTTGCCAGCAAAATAA
AGTTTTATGACACGAAAAATGTTGCAACTAATATTTTAGACGCTGTATTGCTTTCAAGTT
TTCTCTTTTATGTTTTGTATGTGGCTGCCGCTGCTGCTTTCCGACAGAAAGCTAATAGTG
TTTGGCCATTTTTCAAACTGCTCCTGAGGATGGAGGATAACGGCCAGCACACACACACAT
ACATGCTCAGTAGAGTGGTGCTGTCGTTAACTCAAAGTTTGTTAAAAATTTTTATCAGCA
TGCCGAGGCAATGACATGGCCACATCACAAGGACGCGCATGAGGGAGCGGGTTTTCGAGA
TGGGAGTGGGGAGCTTTGAGTGTGGAGGATGTGGACACGGACACGGGCTGCCAGGATGCA
GGATGCAGGAGTTTGGGGTTGTGGAGCAGCAGGAGGTGAAACCGCTAGCCACAACATGAC
GACGACACTGACATGTGACCATACATACTAATAAAGCTTTAGTTGCTTGCTCAGAGCTGT
TGAAATTTTTTTAGCATTCTCTATCGTACTAATGAATTTCGTGGGGAATTTCAGTTAAGA
AATAGTTTGGTGATTGATGGCTTAAAAGTTTTCGGAATTCTGCAGTGAACTTTAAAGTTC
GACTGTATATAATAAAGACAGCTTGCAATTTTGAAAACTTTATCAGGTGCTAACCTCAGG
ACATCTATATTTTATGGGTGTTTCAATACAACAAGTTTTTAATTAAAGCATTTAAAATTT
ATTCCATTCCTTAGTGCGATATGCGTTTACTATCTTTTGCATAAATCGAAATTCGTTTTC
TTTTAATTTATGCCGTTCGTCTACTACGCTCTTCTTGCAAATTCATAGCGTATCGTGACT
TCGTTTATCGTGATCTGCGTAGCTTCATTTTCCCCATTTCCTTTTTGGACATTTTTTCGC
AGCAGTTTTTCATCGCCCCGAACAGGAGATGACAAAGTCCGTGCTGGCGAAGATTAGTAT
TCCAGCTATCCTGGCTTCTTTTCCATACATTTTTTTGGTCAGCGTGGCTGAGGGACGCCT
TCTGGTCGATCCCTGTTCGTGTTTCTGCCTTGAGAGCCATTTCCTTGGCTATTTCTGCAG
CATTAAAGTTGTGTGCTGTGTGTTGTATGTTGCATTTACGCTTCAGCTCCGCTTGACAGG
AAAAGAGACAGCAGCAACGACACAAACTGAGAGAGAGAGAGAGAGAAAGCAGACTTTTAG
TGGCACCATTATGAGATGAAGGACCCTTTCAGCTCTCGGAGCAAAGCTCAGTCAGTCAGG
CAACCGCTTTATGTGTAGAGTTCATTACTTTTATGTGATTATGTGTCATGTGTGCGCTCA
GCATGGTAGTGATGGTGTGCGGGTGTATGTGTGAGTGCGGTACATGTCAGTGTGTCATTG
GCATTATTAGTTTTTCCGTAGCACACTTTTCCGACGCCCCTCTTCAGCTGGCTTACATCT
GTGACAGTTGTGCGAAAAACTTGTCCCCAAATTAGTTGCAATTATTTATGGCCTTTGCTT
TTTGTGGCTTCGTTTTTTGTTCCACCGAACTAGGGTAGCTAATCAGTTGAAAGTTGATGA
TGGCATGTGGGTCGGGTTGAGTCAACTAATTTGTTTATTTTCTGTAGATCTGTATCACAG
ACAGAACAGAACACGAGTCCCTAACCCACTTTTGATATATGGCAAACAACCTTTAAAATT
GAATGCCAATGTGCTGGTATATGCAGCTTGAAAAAAATGCTACGAAAAATGTTGCACTTG
TACGAGACTTTCTGAACATTTGCCAAAAAGTCCGGACTGGTCCCTGTTCACAGGCAGCTG
GCCAGTAATGAGTTGCCAGCCAGCTTCCATTCATTATGGCCAGCTAACACATGGTTATAT
TACACATACGCAGTGTTGTACACCGAGAAACATGAGTTTTTCACAACGTCGAGGGGAGTG
GGGTGGGTACTCAAGGCAAGCTGATAGAAAAAAAAAAGAAATTGTAAAAGAGGGAATTTT
CATCGTTGTTCCATTGCCAACAACATGCAACATGGGAAATATGAACGAGGAGCGAACAGG
TTCCCCCTCGTAATACCCGGATGATTCCTTCTGCCCGACGTACGTAGTTAACTGTCTGCG
GATTCTGCTAACAAGACTCGTCAGTGATTTGAGTGCTGCATACGAGTTTGTTATGCGAGT
TGGAATTAGCATAGTTAGGATACAACGAGTTCCCTTCTGATTGCCAGCGAACCGCTCCTC
GTAATGATGTGCAACATGGTAACATCATGGTGGCAGTATGTCGAAACAAGATGGGAATGC
CAACCTTTGGCTGCTGCTGCGATTTCTCTGTGTAGTGTCGGCATCCATTAATATTAATAG
CTGTGAAATGGGGTCAAAGAGTCTCTTCCAATTATTCAGTGGCTGAGAGTGGATTGCGGC
GGGTGGTTAATTTAAAAATAGCTGAATAGCTGATAATTTTTACTGAATTATTGCATTTGA
ATTATATTCAGTGCAATTAGTTTTGAAAATTATTAGGATTTAATAAACATGGTTTATACT
GCTTTGGGAACTAAAATATTTTCGTTTTACTTGAAGCTTTAGAGTTTTGTTTACAACCTC
TCGATTTCCTTTTTTTATCCTTAAAATCTTTTCAATTTTTTGTCGACCTGCTTTCATCAA
GGCGATGTTTGCGCGTTAAACCCAAAACTGCACATTTTGTGGCCCACATTTTGTCTACTT
GAAATATCCCCTTCACATTTTCCATTTTTTGAAAGCAGTGCTACGGCTTCCATTTTCTTC
GGTTTGCCCAAAAATCATTAGCAGGCGACCGAAAATTCAGGTCAGCCGCTTAATGTGCCG
CATAAGTACCTATAAGTATGCAATGCACTTTCGCCCAGGTACGCCACACCTATAAAGTCG
TACACCTATACAGCATACACCCATACAGCCACAAATTCCACCCACACTGAGGCAATGGCC
ACGCACAGATTGCGGCAACAAAATCTGTACACTTTGGCTCCATTAAAGCAGCACGCACGA
AGAGGCCACGGCTGCCAGCCCGTGAGCATCCAACACAAAAGTGTGATGTCAGTGGCTCAC
TCATATAACCCACCGCTACCCACCGCCCAGCACCGCCCCCTTGCGGTATTTATTTAGCCT
ATAAAGCTTCAGTGGGTTACAGCCGTCTCGCACACCATCAAAGCGTTCATCCATAGGAGA
GCAACTGGGAAGACTGCGGAAAAAGGACTTTTTGTATACGCGGACTATAGGATACTGATT
ACTTAATTTTCTCAAACTTGCATGGTTACTCATCCTCACTTACCTTTCTTAAAATGCTGC
CAATTAAATAGATTTGAATGATTATTCCCCTTAAGTTATTTTGATTGGTTGATAATTAAT
GGTTTACTTTAACTCAATAGTTTTTTTTATTTGATTAAGAAAACCTTATACGAAAGTTTT
GATATTCGCTTTATTAGTCACTAAACCAAGACTGCCCGTCGCGCTGCACGTACCCTGTAT
GAAAAGCGGGGGCAAAATGAGTGGAAAGTGGAAAGTCGAGCGGAAAGTGACACACTAAAC
CAAAAGCAGAGCCTGCCGGCGCGGTTCATATGGCAGTTCAGCTCAGGCGGTTGCCGCTCT
GGTTGGACTCTGTTGACCTAAAAATCTCATTTGCCGCATGCCCATTTCTGCCATCACTTT
TGTTACCTTACTTTTGTCGCACCTCTTGGCGGTGGGCGGGGTTCTTTGTTTTGGGCTCTC
GGTTTCTGAAATTGCGCCCCCAGCTAACGAAAATAATAGGAGCACAACAGCAGAGATTCT
TTGATATATTTATATATATAAAAAACGCAAAAGAAAAATATATATTTTTTAGCTGATGAG
AAAAATTGCAAAGAGGAAGTGCTGGAAATGAAATTTGAGCCCGCAGCCTGACCTAGACGA
AGCCCAAAGACCATATGTTCTGCGCTCTCCATTTCCCCGTTCAGTTAATTTCCTGAACAT
GACGTGCTTCTTTTCTTTCCTGGCCTTCTCCTTTTTTGTTTTAGTTGTAAGACAAAATTC
TCGATTGGTAATCAAAGTCCTTGTCATAAACGAACAACTTCAACAAGCTTCAATATAATA
AAAGTAAACTTTTCATGCTCGTTGGGGGTCAGTGCTCTACAGTTTTTCCGGAGGCAAATA
GCAACCACAGACTGTTGATAAATATTTAATGGTCATGTTTGCCTAAGCAAGCTACTGTGT
AAACTTTGAATAATATTTTGTTTTCTCTTTTTCATTGCAGGTAAGCGTGTTATTTTAATT
AAATGTGCGTACAAAGTGCAGTAAGTAAATATATGGAAAAGGCAACTTTCAAATGAAAGC
TCGAAAAATATTTTCATTTTTTTTTTTTTAATTTAAATATATAGTATAAGGTGAAAAACA
AGTAGTCTTTAAGATGATTAATTAAAGGTTTTAGTATTTCCCCCAAAAGAAGTCAAGGAA
TATTAAAAGCTATTTTGGCATTTTTACATAGGTTCCTTACCATCGCCGCTTCAATTCACA
AGTTGCCATCCACTAATTGAATTTAAATCGAATTTAATGTCGTTTCACAAAAATTGTTGG
CCAGTTGGCACTGATTTGGTTCCAATTCCATTGGCTTTTCTGTCCTCTGCCATTTCGGGA
TGTCAATCTAATAAAGTGCAAGTGAAAGCGGTGGAAATGCTGCTCAGTTCTTTGCTGTCA
CTTAATAATTCAATCCCAGAATGTAGGCAACGTTTGGTAACCCTCAATGCCAGACAGATT
TTATTATTTTTCCTTTTTTCTTCCCTCTCTCTCTCTTTTTAATTTTTTCGTTTTACGTCT
TTTGTTGTCGGTGGAAATGTCACATGCAAATCCAAATAAGCGAAGCAGCAAGGAAAAACG
ATGAAAATTGTGTTAGTCTCGCAACAGAGCTGACAAAATGATAGATGGAAGCCGCGTCAA
AATGCCGAAAAAGGAAAAACTGGCAATCGAGGGGCGGAAAAATTAGCGTGCGGCCTTAAA
AAAGCTTCAAAAGCAATCAAAATGACAACTTAAGTAGGCTTCCCAACAACACGAAACGAA
GGAAAGCCACGAAGGGAAAGTGAAAAGAAAGAACTTAAGTTTAAATAAGAGTAAAAGCGA
AAAGAGGAAAACTCTCCTCTTAGGGTTAGATGGGAATCTTGAGAAATGTGGGCTCAATTA
GGGCATAATTGTTTGTTTTCTCACTCGGCTGACTGGCTGGCTGGCTGGCTAGCTGCTAAT
TGAAGCATCAAAAGTTTTTTTATTGGCTCCCGCCAAGTGTGAAAGGGCAATGATGTAATT
CAATTCGACTTTGCCTCGTGCCCCAAATGAAAATTGATGTTGGCTAAGCAATTATGAAAA
TGTTGGCTGCCTAAGGAACAGCTCCGCTGCGTCAAAGTTCTCCCAAATCGTGCGTAAAAT
TGTTAAACTTTACTGCACAAGCCGAAGAAGACTTGGCGAGGAAAAATGTGTGGTCTCTGA
GCCAGAACAGATTTCCATGCGGTTGTCTTTTCGGCCTGGCTGAGAGCATCAGTTTGTGTG
GGACCCAAATGCGCATTTAACTTAATCAAGATTTTAATATTTAAAGAATTTTCAGACCGG
CAACAAATTTGCTAACACACACACACACCACACATTTGCCATTTTATCTCTTATCACTCT
GAAGACCTTTTCCAACTGTTTTGTGCTGGCTGGCGAAAAAGGGTTCTTCGTTCTCTGTTC
TTGCTACCGAAAGAGGAAACTATTCTGGCAACGACAAACAACATTATCTCTCTTACATGA
TGCTTGCCACACTTCAATTGCTTGTAAATGCCACACAATAGATACAGCCCACTCCACCTA
CACCCCCTCGTCCACCCACTCCACTTGATAAATTCCCGGCCAAGTTGTTGTTGAGCAAAG
TTTACTGGTAGTTTTCCCTTTCCGGCTTTTGGCTGTCGACTTGATTTAGTTATATGTGTT
GCACATTTATTTATTTCGACAGGTTTTCTTTGCGAAATTCAATACCCAAAATGACAGCTG
CTTGTGGCTAAATGTTTTGCAAATCCTATAGAAATTGGCAAAACAAGTTTTGTAAATATT
TAAAAAGAGGTCAAGGTAATATCACGAATTTTAATTCTGGGCAGAGAGATCATGGCTGTG
ATTTAAAATAAGTTATTCCCATCTTACAAGAACATTTTGCTATGGAAGCACATTATGTTT
TCTTAATATATACGAGTATATGCCTTAATTCTCTAATTGCAACGTGGAATAATGAAAATT
ATATGCTTATCTCTGGGCTTACGGGACCGAAACCCAACTGTTAGGAGATACCACAGCTGT
AAAACATTTAACCAACTTTCGTAATGGACTGTGGTCCATAAAAACTTTGACTATAAACTA
TATGGTGCGACTTCTTATAGCCAGCACTCGGCAATAATTCAGTGGTTTCAACTGCTTACG
CTTTTCACGACCCTAAATCATATTTAAAGGCGATTAAATAGGGCGACGAGTGCAAGACAC
ATAAATTATGAAGACGAAGGGCGGCCTGAGTCGAGAGGTGTTGGACCAAATCTCACACAC
GACAGACAATTGGGCTTGTGTGGGAGGAGAGGAAATCCAGCAATCCACACACAGATACAC
CATGTATCTGCTGCCAACAATGACAAATTACCCAAAGCACAAAAATGAATGAGCGGAGAA
TCACGCAACACGCAGACAGACGCGCAGAAAGTATCTTGCAGATACAACATGTTGTTAACA
GCGACAATAACAAGTTATGAGGCAGCAACAGACTCGCTGCATAACAATAAACAGCAAGTT
GGTGAAATTTATTTCACAAAACTATTGTGCAAATAATGAAGCGCCTCGGGTGCCCAAGAT
TCTGGGCGGAGCGCTCTTCACTAGATGTAAAAGTTATAACTTATAAGCATAATTCTCGCA
AAAGATGGGAGTGTGCGAGCAGCAGCCACAACACATGTTGGCATGTTGATTGTCGCGTAT
GCTTCGCAGTCTGCTTTTGGCCGGATTATCCCCCCCACAATGCACATGTCCCCCAAAAGT
ATTTGCGAACTAGATTTTTGACTTAGCATTGCGGAGTTTATGTATATCTTAGCTAGGCAT
GTCTCGATTTGATCCGCTTTTCGTGGCGCTGGAAAAGTAGTGGCAGTCAGTAAAGGCAGT
CAGAAAGTTTGTCAAGGCTTTGGTGTGGCAAATCCCAGCGACCTTTCCCTAACCGCATCA
CATTAAGCTCGTGGTCTTGTCGACTTCATCTGGCAGAAGCTTAACTTTGATTTCAGACAC
TCTTCCCTGGCGGGTAAGCGAGCAACTAGCCCACTTAAATGCGCGTTAGGGCGGTGACAA
GATTTCAGGCACAAAGTGTTGGCAAAGAATAGATAGACGGGTGTTGCTGCTTTACGGAAA
AAGTTAATAGAAGTTCAAAGGAAATTTCCCAAGTTATAGTCTAAGCCATTCATTTGCCAT
TAATCTTATAATGGGGAAAAACTGAAGGCTTCTCACCATTCTTTGAATATTACAAATAAA
GCTAACTCCTACTAATTGATTTAAAATGCTTTACATTTAACCGAAGCATTTTAACTTAGC
CCACAAGTGTGCTTAAAATTGTACAATTATCCATTCCTTGGTTAAATTGGTAATTGACTG
TTGAACAAATTTTGAGAGGGCTTAAAAATCTAGGAAATGAGCAAAGTTTCCATTCGCAGC
TGATGACGCTTACCGTCAACTTGTTGTTTTCTGCTGTTGATGATAGCGTGGGGAAACGTA
AGTGATTAAACTTCAAGTACCTGCGGTCTCTCTCTTTGGCTAAAATCATTTTCAAATAAA
TAAAACTAAACTTGGCCACCTTGCCGAGAAAAGTTATCAGCCAAGAGGAAAGGCAAAAAC
TCTTATTAGCCGTAGAGAGAAAAGAGCAAAGTGGCAGGACAAGTAGACAGGCAATTGCGA
TATAAATAGTCAGTTGGAGCAGCTGCTGGAGTCCTGGGGGAATTGGTCGGGGGGATCCGG
TGCAGAGATGCAGTTGACAAACTAGAAGGGGACTAAAGTTTTTCTTAGATTTGTGTTCGT
TGCTTATGTTTTGTGGAGCAAAAAACGAAGCCACACCACTTGGGGAAAGCAACTTTATCG
CTTAGTGAAAACCCGAGAAATATAAATTTTGCCTTCGATGCCGAAAACAGCAAGTAGGCC
AAATAGAATCAAAGGAAGTCTGGCCATTTTCGCAATTTGTTTATTGTTTTTTATTAACAT
AATTGATTGCTCGATTTGTGCGGCTGTGGAAAACTCTTACGATTATTGGGGAAGTTCCTT
TAGCTGCAGCATCTGAGACATTTTTTCCCCTCTGGCCCAAAATGGGAAATCAGTAAGGAA
TCAGGAGCACGCCATTACACTTCCGCCTCCTTGGAATTAACTTAGCTGCTTATCCTTTAT
CCTTGGCTGAGCCATCTGGGTTTTCCTCCTCCAACTTTTACTTGATTGATGACGCTCATT
TGTGCTACGTGTGTTCGGCTGTGTCTCCCTCTTCATCCAGGTTTGTGCCGAATAATTCTG
CTTAATTTTAAATCAGTTTGCAATTTGCTGCGAAAACTTTTCTATACCGCCTGCCCTCCT
CGTGCGGTTGAATTTGGTTTATTGCCTCGGTGCGTGTTGCATACTTTTTGCGATGCCTGT
CGGAAATGTTTCTCATTCCAGTAGCCGTTGTGTTCGCTTCTTTATAATGCTTAAGCACAC
TCACGGGTAAAGTTAACCGCAAGTTACCAACTTTATTAATGTGCGTATATGCCCGTTCAT
GGGCCTCTTTTTCGCTTATTTTTTATGGACTGTCTGTGTTTCGGCTTTGTTCGGCGTTAT
TGCCTTTCCAGTTTATTGTTTACTTTTCGGAAGTGTGCTACTTTTTATACTTGTTTATTT
ACTTGGGCCAAAAAGTTGACAGAGGTACGCATTTTGTCACTGATTTATTTTCATTATGTT
AGGGGAGGGCTGGAATCTTGGCTTTTTAATTTGTATATTTGTGGTATGTTAATACTTTAA
ACGTGCTACATTCCTTATTATATAAACCTAATCTAAATGAACTCGAAAGCTAAAGGATTG
TTTTGAATTTCAAATCGTACCCATTAGGCTTAGAGAGCAAGCAAAACTGAATCTTTGGTA
AAATATTTGTCGAGCCATTGTCGTCACTTTGCTCAACGTGGTTCAACACACACTTTTGCT
TTTTTATCGTACCCCCTTTCTCGCTCTTGACACCAAATGCCAGCTACAATAACATATTTT
TTCAATTTTTTCTATTATTTTATTCCATTTATGCTCGCGTTCAGTGGAAAGTGGCAACAT
GGCTGGCGCTCGGTGCATTCCGTTTTTGCTTCAACGCCATTAGGTAAAGCAACAACACTG
CAATGGCATTGGTGCCCCTTTCGCGAAGGGGGAAAAATACCATGCTTATAGAGGGGTTGA
GAAAACACCCCGCCACCGAGTTTACATTAGAATTGTTTGCCCGCGTTCATAACGAATTAA
AAAATGCGGAATTTTTCGTGCTGTTTTTACCCGAGAACGGGATTTTCCGCTGCCTTGGCT
CGCTCCCTTTTCCTCCTCCTCGTTTTAAGTCCCCCTGCCATTATTTACTCAGTTTCATTA
TGCACCCATTTCATTAAAAGTTAAGTCGCTCTTCGGGGCCAACCAGCGACAATTTATTTC
AATAAATTTAATTACTAAGCCCTTGCAGCCATTTTTTGTTAACTGTTTTATACGCTTGAC
CAGAACCCTCATTCTTCTTTTATTTTTTTTTGAACGAAAGTGGAAAGTGGGTTGTGAAAC
TTTCATTACCTATTTGTATTACATAATTGCACTCACGTGTTGGCAGTCCCAAAAGTGTGT
GTACATAACTACACAGGGGTGTCTGTAACGTGTGTGTTTTTCACAAAAAGTTCCTTCAGC
GGAAAGTTCCATTTGCTGTACGTTGATAATTTGTTGAAAGTTTTCTCCTGTTTTCTATGT
GTGCTCGCCGAGGTCATTTGCAGGATAGTCAGGTGAACTTTTTCCTATAATTGGGTAAAT
AAAGTTGACTGCTAATATTGAATATGAGCTGTTGGCTGTTTTTATGTTTATGTTTTAATA
AACTCGTGTTTGATAATAGTTTCTCATACCTTTAAAATTGTGTATTTATTTTAAATTCTT
CACTATTCTTTCAAATTTACTAAAATTTACTTGTACTCTATGCATTTTATCTTCAATTTT
GCTAGTATTTGCATTTTAAGCATTCAATTTAACACTCCGTAAATATCTCGTTGCAATGAT
TGGACAGCCTCAGCTGCAGTTAGTGGAGAAAGTGGAAGAACATAATGCCAACCTATATAG
CTGGCAGCAGTAGCTTCTAATTAATGTCAGTCAGTATCTCTCCCATTTTACTTCCTCTGG
ATTTGTTTTTTCAACTTTGAAAAAAACCCTGTGGGTGGGCGTGACGTTGAGTAGGGCTAA
CGCCTTTTCCATGTCATAATAATTTCTGGCTGGCTTTTCCTTTATCCCGCTGCCCCTGCC
TGCTGCTCCGCGTAAAACTGAGAAATGGCGCATGAAAAGCGCCAACAAACTTTAATTAGT
TATGCAAAGCGAATGCAGCTTTGGGAGCGAACAAAGAAGGCAGGGAAAATACAACGAGAA
AAAAATGGGGAAAAACGATTATGTGAAGCAGCGTAAATATATTTAAATGAAAAATAAAAT
AAAAAGTTATAAATTGTATGAGCAAATTACAAAACACGCACATGGTCAGCTCAACAGGAG
TTTTATTCGCCGGAAGCGTGTCTAAAAAAAGGGCAGGTAAAAACAATTGAGAACAAAAAT
TCAAATTAATTGTGCGCAAAATCGTAATTGCATGCGGGTAATTAATAAATTATATTGCCA
TATGCAAATCCGCAAAAGTATAAATGAATTTCTGGCGCTATAAAAACAAATTAACGAGAA
TTTAATGTGCCGTGCGTATTTGATAACTGACCGCCGAAAGTATGCTATGAAAATATTGTT
ATGGTATTTAATTGACACAAAAATAATTCCACGAACAAGATCCGCCGGGCATGGCTAATG
ACCTGACCTGACCTGACCTCCATGTGAGCGGTGCTTTTATGCATTAATTCTTTAGTTTTT
AACTGAAATTTAAACCAAATGTTCAGTGCTTTTTATTAATGGCATGCAGTTGGTTTTACT
TTCTGAAACTGACATGTTTAAACACAAAGCGAATCAGGCTTTAATAAGTCTAGCAAAAAC
AGTTGCAGTTAAATACATTTTTTTTTTTTTTTCATAAATTAACGTTTGAAGATCCTTAAT
TAAGATTCCTGTTCGCAATCTGTTGATCCGGATACGTTGACAGGTTACGACCCATTTAGC
AAATAGAACGTTGCTCCCTTCATCTCCACCTATCAATTCACTGTGTAACCATCTCACATC
CTATGAACAAACTTCCATTCCTGAAAATCCTCGTCCTTCTCCACTGTTTTCTTTTTTATT
TCTCTATTGTGTATGCATCGATTGGTGTTTTTCTTTTGGCTTTTACCCAGGTCCTTTTCC
TTCATTGGCTCATGCACTTTAGTTCATTACATCGTTTTCATTTGGCCAATTTGCTCACTT
GACCATAGTTGATTTTTATTATTTGGTCTGGCAGTCGTCAGGAAAATTGAAATGTTTTCG
GTTGCTTTGTTTTGTTGCGTTTTGCATTTGCCTTTTTATATCCTTCTGGTCAAATAGAGG
GACAAACTAAGTGAGTGACTCCGATACACTGACTTCAACTAGTTGCATTCGGCTTTCCCT
TGGGTGAAGTACTCTGTTCACTTTTCCTACCGCCTTTTTCATCTGTCTCCTGTGTCCGTG
TCCTATGTCCCGTGTCCTGGGCCAGCTTTCAATATCTGTTATTGTCCTTCCCTTGGCTTC
TTGCTGCTGCAGCTGCTGTTTGCATGCTACTTAATGTGGCACTCACTGTTGCCACTACGT
GACTTTGCCATCATCTTCATCACGAAGCCAGTTAAAATGTGGTCAATTCTGGCTACTTTC
CTGCTCCGTTTGCTCTGTGATCCCTTGGCTTTTGGCCATTTAAGTGGGTTTCCATCGTTC
CGCAAACGTTTACATCCTTCGTTAGCTGGAATCATTGAAAAGGGAAATGTTAAATATAGC
TTATAACTGTAGTATTGTGGGATTATTACTATTTTCTTTCACTTTTAAATGTAGTAGTAC
ACATAACGAGAGCTTTCTCCATTTATTTCCATTTTGTGGGCTGATACCTTCTTCCTTATT
ACCAACTTCTGTTTTCTCAGCCTCATTTGTCCGCCTTAGATAATTTAGCCAGCCGCAAAA
AGTTTCGCCTGCTTACAGAAGAAGTTCCAGCAAATACAAACTGCAATTTGCCAGCAGGGG
GTCCCCCTTACCGCAAAGAAAATGTGCATGTGATATGCTTAATTATTTATTACGACTAAT
TTGAAAAGTCCCCAACAGATTTCGTCATCGTGTGCAAACTTTCACGTTGCTGAACCGCTC
TGCATGAGAGCGAAAAAAAAAAAAAACGCAGACTGCTTAAACAGCAGACACCATATGAGT
TTCAGTTTACATAGGTCAAATCAGGGCAAGAACGAGAGCTCAAGGGGTTAGCTGTGCCGG
AGGAAAATGTCTGAATAAGCGAATCAGACTCTGAACAGCCAAGTTAAAGTAGTTTAAAAA
GTGTCGTCGTCGTCGTCGCCATTTCATCGCTCAGCTGATGATGAGCTTACCAGGCCAACT
AACTGGAGACGAAACCTCCTCCAGTTCCAACTCTTCCAACTCAGGTCCCTATGGCTCACA
TTGCCACCCCATTTCCACCCCATTCAGGCCGACGAGCACACAAAGCTCGTTTAAGTTTTA
ATAAACAAATTAAACTTGCTGTCTGTGCAGTTTTTGGAGCTTATTTTTTGTGGGCTCCAC
AGTGACACCAGATACCCCAAATTTGAGTTCAAGTGGGGTTAAATACAATCTATTGGGGCT
GAGTTTGGCACAGGGAAGTCGGTTTTAATTGGCGATTCAGAAAAAAAGTTTATTAATGTG
GTGAAGCCTTCAATTTGAAATTGCCAAATATTCGCAAGAATTTTAATGACATATCATGGA
AATAGCGATACATTTGTTTTATTCTATTAAAAATTATAACGAATAAATCAGCTGCATGCA
TATTTTGTATCCCTTTGCTTTCATTTATTATGATAAAAGCTTTGCAGATACTTAAATAAT
TGCTTTTTACAATTGAATTCCCCTTTATGGCCTGTGCGCATTTTGAAGTCCTTGGCATGT
TTAAATTCAGAGACTTTGGCAAAAGTCGCGGGCTAACATTCATTAAATCCTAATTTGCCG
AGGATTACGAGCAGATACTCGCATATGTGGAATGTTTGCCCCAGAATAAAACACTCACTC
ACAACATCGAGCCAAATGTATGTATGAATATGCAGAGCAATTTGCACATTTGACCCAACG
CCCACAGCAAAAATTTCCCAATTATTTCTGCTTGTTTTTTTGTCGCTTTGCTGGGCTTGC
GATTTTTTATTTTGGGCAAAGTCATGTCTTGCGGAATTTTAGTATCGCGGCAAGGATGAG
AAGGATGCGCCACAGTTGCGCAATTATAGCTTCGCCACAGAAATTTTATTTACGTAAATT
TTATTTCAATTTATTTTCCTTCCCGCCTGCCTGCCATTCCTTGCATTTGTTTTTCGCGAG
TTCTTTGCATTTACTTTGCCTTTATGAATTTTAATGAACATTTTTTCAGTTGCTCGTTTG
CTATGCAAAAAAAAAACCAAACTAAAACAGAAGACCTGCAATTGCTGGGACCAAATTTAG
ACACTTCAAATGCTCAATGCAAATGTCATTCCATTTGGCCAGGATGTCTGTGCCTCCATT
TCTCCATTTCTGTTGATTTCGCTACATATGCAGTTTTTCTTCCTCATGCTGCGGCAAATT
CCAGCTTGCTGAGCGTTGCCAACTTGCCCAATGTGCCAACTGTGGAGCCCTTTGTTAGCC
CTGCTAAATATTCGTTAACGTGGCGAGCAAATTTCGTTGGCAAACAGAGTTCCGTTTTGG
CGTCCGCGAAGTCCCTGCTCTCTATAAAATTCAAATTTACATATTTGCACATCTAAATCG
CAGTGAATTCGCATTGTTTGCCAAGGCTGCAAGTTTGAAAGACTTTGAAAGGCGGGGCGA
AACTCGAAGGCTTACTTTGTCACAGGAGCAAATTCAGGAGAAAGCTCGAAAATTATTTGG
GTAACTTTTGGCAGCAAACAATGTGGAAAAGGTAAAGGGATAAAACGTGCTATTAAAGTT
TAAAAACGTGTTTGCACAAGGTGTACAATTAAAGGAAAAATGTAACCTAAACATGTAATG
CTGACCCGATGACCCACTATTATAAAATTAATGTGAGGCCAAAGGATAAGCAACATATTG
TGAAAAATAATATATTCAAAGCAAAATGTATAAAAACACATAGTATTTTCAAAGCTATAT
GTACATTTTCGCTTAATAATTTCTAATATCAAATGCTGTTCAAATTGGAATTATTCTTTT
GAATTTGTTTGTGTCATTAAATGCAGTTCATTTAAAGCGTTCAATATTTTTTGGTAATAA
ATAAAAGCGCAGTTGAAAAGAGCATATTTCATGATCGCCAACTATTTCTTAATTAAAATA
TGTTTTCAATGACATTTAATTTACATACATTCTCATATTTATTTCGGGCACTTAATGAAT
TGCTAACATAAATTGCGGGATTTGCAGCAACTATTTTAATTTAATTAATAGGAGTGAAAA
ATGTGCGCGACTAAAAGGAAAGAGCATAGAGAAAAAAGTCATCTGCGGCCAATTGAAATG
CGGGTGGGCAAACGTGGCGTATGATTAATATGCATTTTCAAAAAAAAAACAGAAAAAGGC
AGAAGAATTTGTGTTTTTTATTTATGACTGAACGTTGAACTTTCCGCTAAAGTCAACGAA
GCTCACACACAACAACTGCCACTCTGGGGGATTTGGGTTAATAGCCAGTGAAGGGGGCGT
GGCAAGTCTGGAGGCAGTGGAAAAACAGTGGAAAACAGCGCCCACCTGCAACCCACAGGA
CAAAAAGGTGACCGAGTGTACGTGCAATGCTCACGAAATAATGGCAAAAGGTTTTTGTGT
CGTTGTTATATTTTTTTCCGCCTAGAAGGGCAGAAAAACAGTAGTAACAATATGTAGATG
GAGGCAGGTGGGCAAGAACAGGTAGCGGGGCAATTGTTGAGGCAGCTTAACAGTCTGACA
CGCACTGAGACTGTGACCGAGATGAAAATAAGATTCAAATGAAAGCTACACAATAAAAAA
CAATGACAAAGAAAACTCTCAAAAGGAGAACGAATTTCCAGGCAAAACGAACAGGTGTGA
ATTGCGGACCAGAACTTATGAGCAATATGGAGTGCTCAAACTATTGGATTAATTTTATTG
AAAAATGTTTGCAAAACATTCTGAAAGTTGATTTAAGCTGACACATTTTAGTGCTACTCC
GTTTGCATATAAAAAAACCCGAAAGGATGATAGTTGAGGCAGCAGATCCCCAAGCGCATA
ACGAACTGAAAAAGATGCTTTGCATACGAAATACAAAGGCTGACATAAAAAGAAACAGCC
GCAATGAGACGGACGAGAAGCAGAAACAATAAACGTATCACAGGTCACCAAAAAAACCTA
AACAAAAAAGCAACGGCAATTGTCGGGGAAAGGGGAAAAACCGACGAAGCTGAGCCAAAA
CCTGGAGCAGCAAACCCACAAGCCGTAAACTTGAGCCGCCTACAGAGTCCAGGAACGGAC
AAAAAGGATTATAAGCGCAGGGATGGATAAAAAAAAGTGGCAAGGTAAAGGGAAATTCGG
CAGCCTCTCTGCGTCCAGAAGTGAATTAAAGCTGACACAAAAGGATTCGGCTTTGGAGCA
GGGTGGCTAGTGGATGGCTTGGCCTCAGAGCTCACCCGGGTCCTCATATGTGGGTGTCTA
ATAATATGGTACTACCACTGGCAGCAGCCACAGCCACAGCCACAGAAGTTTGGTCGAGAC
GAGATAGCCATGCAGCCAGGGAAGCCAGAGCATTTAACTTCGGTTTCGGTTTAGTGGGGT
TTTTGTTCTTTTTTCCCCGAATCCTTTTGGCGTTTGCTGTCAGCAGCTTTTGGGGGACAG
CTGGGAGGAAAAGAGTCGCCATATCGATTTCCCCTCGAATCTTTTTGGCCAGGAGTCTCT
GGCAACCACCGCTTGCTAACCTGGTTTGTTACCTGATTATACACAATCGCATGTGTGTGT
GTGCGTGTGTGTGTGTGTGTAGAGATGTATGTGCTGGGTCCCGAGTCCTGTCTATTTGCT
CAGTGCAGCGTAAACTCTGCAGATAAGTCAAAACCAAGTGCAGCCAAGTTAATATTGCAT
GCGGATAAATTGGAGCTTATATTCCAGCTGCTCGTTACAACTCCCCTCTCTTCTTGATCG
TTGCCTTTGGCTTTATGCATTTCTGATTCCAGATTTTGCAGTCTGCATCTGATGGCTCAA
GCTTTAGTTGTTATACTCGGCAGTCGTAAAAATGTAGGGGTATATGATGTTTAGAAATAA
ACTGTTGGCCATCTTTCATACATGTAAATGTATGCGTATACAACTTATTGAATAATGCAA
TAGCCTTTTGCTCAATAGTCACTTATACAGATTTTCGTTTCTTTAAACGCCATGTAACAC
AAATCTTTTTAAATATAATGGGTGTGCCTGCGTCGATTCAAACTTTCTTGTTTGTTTGGC
TCATCTAAGCATCTCAGAAACTTAGTCATATTTGGATGAAACTTGCAAAAGTAAGCAAAA
GCAAAGTTTTGAAGGGGATAAGTGAAAGGAAATGGGAAAAAAATATTTTCGAGTTTAAAC
AGAGCGGTCGCCAAACTTCTTCAAAGAAACTTATGAGCCATTCATGACAAAATCTTTTGA
AAATCTTCAACATAGGATAAATAACACATATAATATTTCTCTATTTCAATAAAGAAAGCA
AACATATAAAGAAAACGTATATAGTATATATACCAGAATTCCCCCCATTTCAAACTTTCC
ATATCTAAAGCACCTGATATATGTTAACCATAAATAAGTTTATTCAATTTATCAAACAAG
CTTACAAGCTTTAAATACCACTTTCCGCATAAAAAGGTTTAAATTAATCCCTCATCAACA
TTCTCTTAAATCCATCATTTTCCCATTTTACGTTTTCCAGTTGACCCGGAAACAGAGTTT
CATTTCCCCCACCCTTTTCTCATCGTATTCCGAATTCCCCCTTAACTGGCAAAAGAAATG
TTTATAGAACATTTGCTCTGACACATCGCTCAAGATGATATAACAAGGAATAAAAATAAT
CGAATAAATAAGCAACGTGGGGAGCAGCCAAACAGCCTGATATAGCCAAATCGAATTCCA
GTTCCCCAACTTTGACATCCAGTAACTCCAGCTCGATGCTTACGGCTCAGAGTTTGGTCA
TAAAGGATTTACACGGATGTTAACACGGCCCGACTAAAATATGTAAAATGCTACAATGGC
AGTTTCAACAGCAGCAGCTGGATGAGGATGATGATGGTCCCTGTTTAAATTTTCTGTCAT
TTTGTTTTCCAAAATGGGGAATGGGAAATGGGAGCTGGGTTATGGCTGTCAGTAATGCTT
GAACGCCCCTTGTGAGCACCACTTGACAGGTTTTCCCCCAGCGGCTGTATTTTTTCCAGG
GATGAGGGGTCTTGGCCCGGCCAGGACGAACATTCGTCACTGGTGGGCCGACATCACTTG
GTGATGTGTTTATTATGTGCCTCTAATATATTTATGAGGCGTCTTATAAACGCATTTTTA
TTTTATTCACATGGCCTGTCTCGCTTTTTCCTGCTCCGCAAACAATCAAAACACATCCAC
CAAAAAATAAAAGGAATAAGGCAAACAACACCCGTAGGTATTTTTTCTTATTTAGAAAAA
ATGCTTTCAAATTCATGCAGACATTTTTTTTGCCGTATTGGGCCAAGGAAATGATGCGCA
TAATATCCTTATGAATTTATATGGCGAAAATTATTTTGGGAAGTGTCTCGAGTGGCTCAA
TCAAGTGAATTTCCGCAGCAGCCTTAGTGAAAATTTCGATTTTTATTAAAGACCTTTTGG
GGAATTATGCGGTTTACTTGAATTGCCCAAACAGCAGTTCCCGGCTCTTTAAGCCCACTC
AACACAGTTTTATGGCTGCTGCCATAAATTAACCCATCTAAGGCATAATTATATGGAGAA
ACCATGGCGAAGCTTAGTTAGAGCTGCCATTCAGCAGCAGGAAGTGGGCGTGCATTTTTA
ACCAGCCATATCTTCCCCCTTCTTCAATTCCAAGAGCTTTTGGTCAGGTCAAGCCGAGCA
TGGCATTTACTTAATTGGCGCTTTAAACTGCAAAATGCAGTCACTGCCAGGGCATATGTA
TATATACGAACGCGTATAGCGTATAGCGTATAGCGGCACACACGTAAGCTCTTGTAGATG
TATTAGTTCTGGCCATGTCGTGACTTAGCAAGGACAAGCAGCGGAAATGTGAAAAATGAG
CCAACAAAAGCGCGTCGGAAAGGCAGGCAGCAAAGCACTCTCACACAGGACGAGTACATA
GCATATACGAGTGCGAGTAGTAATCTCGCATACGTGTATTTATAGCTACTGGCGTATAAA
AGCCATAAGCTGCATTTGTTGGTCCGCAGCGACGAAGCCTTTTGCCGTGGCTAATGGTCG
TGGCCAGAAAGCCCCTTTTTTTTAACATCCTCCACGCTCATGAGCACCGAAAATGGGCGC
GTTTTTATTTGCCATTAATAAACCATGTGGAGGCAGTAGGTTAAGTGGCGAAACAGCTGC
TAATACCATACTTAAAGCATCCGACTCAAATATATACCATGATAAATAAATAACTTTCAA
GTTTGAATAGTTTATAATTAAGACCCCACAATTGGTTTGCTTTACTTAACATTGACCCTA
TCTAATGCTCAATTAGTCCGGCATTGTCATTTGAGGAAAGGACATCTAAATAACAGACTG
CCGCCAATAAAGAGGTAAGCCCGATAAAAGAGAGCTATCTGGTCATGCAGGAAATTGTGG
TCTTTCGTCGCACAAATTAGCGGCATTAGTTGGCGCTGCCTGAGGAGTGGGGTTGGTCGT
CTGCTATGGCGAAAGGTGGCGTGGAGCATCGGGGGCGACATAATGACCAGGCACTGCGTT
CACTCGTGCTGGAAACTGCCGCTTTGCTGTCGCTTTTCCCATTTTCCCGTCGGCATTTTC
TCATTTTAATTGATTTAATCGGCTTTGGTCCATGTGTCGCGATCGTGACCCCCAGTCCCC
AATTTGTACCCCGTAAATCCATCACTTGCTGCTCATTAAAAATGCCTCGCGTTGGGTTGC
CCCTTCTTCTGACTGATTTTTTTGTTTACCCCATTTCCGCTCTATTGGCGTATAAACAAT
TTTTGCGCATTAATTGAATTGCGATGTTTGTGTGTGTGCGTGCATGCGTGTTGCCGTATT
TGTGTGTGACATGCATAAGCCAAATTAATTGGAGCTTCATTTCGCACACACACACACACA
CACAAACACACACACAGGCGAACGACGAATTTTACGTCCTTTTGCTGGCTAGGATTTCTT
GCCTTCTATTTTCTTGTTTTTGTTTACTGGCAACAAAGGCAACGAGCTTCCTAATGAAGG
TTTAATTAGCAAACACACACGCAGAGACACTCACTTACAACACCCACACACACAGACACA
TATACACACGCCGGGAAATTTTTGGAAAAGGGGAAAAAGTAGAAATGGCTGCACAGGATG
AAGTCTCGAAATACCATTTCAATTATTTGATGTGCTGTGTGCCATCGCCTAATTCCAATT
TTAATTAGTTTATTTGGTATATTTCGTAAGTGATTGATTGATTGATTGATTAAATTAGTT
GAAATACAATTAAATAAACGCTCGAGTTGGCTAGAAAGTGTAAGTGAAAACGTACAAACA
AAGAAATTAGAAAACGAGTGGAGGTCCTACATATCTCGAAATACATATATACAAAAAACT
TGTGTAGAGCCCAAAATAAATCCACAACCGATACAAAAACGAGAAACCAGAACGGCCAAC
ATTTTAAGCCCTTTTTTGTGAGCACGGGACTAAAATTCCATCTGACATGCCACAGGCTCC
AAGGGGTTAAGGAAAAATGTGGAAAAACAACGAGTATATGACAGATAAAAGGATGGGTGG
GGTCGAAAATAACAACTGGGACAGATGCGGTTAATAATTGGCCAGGTGGAGAGCTTTCAA
ACTTGTCAATCGCCCGAGCTTTGTAAGAATTTGCCTCGTCGAACAAATACTAGGTTAGTT
TCCCTGGCACGGCTTTAATAGTTAAGTCGAATTTGTCTGAATATAAACCAACACATTTAT
TAGCATTTTCCGACTCACGCTCCACATTCCTTTTATGTTTGCTCTTTCTAGGACCTACAA
TCGGAAATTGAAACCCATCGCGTGGTTTACGATCGTCTCGATGGAACAGGCCGCAAACTT
TTGGGTTCGCTCACCTCACAAGAGGATGCGGTTATGCTGCAGCGTCGCCTCGATGAAATG
AATCAACGTTGGAATAATTTAAAATCGAAAAGTATTGCAATCAGGTAAGTGCTTTTGACT
TCTTGTTTCCCATAGCCAACCTCGATTTTCATTTTTTACCTTCCTGTTACTGCTGTTGAA
TTGTTTGTCCGGGAGGAGGAGTTGAAAAAAAAAAACAGTTTTGTTGGTCGGTTCTGCTGC
TTTTTTGCTCTTATTGTTGGTCTGCCATTTTTATGCTCGTGGATGTAAAAAGGGGGCGTG
ATGATTGCGGCCCAAGGATGCTTCAAAACCAGCTGAATAGAATTAAAGTAGCTCCATGCA
GTTTTTGGCTTCAGTGCTTAAATGAGCATGAAGTTGAGAGGCTAGTAAATTGCCCAGGGA
CTTGTTAAACCGCCAGCTGGGCGTATGATGAATGAAGCCGAATCTAAATCAGATTGCCAG
CTACGGATAAATAAAATACTTATCCCACAACTGCTTTAAGTGTTAATTAAACCGCATTAA
GCCGTGCACGAAACGAGCAGTGCAGCGACATTGTTTAACAAGTTGAAAACAAGCCAATCC
CCCTTCTGTGTCTCCTGTGCCACGCGGGTTAAGCAACTTTGTGCCGATGAAAATGGGAAA
ATGGTGGCCGGAAAAGCGAGCAGTCAGCAGTGAGGTGGAGATGAAAAGGGGACACACTTT
ACGGCTGACAAAGCCGCGAGCCGAACGAAAATCAATATTAAAAACGAAACGCGTGAAAAG
TGATGGAAACGAGTGAAGGTCCGAAAAGCTCTGGTCCATGGACACTGTGTCATTGATGAA
ATCGTGTGCAAACACTGCCCCAGTATCCTTCGTCCTCCTGTCCTGTTTTTTGTTTCTCTT
GTTTTTTTTTTTTGTGTTTGTAATTTCCCCATTTCATAAATAAAAGCTTGGCTTGGGCCC
ACAAATATTGGACGCTTGTTGATATTGATGCTGCCGATGATGAAAGTCGGGTAACATGTT
TACAAAAGGGGTGCGGTGGGTATTGGGTATGGCAAAAGTGGACCGAAATGAATAATGATG
ATGGTGGTGACACGCAGAAATTCGCTCAACGCGGAGCCGTCGAGATCGCATAATGAATAT
AAATGGCAATTATCCATCGGAAAAGACAGCACGGCGTATACGTGATGTTGCGCCCAAAAC
AGTAGGCAACATTAATTTGACCAAGTTTCTAGAAGGGAAAGTTGGCTAGCTTTGTTACCA
TCTTATAGTTTGATTAGTCTGTATGCTTTTAACAACAACTACATTTACTAAATACAATAT
ATAATTCTTTATAAAAAAAAATAATATTAGGCTCAAGAGATTTAATAATTTATTTTATTT
ATGAAATGTTATATTTTTGTATAGGGTATGCTTCCTTGCGTATAATAGCTCTGGTCCCCT
GGCATGTTTCTCAAATGTTTTTCAATTAAAGGCAACAGACAAGATGACGAATGACACCTC
GAGTGTGGCTCATCCTCCTCATCATCCTCCGCCCAAATTGCAGCCCTCATTATTCCGACG
TTCTGGCACATTTCCGTGGGCTAAACTTGGGCCACTTCCTTTGTTGTTTGGCTTGGTTTC
CGACCCGCTGTCCGGAGTCGTTGTTTGCGCTAAGGATTTGTTGGCTTATAAATTCTTGCG
AAATATTTTGGACAGCACTTGAAAAGTTTCACCGTGGCTGCCATTCCTCAATCCCTCTAC
GTCTTTTCCTCTTTCTATTTGATTTTGCCCATTGTGTTCGCTGTTCGTTTGTATTAGCCG
CGGCACTTTTTGGCTTTGGGTCATTTTATGCGCAAAGTTTCGTTGGCTTTGAACTGTGCA
AACTTTTTGCGTGCTGCATCTCTACAGGTGTTCCGAATCTGGTTTATTCCCCCTTCACAT
TCTCGCTGATTGCTGTATGGGAGCCGTATGGTTGTGTGTGCGTGTTTGCGGAGAAGATTG
ATGAACCCGTATCTTTTCTATGGATTCGTTTTCTCTTTAAGCTTCTTTTGGCGGGTTAAA
AAATGATTTAATCGAGTATTTTTTCACGACCAGATTTATAGCGATGTGATGGATGTGAGG
GAATGTCCGTAATCAATCAATATGCTTATGAAAAGCACTTAAATAAAATCAAGATACCTC
TTTTATTACATTTTTAATAGAGAAAACCTGTTAGGTCATCGTTGTCTTAATATTTTATAG
CTGTAGAAGCATATCAAGTTCAGGAAAAGGATTTAATATTGATTGTTTGGAATTTGCTAA
GTCCCAAAACCGATGGTGTCACTTCAATTCTCTTATAACTTTCACCCATATCAATTTCCA
GTACAATTTGTCTGCCCCACGTCAGTAATTGTCAAAAGCCTATTCACAGAAATAAAATCC
AAAGTGAGAAAACAACAAAGCGGCTGAAACTTGAGAAAAAATCACCAAGTATTGTCCGTC
TCAAGTTATTTCCTTTTATTATTTGCATGAGGAAAAGCGAAAGTGTGCGAAAAGCGGCAA
AAGGAAGGAAAGCCCAAAGGAACGGTCGTTCCGCTCCAGACGAAGATGAAGGTGCTAGAG
CCAAGCCTTAATTATAATCAAAACCAGAGCAGAAATAATAAAAGAATGAAATGAGCACGC
CAAAGGAATTCGCCAAAGATAAACAGACAAAAGGTCGAGGGGCAGGAAACTCCAAACGGA
GAAGCGGCGAGTGGCGGGGAAAACTAGGGAAAGCGGGGTGAAATGTGATGACAATGAGGC
TGTGACTATTGTTATTACCGGGTCGCGGGGCTAGAGATTTTTCAGATTTTTCCCTGTGTT
ATTTCTTGCTTCCCTCGGCATGGCAGTACAATGGTCGAAAATATGCCAGGACGAAATAAA
ATGTGAATAAAATGTCATGGCATTTCACAAATACAGCGACAGCTGAAATTTAGCATAGAC
CAGTCCCATTTGTGCCTGTGTGTGTGAGTGCCTGTGCCAGGGTCCTCGGCCAAATGCCAA
AACAGGACACTTTAATAGACCTCACTTAAGGAGGAAATTTGTGGGCCACGAGGAGCGGGC
CATTGAGTCGCTGGACGAGAAGTGCCGGAAGGAGGGCGGAAACTCAAGGAAATAGACAAA
TTGTCGCTGACATTTTGCGGGTGCAATCAGCACAGATGCTTCCTCGTCTGCTCTAAAGTG
CAAATTAAATTTAATATTATTACAGCACTTTCGTGGGCACAGAGAAAAATAAAATATGCT
TTAAAAATTAGTGAAATTATGTAGATTTAAAAAGAGGAAAGGATATTTTTATTCAATTGT
AAAAAAAATTGTAAAAATAATATTCATCGTTGAAATTAATTTTAATACCTTTTGATTATA
TATTTTTCTTATTCGTAAACGGGGTTTTTAAATAGTTTTATTAGTTTTATGCGATTAGGG
ATGCTAGATTTCTTTTTAAACTTTTTTTTCGCAATGTGAAGGTGCTATAATTCTGGTTGC
CTGGTTAAAACAATCTCTAATAGCCTTTTACCCTTGTTTCTCTGCAGGAATCGCCTGGAG
TCCAATTCGGAGCACTGGAACGCCCTGCTCTTGTCGCTCCGCGAACTGACCGAGTGGGTT
ATCCGCAAGGACACCGAACTGAGCACTTTGGGCTTGGGTCCCGTTCGAGGCGATGCCGTC
AGTCTACAGAAACAGTTGGTAAGTCCTGGCAATGGGTCATAAGACCTTTTTCCATTTCCC
ACTTTTTTGGTCAACGACCCAATTTTATACCACTTTCTTCATTTTTTTTTGCATTTTATT
TTTACTGGAAACTCCCCCGGGGCTCCACTTCAATTTGTTTGTCCGCCTGGCCAACTAATT
GTGTGGAAGTTTTGGCCTGCGTGGTCTCTTGACACATTTTCAGGTCCTGGGTTTAATGAT
GCCAAAAGTGACTTGGCCAGCTGCCACTTTGCATTTTCGGTACCCCATTTTCTGGTTCCT
AATTAAATAATATTCGGCAAATACCTAAGGTATATTTAAGCTATGTACATGCTCATTTGA
GCGTAAATACAATTTCCAACTGATCCGGGAATTGCTGTTTGATATGGGTAAACAGTTTAG
ACTGGCAACAATGCAATCATTTTGCAATTTGCACAATTGTATTCCGAGTCTTCTGAAGCG
CAATGAAAATTTGTGTGTAGCCCAAATCATTTGCTATGCTATATTTTAATGAGTTTGTAG
TAAAATCAATTCGATCCGTAATCCAAACTGACCCTCTAAATATAAAAGCATGGGTCGATC
ACGTTTAAATATTTTATGATATTTTTTTTTCTATCCAGCGTATATTAAATCCTAATCTTT
TTCTACTCCTGCAGAGAAGCACATATAAATCTATATGTGGTTTTTGTACGGTACCAGCGT
ATCAATGTATTTAATGGCTTGCAAGAGAACCCGGATTTTAGTTGGTATTTTCGGCTAAAT
AGCCAAAAGACCTCCTTTCGAATGGAATCAACTTGACCGAGTTGCGTATTCGACCTCGGC
CACGATTGGGCTCAGAATTCTTAAATAATTGTTAAATGATGCTTGTTATGTCAAAAACAT
GGACACACTCGCCCGATTCCACACATCCTGCCGCACATGGGGCGAAATCACTTAGGGACC
TGCCTGAAAAGGGAAGTAAGGGAATTAGGGAAAAAGTGTAAGGCAGGAGCCAAGCAGGCC
ACTCACTCTGCGAATGGGAAAACACTGTCTAACACAGCATGAGGCACTTGAATTTCACTT
GGCCCCACTTAGAGCCCCAGATCCGAGCTCCAAGAAACAAGTGAGCGGAGGAGCAGCTGC
GGAAAAAAATGAGTCAACTTTCACCCCATGGAGAGGAAAGAGAAAGGAGGGGGGCCATCA
GCAGGGGGGCAGTGTATAAATCTATTGCCTGCCACTAAGTTACGGTCTGCCGAACATTTA
CATTTCGGCCTGAAGATTTTATTTGCCAGCGAACGAAGGATTCAGCCAACGGCCACAAAA
GTCCGGGTCCAGCTCTCTCGGTCCGTAGTTGTATATTGTTGCATTTTGTTATTCCCCAAC
TAAATGCATTAAACACGAGAATTTATTGCTCCGGGCTGCAGAAGATGCCATTCCCTTGAT
AGTTTATGGGCCTTGACCACTTCAACTGTATTTTTCAGGCGGCTACCAAATATCATGAAA
GCCCTAAACATACTTTTATACATATATATATATATATATATAGTTATTGCACAAGAGTTT
CATTCATTCATGTATTGCATTCATTGCCCTTCCACTTGCAGGACGATCATAAAGCCTTTC
GCCGCCAATTGGAGGATAAGCGGCCAATTGTCGAGAGCAATTTAACGAGCGGTCGTCAGT
ACATCGCCAACGAAGCAGCCGTCTCGGATACCAGCGATACGGAGGGTAAGTTTTATGGCC
ACCAACGACACACTAAAAAGTCGCCAGCTAAACTACCCATTAAGGGGACCACAAAAAGGT
TTTCCATGAATCTCGTCAAGTGCTCTTGTCTTGTGGCGCAAAACCGAAATTGGATTTGTT
AGGGTCGGCGGAAAATCATGATCTATAAAATGTCCGTGGAATAATAGAGTCTTCTATTAA
TGGGATACTTATTATGGAGTTCGTTGACACGTTCTTCCAAAAGGGTTTTATTGGAAGGCA
AGGATCTGAATAAATATCTCCTAATTAAATGAGGACTAAATATAAATAACTAATCAAAAT
ATAAGTCAGGAAGCTTAATTTGATCATGAGTATGATTTATAAATTTGCCCCAAGTGTAAC
TCTACCTCTAATAGTTATCCAACTTGAAATGAATATTCGGGCAATCCTTCTTCGTATTAA
ATTCACCTAGATTTTTCACCTTTTTATACCGCCGCCCTCTTCGTTCCACATTCCCTTGAG
CATTTTACAATTGATTGAACTTTCTGTCGAATATCTCTCACGAATCAACGAAAAACTAAA
ATGTAAGAATTTGGTTTAACTATTTTACAAAAGCTTAGGAAGCTCAAAAACCACACTCGC
ACTCACACCAGCACGCATACAAATACAAATCCAAGGATTGTACTTCGGAACGTGAGCGCC
TAAAAGTAGACAACTGTTGTTGGGCAACCGGAGAATTGCCAATTGATTTTGCACCACCAC
ACATATAACCCAATCCGAAGCCCCCGAAACCTCAGAGCTGGCTTTAGTTGCCATCGTAGT
TTTTTTTTTTAGACTTTAGTTAACAATTTAGCAAATGGCTGTGTGGATTTAGCTTGGTGG
CGGAGGTTAGAGCTTGGTTGGGGATTTGTTTCCTTTTTTTTTGTGTTCGGCATGAGGGGG
AGGTGAGAGGCTGGGAAAGCGTCAATGATAATTGCGACCAGAGCAATTAGGGCGATTAGT
ACGCTATTAGTGCCAGCCATCAGCTGTGGGAGAGATTTGGCCAAGTCCCCATCACACCAT
CGTTTTGTGGCCTTTGATTTTACCCATTCCTTTTCACCATTGGCAGCGAGTGCCCCGAAT
TTACCGACTCAAATGAGTTTTAATGCCTATTATTTGGCAGTATTAGTATTATAGTATTAG
TATTATAATCGGGGTAGAATGAGATCTATTTTGTATTTAAACAAATTTGAATAACGCTTA
TATTATGCAGCTTAGTGTTAAATATAGCGATAGCATTAGCACTTTAATTTGTGTGCATTG
TATTATGGCAATAATAATATATTTATTTTTATATTTCCTCAAAAGAAACCAATATTCGTT
TAAATATCAACTTATATGCGAGTTCTTTCTATAAAATCAAAATTGAAAAAGAAAAGTTTT
GCTCTGGAAAGGCAGTGATGCGAGCAAAAAGCAGAAAACATCCAGAGCGATAAACTCAAT
CTTTAAATTGAATTTGAATATTACAACGGAACTGCGATGTAGACGGGATGGGAAAACTCA
GCTCAACTCTCGATATTTGCTTAGCATCACATTACCAGCTGTCCAACCTCTCCTTTGGCC
ATAAAAGTTGCTCGCTGTCTCCGTCCGTGCATTAAATTAAATTCGGATTTAGCCAACTTC
GCCTTGTTGCCTTACTTTTCTCAGCGACTGTGTTGGCCTGTCCATAAAGCAGGAGCAGCA
GGAGCAGAAGCATGAGAAGGAGCAGCAGCTGCCACTCGACTATCAGTCAGTTGGTCCTTT
CGTCCATGGATTTGCTATTGCATTTCCCTTTGCCGCAGAGCGCGTCAGTTTGTCTTTCAA
ATTTCCTGACACTTTTCCTTTTCGATTTTCCCGCTGCCGACGACGACTGGCTTTGGCTTT
CATCTTTCAATGTTGTGGCAGGAAATAGCTGAGCTGCCCTGTTGGTTTTTGCGGTCTCGT
CGCAGCTAATCGATGGCTTAAAGACATCGATGTCAATTGAGTTTACCTCGAAACTTTGGC
TTTAACTTGAACGGTCCAGCTAATTGATTCCCATGCCGAATCATAGTTGAGTTTCCCTTT
GTTTCCACTCAGCTTCTTGGCTGCTGGCTTTCCCCCAGAGCTTACCTGTCCGAAAGGTTA
TGTTATTGCAAATTTAATCACAGTCTGCAATCAGCATAATCAAAGATGCCAAAGCACTGG
CAGCGCACAATCATCGGGCCGACACTAAGAGCCATAATATCATCTCTAATTCATAAACTC
TTGTACGTGCCAGGTGGGGAATCCTGGTGGGATCCTGCTCAATTTAATGGCAGCGCAATT
GTCTTTTTTTCAGAACTTTGTCTCTGGCTTTGTCTTTGACTTGATTTTCATAAATTTAGT
AACGAACATCTCCTTATCATAATCTCTTCCTTCTCCCCGCAGCCAACCATGATTCCGACT
CGCGTTACATGTCCGCCGAGGAGCAGAGCCGTGAGCTAACACGCAGCATCCGGCGGGAGG
TTGGAAAACTTTCCGAGCAGTGGAACAATCTAATCGATAGATCTGACAATTGGAAGCATC
GCCTGGATGAGTACATGACGGTAAGTCGAGACTCGCAACTTTTGCCTCTCATTTCCTGCG
TGACATTTTCGTAATTTGAGTTTTGGGGCCTCGTCGAAATTTGAACTCAAACTCGAACCC
GGCGCGTAATTTTCCATTTTTACAACTGCTCGTTAAGTGCCCGTTCTGTGATGGGAGAAA
AGAACTGAATTTTCAAGAGGAAATCGAATTTAGTTTGTTTTTCCGAAAAAGTTCAACTTA
TGGCAGTAGTACCTCTCGCATTCTTGGCACATTTTCCGCTGTGAAAATACTTTATTCAAT
TACATTCGCTGTGGCCACAACAAAAAGTTTATTTCCAGCTCCGAATACTTTGTCCTTTTT
GTTTCCTACATTTTTTGGGCTAATAAATGCAAGTGTGCTTTTTATGACGCCTGTCGTTCC
GTTCGAGGCTTAGTCTGTCCCACAACAACAACACAATATATTCCACCGCAAGGCCATGAA
TGTGTTGGCTGAAAAGAGATGGCCAAAAGGGGAACGGGCCGAAAGGGAGGCTATTTCGGA
TGTCTGCTGCTGGCATCGTTACTCATACGCACCGTAAATTTGATGCAACAATGTTTGATC
GCATAAAAATGTCACACAGACTGTGCAAACAATGGCTTCAACATGGCGGGCCACACCAGT
CCCCCATTTCTGGGCAAAAACAACTCGTTCAGAGGGCACAAAATGTATAAAATATCAAAG
CGCATAAAGTGCACATATTGTATGCGATACTCCGTTTTTCCGTTTTTGTGCGAGTTTTTG
TAGGTGGCATACTCTCATCGGCCAGCCGAGTGAAAATCAATGCTTCAGACTGAACGAGCA
CCAGGAAAGCAATATAGGGGAATGGAGCACAGCCAAAAGGCAATGGCAATAGTCATGAAA
ATCAAGAAATCCTGGCCTCAAACAGCTGAAAAAGGAAGAAACGTCATAAAAAAAGGCACT
TGAGTTCTACCTTTTATAGTCGGAAATAGAGTTTTCTCAATGCTACTAAATATTTATTTT
TGCTCTTTTAGTAGAAAATATCAGTATTAAGCTTGTTTTTATAAAAGAAATCATACTCTG
AAATAATACACTAAACAATACCAAATATTTATATTATTAAGCTCTAAATCATACGATCAG
GCTTATAAATTTGTATATTGGCCTTTTTAATAGATAAATTGTACAATTGGGAACAGTTTG
AATGGATTTTGGCAAACAATTCTTGTTTGCCCTTTTGCAGACAAATCTAATCAACACAAA
ATGTTGACCCACTTGGCGGTGTTATATATCATAACTCACAATATTTAGACACGTATATTT
ATATGGTGGTGTTTGTGGCAAGGCTATGAAAACCGTTTAAAATGCAAATAAATTCGTTCG
TTAGATTTGCACTTCGATCAAAATTGTTTAAACGCATTTTAATAACGCGTTTACCGCCGC
TCTATTTCAAATGGTTCTTGATAAATTCGTTATGCTTAACTGGTTTCCAGTTCAGTCAAT
TCCCGACCAATTGAATCAGCGGAAATCGCCGGAAAATAATCTCTCAATGCCACTCGACAC
CCAGAAAAATTACAGACTCCTCGAAAGTGCTTAACAGTGTAGTGCGTTTCATATTTTTTC
GGACTAGCATAAAAATCAAGTTAAAAGCAGCTAAAAAACTCGTTACCCACCTGTAAAAGT
TGGTTAACTTTTTTGGCAGTACTCGCGCACCCTTACACCAAAATGTTTATTTAATTTTTT
GCTGGCGAAACAAAAATTACTGATAAGGAAAACTTTTTTCAAAATTAAAAATGTAAAAAA
ATTAAGAGGGATGTGCAAGCATTAAAAAGGTAGAAAAAGTGCAAATTAAAATAGAAATGA
AGGAACAAAGTTTGGCGGCAAGAAAAAATCGGAAAGTTTGGTTTGGTGCGCTGGGCATAA
AAAAAGTTTAAATAAATGCAACTTAAAACAATCACAAGGATGCAGAACTGGGCAGAAATA
AGGGTGCGTGGTAGGATGTGCAAACTTTGCGACCGTTTTATGAAAGCCTGGTTGAGCCAC
GTTAAATGAAGTCACCAAATGGCCGAGGGAAAGTTTAGCCAGTGTAGTAACCGAAGCCCT
TCCTCCCCTACAAGCCACTGAATAGTGGTCAGCTTGGTTAATTGACCACAGGCAGAAAAT
GTCTATTAATTGAATAAAAAGTTTTTGCTGGAAAATTTCATTTGCATGGTAGGGAGAAAG
GATGTATTTTTTGCGTGAAAGTGCATTTTTGTGCACATTGCGTATACGACTATCAGAAAT
TAAAAAACTAGCTGACATTTTTTTGTTCGGTTTTAATATCTTGGCATTTATAACATCTTT
AGTAATTAAACAATTAATGGCTGGTAATAAAATTACAGTGCAGTATAGGGAAAGAAATTG
AGCCAGAATCGTAGGATTTCCAAAGTTCCGCCAGCACTTGCAATCAAGCATTCAACCCTA
ATGAAGTTTGATTAGTACTGGCTTCGGCAAACCTCAATGCAATGCGCAGCCAGGCTCTTC
AATCGAACTGAGAGGCATCTCTACATCGCCAAGCCTCCCGAGCTCCTCTTCGTTTGGGCT
CCAAATGATGCATGGCGCCCATCAACATCAATGTCACGCCGAAATTCCTTGGCAATCACC
CACAAACTCAATCAGATGTGGAATGTCGGCCCTGCCATGCTAATGAAAAGGGTTGGTCAG
AGCAGACAATGAATGCCACAGAACTACTTCTGGCTCATTTGGCAAATAATTCGAGACTCT
GAATTTTATGGAGTTAGCTCGACAAGAGCAGTGGTATGAGCTCCTCCAAATGCGTGAATG
TGAATCCCCATGCGGAGCACGCTCCAGAGAATCCAATCGAATCGAATGGAATCGGAGAAC
CGTCCACTTAAAATGGGTAAAATTGTGGCATTGGCAGTCCGCAGTGGCATGCTGAATGGA
CGCTAAAAAGCAATTGCTTAACGCTTTGAAATATGTTTCATTGATTTCCCGGAAAATTGC
TGGAAAAATAGCAGAAAATGGTGTAAGGGCAGTCAGCTCTGGCCATAATTTAACCACATG
TGGTCGATATTGAAGCAGGACATGGGAAGGCAACTTATTTAACCCCTTATGGTCACTCGA
ACGAAGCTGCTGTTACTTGGACGTTGTCCTTTGGCTCCTCTAGCCATGCTTAACCACTTC
AAGTAAAAGCTGCTGAAAAATGTCCTTGCTGAGGCTAAAAGTTTTCGTTGCAGCTTGTGT
TTGTGTTTGCTGTATTATGCAGGCTGGGACACACAATGAAATCAATTTAGTTAGCTCACT
CCTCCTCACTTCGACACAAAATAGTTTAATAAATCACTCATACGCAGTGTGTGTGATGCA
TGTGCGAGCTCTTGTGCTCGGTGGCCAGTGATTTATGGCACACTTTGCGAACTACCAGCC
CCGGTTGACACTAGAAGTAATATTATCTATGGAAATTTTGATTTAGCAACAGGGATTACC
GACTGGGCAAGTAACCAACAAAAGCTAATAAAACAATTTTGAAAATTTCGTAAATATTGC
GCACATGCACACTTGTCCTTAGCCAAGACCAGAACCCCATGAAGTGGAAACATTTTTTAA
TTCAGGTGCCTAGAAGTATGCAATATTTATGAGTCAGTCCATTGACAAGTGTAAGTTAAG
TTCCGTCTGGCTTGAAAAAATTTGAAATAAATTATTTATATTTACATAGAATATTCATAT
TTTTAAACTTTACACAAATTGTTAAAAGGCTAAGATAACTCGAAACATTTATTTAGTAGC
TTTACATACGTTTACTTAAATGTTTAAATTTAAGTATGTTATGTGCTTAACTTATTTGCT
TAATGGCTTCCCACAATCCCTTTATAAAATAAAATAATGGGTAATACATTTATTTGAATT
GACTTATTTTACTTATTTGCTTAATGGCTTCCCAAAATACCTTCTAAAAATAAAATAATG
GGAAACAAATTTATTTGGATAGACTTTCAACATAAGCACACTTTGAAATGGTTATCCAAA
TAAAAACCGAACTCCGTGCCGTTAAATCCTTCAACAAGGATAAAAAGCAGAATAACAAGA
AATGTCACCAGAAGACAGCAGCTGAGTGCTGTGGAAAATGGGGAAATATTGCACGTCAAA
TATAGAAAAATATATCATTTCTCGTCAACCGCCTGGGAAATCAATTGATTGTCACGCTAA
AATGCTTTAACCGTGCGGCTTTCTTCCACTCCACTGTCTGACTTTTTTCGCCATTTTCCG
TTTGTATTTTTTGTCTATCTCTTCGTTTTTTATTGCGCTCTTGTTGTTTGCGCAAACTGC
ACAAATATGCCACGAAATGTAACCAATGTATAATTGTCAAACGTGTTGTGCTTTATATTG
CCACACACACACAGGGTCTCTTCTATTTGGAACGTGGCTCACCATATGGACAATTCATTT
GGCCTGTCAATATTTCTGCTCGATTCTGCTCCTTTTTCCATTGGCTAACGGCGCCATTTT
GTGCGGCAGTCAACTTTTTCCAATTTCACCCGGTTGACCCTTCTAGCAGGGTCGAGGATT
TTCATTTCATAAATATTTGCCATTTATTGTATGTTTTTCTTTCTGGTTGGCGTTCGTTCG
TGGGCGCAAAAACAAACATTTCGTAAATATTTGCTGGAGGGCTTACAATATGGCATGAAA
TAGTTCTCTAATTGGCATTGCTTTCCAATTAAGTGGACTGCGTAGGGGAGCATAAAATTG
TAAAAACAGAGATACTCGCAAAATATTGGTTATATTTTAACAAAAAAAACAAAACCGAAA
TCTTTATGAATAAGTAAATTTTACGTAAATAAATCCAGCAACTTAAACAAGTTCCACATT
CCTTCAACATCGATCAACTGTCTTAAATACATTAGTAAATGTAAAACTCTAACTCAAGTT
TGTGTTATCGGTAGTCTCTTCCGAAATCTTCCGTCCATTAATAAATGCCAACTACAAAAA
AAAAACTGAAAAACTCAAACCAACACGAAATAGACAGGGGAAATATGCAAAGACCTCAGA
AAACAATTAGAAGCGAATGGACAGAGGAAGAGAATTCAATTTCAATTTCCGAATTCAGGA
AATCCGAAGGCAAGGCGAACTGAATGATTTCCCAGATGCATTTTTGGCTTTAGGATTTTC
CTTGGTTTGCCTTTTGGTTTCTGTTTTTATCTTGGCAGACGACAAATCGCCTTGCCAAAG
ATAAATATTCACACACGAGGATAGAGATGGAGGAAATACTGCCCTACAAGGTGGCAGACT
GGAAAAGAAAATTATGAGCTCGAAAATAGATTTTCCGGCCGCACTTCGCAGACAGAGAGA
AAAACGAACTATTGCTGAAGATTTGGCCCCCTCTCTCCGTCGTTTTTTTGTCGCGTCTGC
AGTTCATAAATTTCCACATTTTCCACATCCTTTTCCCCACCTTTTAAAGCAAGTGTAGGC
TTAAGACAATCCCAGAAAAAGAAAAATACACTTCGGAGTCGGAGGCATTTTTCACACTTT
GTCACGTGTGGAGCGGCCAAACGGGAAAATTATATACCAATTTTGCATTTCTCTTTTTCT
CTATGCGGAAAGCCACAAAAAAAAAAAACACAAAAAGTAACAAATTTTTGTCGACTGCCA
TACAATATTCGCCTGGCAGAATATAATAGCAACTGGACATGAGCTAAGAAAAATTAAAGC
AAAAGAAACAGAAAGTTAAAAAACAAAACAAAAGTATTTTTAAAGCCACATTTTAGTACA
TTTTACAACGTTACCTATATCCCTTTTTAAAACTCTGTTTTATCCCACACCCAAATTTCC
CATCAATTTTGTTCTGAGTCACAAGAATCATTCACTCGAAAACGAGTCTCATGAGAACAA
AAATCGCACAAAAAATGCGTGTAAATTATCAAATAAAAGTGCCATAAAAACAAACGAATA
AAAACCACACCAAAACAAACCAAAAATGCGGGAAGATAAAGAGCGACAACAAAAAGCACG
CCATTCAAATGCATTTATAAATTGTATCGAAATGAGCCCGAAACTCCGGCAATAAATAAA
GCCATAGAGGGGCGCAGAAGTATCTGGCAGATTGAAAAATTATAACAACACTCGTGAGTG
GCACTCAATTGGAGCACTCAACATGACAACCACTTAATGAGTTAACCCAGCGAGTGAGTG
GGAGAGTCGGCAGGTTGAGTGGATGGCGGCAGCATGAAGACATAAACAATGCATAAACAA
AACCCGCTAAGTGAGCAACAAGTTCTTGGCGAGAGAACAAGTTTCGTTTTTGGGAGTGTG
AGTTTTTTTCGAGTGTTTTCCGAGTGTTTTTGAGTATTTTTTGAGTGCTTTTTCGAGTGC
AGCAGCGCTTCGCTCTCCATCCGTCGCCGGCTTTGTTGTTGGGTCAGTTTTCGAAGCGGC
GGCGCGTAAGCTGGTTGCGTTTTTTGTCGCGATCGCGATCTGCCGGTAAAAAAAAAGAAC
ACAAAAAGTATACTAGCCATGAAAAAAATTCAAATTCCTAACTCAAGGATCTTTTTTAAA
AAAAAACCGTAACCTCACAGAAAAGTGTTTAAAGTGCGAAAAATATTCCCCAGTTGTATT
CTACATATATATTCACCTTCTCGGCCGCAAGTGAAAACCAACGTCGAGAAAAAAATAAAT
TGCAGAAATAAATTGTTCTGGTGTTATACTTTATTTTTTCTGTGGCAAAACAAACGAAAG
TAACAAGAGTAATAAGGTCGAATTTATTATAATCATTTTTCGTCAACGCTTTGGCCCACA
AGACAACAAAAGCAACAACAGAGAGTATAATAACACCAGAACTTAGTGCATTTGTGTTGT
GTGATAAATGAAACAAAAATTCTTTGGTAACAGTCACGTTTAAAAGTGTGCGCACTTTTC
ACCAACTTGTGGTAGCGCGTGTTCAATACACCATTATTTTCACCGCCGTTCTTAAATCGC
AAATAAACACTAAAAATCATAAAGCGCGCAAGATAGTAATAGTAATTTTGTTTTCTCTCT
CTTGGCGATGGGAACAACTGTTTAAAAAACATGACAACGGCGTTAAGAAAAATTACGCTA
GCTCAGCTTTTGGCGAGTAGAAATTACAATATGGCAAACGCAGTTGAAATGTATTTTTAA
GAATTATTACGGGAAAGTGACCATCTCACTCGCTCACTGACGCGTCTGTGTGGGTAAAAT
GCACAGCGAGAAAATAGTCTAAGGTTGTGAATTTATTAAATGAGTGCATTAGTCCCACCT
GTTGGAATCTTCACTTTACAAGTCTATTGCCTTGAGTTTGACATTCTGTTATACATTTTA
TGTATAATATGCCCGAGAATCCGAAGTTAGGCTTAGTTCTGCAAATTCCTTCACATCCGA
GAAGAATCTCATTTGCATCTCGGCGAGCAGCAAATCTCCCGAGGTGCGTATACTTAATAT
CCCACGCGGAAATGTCAAAAAGGAGAACTCAGAGGAGGGAAAATACACATCCCGGGGAAG
CGAGGATATCCTCTTGGCAAGGTCGTTTATTATTATTTACTTTGCATGTTATTGAATTTT
GTTGGGCGCGCACAAGGAGATTTAGTCGTCTTGCTGAAGTTGTCTCTTACTTCGCTGTCT
CTCCTTGTGCCGTATCTTATTCTCCTTTGTTGCAGCCTCACTTTATCTTTGTCATCATTT
CGAGTGTTATGGGTAGTCTGGTTACTCGTGTTTCCATATAGAAATACACACATATATCTT
TGCATCTCAAAGTTTGTGTCTCAGCATCTTTGAGTTGGATTTGTTGTTCTTTCGTATATA
ACTTGTTATATGCTTATCAGACGGGGACCCATTGCTGTTCCTTTATTCATTTTTTAATGG
TTTTCAGTGTCAGTTGGTTAATTAGAGCGCATATGACTCAAATCGGCGGCCCACTGGCGC
CATCTGCCCGTCCACTCGACTTTTCTCGCCTCTGTTAAACTTTCTAAACTCCATCAATAT
TGTTAATTTATTTGCTCGGACGGACTGCATGCTGTGCCCCCAATTTTCGGCGATTTCCGT
TTCTTAACCCCTGCCAAATATCATTGTCTGCCGATCTTTGCGATGATGTCAGCTTAAGTT
AAAATATTTAACACCCATGCATACTGTGTTTCTGCTCATTTGAAGTTTTCATTATCAAGC
ACGAATGTTTTATTCCCAGTCTAAGTGATCAAATTTCTTGTTTTATTTTTCCAGCCGCAA
TCCGTATCGGTTGTATCGGAAATTCTAATTTCCAACACGCTCAAAGTATGTTTTCTGTTT
TTCTTTGTTTTTTTCCCATATTTTGTCTGTCGTTTACATTCCTGTTTTTATTAACCCATG
AGCACTGGTGGGAGCCCCTGCCTCCGAATTGAAACGAATCTCACCCCATAACAATAATAT
TCATTTGGCACAAGAGCAATTCCCATTTCCATTTGCATTCCGGTTACAAGTAGAACATCA
TCAATGTGACACATTTATCTAACATAACAGATAACTCTGGTACTTTAAGGGTCTTAAGGG
CTAGATCCGTATCTCCAATGTGATATGGTGCTTTTTTATTGAAGCTGTTGACAAGCCATT
AAAATTATTGTGTACGACGACCAATAAAACAGCGGGAATCAGCTTGTGGGGATTTTGAAC
TCGAAATCTGAGAGGGGGTGACCCACTTGAACTGCCAGACAGTCGCGATAAGAAAAGGCT
CCCTAACTCATCTGCTCATCGGCTATTCCCGCAGTAACGATTCTCAATTGAAAGCCGAAA
TGTTAATAGTGAGTCACAGAATATTTTGATTTTCCTGACTGCCCCGGATCAACGACCAAT
TAAGGAATTGTTCTACAGCTGTCAGCTGAATAATTTCGAGGCGAACACAATCGGTTGCCT
CATTTCATTCGGGGAATCTAGTTCAACCTATTGACACTGACGATTTCCAATAACCCCAAA
GCTATTCGACCTTGAGCGCCGTTTAATAACCGATTGGGAGACCCAGTTCCCACACAAAGA
TCTGCTTTCAATAGGAACCATCCACATATTTTAATGCCTGGTTTCGGGTTCTGATGAGCC
GGCGCTTTTCACATTGCCAAGACACACCGATACCGAGTCTCCCCTTTCGCGAATTTCACT
TAAATTTCTCGAATTCACTTATTTATTTATATGAGTGCTTCACTTATTTGTGCATAATAT
TTACCAGCCGCAGTCTGCGAATTTTGCGATTACCGACGCTGTTGCTTGCCATGTGCTCGA
CATTTTCGTACTTTTTCGTACATTTCACGTACTAAACGCCATTTAAACGTCATATTTAAA
CATGCCTGTACGTATCCATATGCATATGCATATGTGGTATGTAAAACTCTGTAAACAAAC
ACCAGCGACTGAGATCGGATACCCCATCATGTGCTTCTGTTTTATTGCGTTCCATTCGAA
TCTGTTGTTTTGCGATGAAGAAGGCTGTTCCGTTCCTCTGTGGACTTTGGTTACTTTGGA
GTTTAAGTACATGCATGTGTTTATATGAAGAGCTTTTCGAATAAGGAACGCCAAGAGAAC
GAAGAAGAACCAAATTTGTTACTCGAAACTTCTGCAGCTGCAGTATGAAATCATCAGGCT
GACAAAAATGAGGGGTTATGTAGCGGGTATGCAGGGGGTTATTCCAAGTCCTGGGGAGGA
GTGCAAGGTTTTCTGGGAATTTCGAGTTCACAAAGTGTCAATAATATTGAATTCTTCGAC
GATTAAGGTAAATTCTTTGAAGTGCAATCTACACTTCAAAACAAAGTATGTAACGTGTTT
TCAATTCTCTTGTGTACTTAATCAATAAAACATCTCAATATATTAACGATAAATGCAAAA
GATCCTTATTACAACATTTGAGTACCCCAAACGCACTGCATCCCATAAATACCACATTGC
CGCAAGATTGTTCACTATTCAGCCAGCGATTTCCAGTGTTTGCCAAATTTGGCGAAAAGT
AATCTATCCACACAAGCTCACTTTCTGGCCACGTCCTTATATGAAGAACATCTTGCGTTG
TTGCCACAGATTTTGTGTGTTGTTCCCTAGATGCCGACCATGTGTTCGCCATGCCCCCTT
TCAAGTTTCCCCGCGCACTTAAGACACCCTCTCTTCCGTTCCGAATTGCAAACAGTTCAG
TTAAAAGCTGAAAATTGTTTATGCTAATTGCACTTAATTTATGCATGCGTACTGTGCCCG
ACGAATGTTTGTGCGAGCGGGAGCGAGATACAAAAGTATCTGGAAGATACCGTACGACAT
GTTGCGCCTATCTTGGTTTGTCTCTCCCTCGCTTGATATTTATTGGCACGCCAAAACGCG
CGAGTGAAGTAAATATTTATTTCGGCACAATTAAGGCTTCCACCACGCCTCTTTAAAGAA
AAAAGTGCATTCGATGCACATTCCAAGTGTCATTTGGCATTTCGGAGAGATTCGCACACG
CGAGTGAACACACATACCTAATGTCTAAACTTGGGCAAATGTCAGGCGATCTCGAAGCTT
AATCCTGACGCCATTTAGACGGTGTCTATTTCGGCCAATTAATATGCAGTTAATGGTGCT
AACGGTGTGACGTGCTTATTTATAGGCCCGCAGATGCGACTGCAAATGGCAAATGCAGGC
GGAAAATGGCAATGCAACTCAATTCCACCAGCGCCAAATAAATGGCTGGCACTCGCAGCT
CAGACATCAGCCTGGCGCCACAGCGCACATTTTGCATGTCAATTCGGTGGGGGAGAGGGG
GAGGGGCTTTTCGCCTAAAAAGTATCTGCCGGATTGCATAAGAAAGTCGGGCATTTTCGC
CGTTGTCAGGGTGTGGAATAAAGTTCACTCGACTACTCCAATACATCTGCATCTGTACCG
GGAATTCAACTCACTGCGAATAACATTTTATGCGCATAAAGTTTGGCCAAGCCAAAAGCA
GTTAGATATTCGATAGGATATCTTTAACTGTAGGAAAATTTTATGAATAAGGTAAAACAG
TATTTAACCCGATTTGAAAGATATAACAAGTCGATTTTATTTCCCATGAAATGTTCGGCT
TAGCTTATGACTAAACAAAGTTTATTTACTATTTGTTTTTTCTAAGAAAATCTCACTAAA
AATATTGGTAACAATTTTCCATAAAAGATTCTTTTGACCCTAAAACTTCAATTCTAAGTG
CAACTGACGTGCCCCAACGAATTTCATACTAGAGTGAGTAAAAGCACCCATGTATCGTGA
ATAATATACATAAATATCTGCCAAAAAGCTGTGACAAATTCCATAGAGAATGCATCTCGA
CAGTCGAATGCATGAATCAAATTCTGTATCTCAATGAACAAGTGGCATTTGCAGCCGGTT
TTATCTATCGGCAAGCTTACTACAAACCGAGCGCAGAAAAAGTATCTGACAAACGGAGCA
ATTCAGGTAATCTGAATTGGCACCCTCACTTTGCTGGCATTGTTCTTTCTTCGTGGCTGT
GTGAAACATATATATTTACAGATTGGTACAATTCGGTTTATTGGCCCAAGACATGGCGGG
AGTTTTGCGCCCGATTCCTCACGTAGCCAACTTGCTGTAGATACGTTTTTTTGCCCATCC
TCACGCACTTGAAGTGGAAAACAGTGGCAGCTGTCAATGGAGAGTCGATGTCAGTTGTGT
TTCGATCAATTAAAAAATTGCTGCACTAATTGTGGCGTATTTATCGGCTGCATTTGCTGC
CGTTGCATCGCTGACACAATCACTTTAATTGAGCAATTATGCAGTTGCACTCAATTAAAT
ACCAAGCGCCTCTTTTTTTGGGCAGACAGCTCAATTAGGACTCCTGTTAAATTGATTATA
ATTCCACGAACTCTTACAGTTCTTAGCCTGTAGCAAACATAATACCCAAGAGGCATACTT
GAAATCTGTAACTAATGTTAAGTATTCATGATTCCTAATGATCTAATGAGCTCAAATGTT
TGTCCAAATGTTCACAACCCAATTGAGCAGAAAATGTACTCACTATTTGGCTAAGAAGAG
GGGGGGAAACTTTAGAAAATTTGGCCAGGTACCCATCGCATTGAGTCATTAATCAAAGTC
AGAGTTCGGCCCGCATCAAAGTCTGCAAACCAAATCGAATCCAGCGTATTTAGTCAGCCG
TGAAGCATTACCAAACTGTTATAAAATGACCAGAAAAAAGGGGAAAAGAAAGTTCCAAAT
GGAAAAGCTTTTCCAAGCGACAATCTCTCTAATGCAATTTTAATTAGAGCTTTATTTATG
TTTCAACATAGAGAAATTCCATCTTAAAGACATCCACAGAAACTACAAAAAAAAATCTAT
AAAGTCATGTTTGGATTACCACTTCAAATATCCATGCTCGAATTCAATTGCACCTAATTT
CATCGATTTTTATTTGCATACTCTGGACCCAGACATGCATAACAATAATTTTTGGTTGTT
GTATTTATATTTGCACAGCAGCAATATAAACATTTCTCTTTATGATTATTTTAATTGAAT
AAATACTGGCAGTGTGTGACCAAAACAGCCAACCCACCCATTGATTCACCCACCAAATCC
ATTCAACCTCCAAGCTGCGCAATTTCACTCCCATTTATTTATTAAATAAACATTTTCCGA
TTACCTTTATGGATGCTCCTGGTTGGCTTCTTTTCGGGTTTGCCAGTGTGATTAGTCAGA
GCTTTTATCTAAAATGGTCTGGTCTATACAGAATAAACATAAAAAAGATGTGGAAATTTA
TTGTGCGGTCAAATTGGCTTAATCTTTTGCTGCACAGTAAGGTTTTCTCTCTAATACAAT
TTAATTGTTTGATTATTTTAAGTAATGCATAAGAGGCACCTGCAAAAAATGTTTATATAA
ATATTTATTTTTTAATATGCCTAATTTGAACAGCAGAATCTGCAACATCTGTTGACCAGT
TGAGTAATTGCTCCAGTTGATAGATAGGACCCAAAATCTTTTATTTTCCCACCCACCTTT
TGTTTACTTCCTTATGAATATTTATTCAGCCAACGCTGAAAATTGTTTACATTTCACTAT
ATCCAGCGAGAAGAGACTTTAGCCCCTCGTTTTGTTTAGAGAACTGGAACCATGCACTTT
GGGTAATTAGCAAGTTTATTTGACCCTGAGCAAAGACCACCGAATTGAGCCAAAAATAGG
CCACTGGAAAGCGATTCGGTGTTGTAAATACCATTCGTTTGCGAAACCAGCAATGTGAAA
TCAATAATCATTTAAAATTCAAATGCGAGCAACGCATGAACCGGAAAATGGCGAGCAAGG
AAACAGAGGCCGGCGAATGCAAATTGGAAAAACAGATAATGAAAAATCCAGAAAGCGGGG
GTTAAAGTAGGCAATGCCCTCCATGCTAATGAAATTAAAAATTGATGCTTTGGGGCCAGC
GGCACACCAGTTTTGTGTGTAAAGAAATCTAGGCGAAAATGCTAAGCAAATGTCGTTTAA
TAAATTGAAAAGGGCCGAAAGAATAGGGTGTTGGCTTGGCTTGGCGGTAGGTGGCTGCCA
ACCATGCCTATTCATTTCTATGGCTGATTGATTTTGCGGCGTTGGCGGTTAAGTGGCGGA
CTTTGAGACACTGAGACAGCGAAACGCTGTGCACCACAAGAAAAGCCAAACGCCGCCGCC
AACTCTTGACACGTCTTTTTGATAGAGTTGCCAGCGGAGCACTACGATCTGGCCAATCTG
ACGGATCAGGTCGGTCGGAGCGGTAGGAGCAGTAGGGAGCAGCTACATTTTGCGGTCTGG
CCTGGTTGCTCAATCTTCCTGGTTTCAACTGCCACTGCCGCCAAGCCGTTGACATCAATT
AGCTATTAGACATGGAGTTTGGAGAGGGAAAAATGCAAGATGCTTTAATCTGTACGGCAG
GAAAGTAGTGTTATTTTAATATAAAACATTAATATAAAACAACGGAAATACCAAATAATT
TACTAAATACCTGAAGAAAAGTAAAGTACACATCTTATAAACTACGAATTCCTAAAAAAT
CGAACTCTCATTTGATTTGGCATCTAATTGGATTAAGACTACACTCTGTATGACATTTGC
CATGCAGTGTTTAATCAATCGTTTTTGTTAGCTCAGAACCTTTTTCGCGCAGTGTCCTTA
TTCAGCCAGATAGTAAAAAACTATCAACATTCGTTAAGGCAAATTATTGCATTGCTGAGG
CGAAGATAGTTGCAGTCCCCTTTCGGAATCCATCCACTTATCATGTGGGCGTTCTTCAGT
CCGGCGCCATCTGGCAGTCTCCTTCTGTTACCAACTGCCTTTTCCATCCGCCATCCGCCA
TCCGCCATCTACCATGTACCATCTAGCATCTAGCAACTTCCATCTTCCCCCCGGCCATCG
GTTCATTAGACGCCGCTCAATTTATTTCTCCTTTACACGCCAATTAATCAGATTATGTCA
AAATGTGTCACTGGGTTAATGCAAATATATTACGATGGCCATCCAGTCAGGCAGCCAGCG
AAGTATAGACTCCCCCGGGATCTCCGCTTTTTGCCCCAGCTCCCACTAAATCGATTCGGA
TGTCTGGCTCTTGGGAGAGGCTTTAAAGCGTTTTGTCTGCCATTCGCATTTGGTTGTTTG
GAAAGCGCTTAGATCCACTTAATTAGTGAACTGCATCCAACAAAAGCGGGGAAAATACTC
GCACAAAATCACTTTTAAGCTGATTTGGATGGGTATAGAAAGGCAGAGGAGGAAATAAAT
CAGGAAATTGGAAATAAATTTGTCTACCTCCAGTCAGTTCAAAATAAAATTGTTTAATTT
CCGAAGAGAGCGAAGCGATGTTTCAGTCTTTGCGTATTATTAATCTTGCATTCACAGTAT
ATACTTTGTAAATATATTGACAAATCATTTGAACTCCTTTTTCATTAACTCGAATTTAAA
CAGGTAAACGGCATTGCTCTGTACAGATAGATCTCCGACTTTTCGGTACACAAAAGGCGT
ATCGTTTTCAGTTTTGTCTAACATAACACCACTGCGAAACAAGGCAATCTGACATCTCTC
AGTTCGTTTAGTTACCTTGGCGACTGAATTTCAACAGAAAATCGCGTTGGTAACAATGTA
ACATCAGCAACTCCATCGGATCCCCCAGCATTTTTACCTCTTCCGACTCCACACTCCCAC
CGGCGGAACTTGTTCATTTGGCATTCAGCAGAAAAGTCATTAAGTGACACACCCGCCTAC
AAAATGCCCCCAAAATAGATTCCAGCATATTTATCATTATTTTTTCTGCTTCACGTTTTG
TCTCCGAATAAAGGGAGAACAATCATGTAAAGCTGGGCTTGGTGCAAAAAAAAAAAAACG
AGGAAAAATAATAAAACGAGTAAGGGGTGGGCATCTGTCAGTGCTTAATCACGCATATCA
CCCAACTTTCCGAGCTCAAAACCAGCTTGTTTGTTTTCGGATTTCCATTTTTTTCGCATT
TTTTCAGGCTGTTTTGGGTTTTTGGGCGTGTTTTAGCTCGGCTCATTGAAGGCGGCGCAC
GGAAGTTGGCACCGCAACGGAAATTGAGCCATCAAAAATAATGTACAACCAAAAATATAC
ACGATAAATATACCGTATGGCATACAAATTCAGGTGCTCGACTTTCGCTTTTACCTCCGC
CTCTCGAGCAGTAAAAGAAGAGTTGTAAAAATACTTTACAACTCATTAAAAATTATTATT
GTTCCCTGCATAAAGATGATGAGCCAGGATGAGCGAGTCCTCGGGGGATCCTTTCTGCAG
TCCTTTGCGTAGGTGTCAATCGCGATCCCTTTTCGGCTGCTCTTCAAACAGAAATTGGCG
TAAAATTTTGCGGCTACATTTTGAGGAAATTTGATGGGGGAGGTCAGATGGCAAAGGTTA
AAACTCGTTTTATTCTTATTACTGTTGAAAAGTTTTTTTGCTTAAAGCGGCTGCTTAGTT
CCCACGAATTTTCCGGGTAAAAGGTTACGCAAAGTTTCGCATCAAAAGGCGTTAAAGGTT
TCGAAAAGAGCAGACGGGTTTCGAGTGCTTCCCAGAATGTTTAATTCAATTTGTTGAACT
AAAATTGCGCCCCTGGTTTAATGAAAGTTGGTTAGCGGCAGCTTGTTGCCAAGTTTCCCA
GAGATTGGAATGTGGGAAGTGAAGTGACAACGATAACAGGTCTTCGATTCTCTTAATCTC
TGGATGAGTTTATATCAGAGCGGAAGTTGCTTAATTCCATAAATGGACCAGATTAATTTA
AAACCTGTAATGCCATGTTTAAGGTCTGTTTACTATCGAAGAACATTTTACTCCGGATTT
ACACAATCAATTGGGTCAACTGTTCATGTTTTATTCAGGTTTTAAATTATTTTTCTCTGA
TAGTTTTGTGATAATACTGCTTTCTTGTCTGAAACGTTTTTATTAATCAAAATGGAAAGA
ATTTCCGTGGTTTAATCTCTGTGCTTAATGGGCATATTTAGTAAATGTTAAACATTTTTA
AAGAAATTGTTATAAATAGCTATGCATGCTGGGAAAATACCAAAATACGATAATATTTGA
AAAGAAAACATTGCTGAATGTCGAACACAGCATTTTATCGAACAGTTCCCATCGATGGGA
TGGCTTTATGTGCCCCATCCGTAACATAACTCACTCGCCCATTACTCCATGTTTGTTCAA
CAATTTCGCTAAACGTTTTACAGGCCAAAAAGGAGGTAAATGTTCGAAGCCCAGGCGCCA
TTTTCTGCTGAGTGCCGTGCAGCCAATTCAATGCACTTTATTAATGGCATCCATGACTTG
GCCCGACTCTCCTTTTTTCGGGTGATTCCCCTCCCCGAGCTCCACGTGCACCCCCCCTCC
CCTTCTCCACCGTCACCAAAAGGGCGACAATAAAGCCCACAAGAAGCCAGCCATATCCAT
GCTCCTTCCTTCCTTCCTTGTCTGCTGCAGTTGCACTTAATTTTATCTATTATCCTCCAT
TTTTGTCATTGTCTAAGGAAAATGAAGATTCAAAGCCATAAGTGTGTGTGTGTGTGTACG
GGTGTGTTTGTGTGTGTGGGCCATCAATGGCAAGGCAAAAGTTGCCAGCATGCTTTTGCT
TTCGGCTTTGAGCCTTCGGTCCATTGTTGTTGGACGGGAATAGAGGATCTCTATCCTGGC
AGCAGGTGTGCCAGTGAAAACTCAACTTGTGCTGCTGCTGCTGCTGCTGGCAGGTTGGTT
GGAAAATGTGATAAAATGATTATAAAATAATTTTCACAAACAATGGCCAGGACATGCACA
CAGACGCACGTCCCTCTTCCGGTTGGGCGATACGTGCAAACTTGTTCTCACTTTTTCCAC
CCACATTTTCCAGCCGCCGGGTGGTCAACTCTTCTAATTGAATAGATTATACGGGGTCGG
GTCTTTAATGGCTGCCAACCTCAAAGTCTGTAGTCTGAACTAATTTCATTCTGGTGCTTC
TCGAACTCCTGCAGCAGTCATAAGCGAATCTCTCATAACGTTTTACTATTGCCATAAATA
TTCGTATATTATTATGCGCTGCTCCCCCCGCACACTGCATTTATTATTAATCCAAATGCG
TGGCCATAAAATGCTGTGAAAATTACTTTTCCCGCTGGCACGATAGAGACGACTTTGTCG
GCCGTAAAAGGGAAAACCTTAAAATGGAACTGCTTGAATGGGTGGAAAACCAACCAGGTC
GATTAATTGCAAGCAGGACCACACGGGGAAGCACTCCACCCACTCGCCGCCAATCCCGAA
AGGAAACATTTGTATCTGGCCAATAAACATGTCTTAAAGCTCGCTTGGCAGACACAGTTT
TGAACCAGTTTAGCTGGCCCGCCACAGATGCAGATACTCAGATAGAGAGTCCCAATTTGT
GCGAATGCGTAGAGCAACCAATTTGAGGCAAATTGCCATAACGAAGCTATGCAGCTCCAA
AAGGCTCAATAGCAGTTGAACAGAATGGACAGAATGGGGCGTATTCTGGTCGGCGGGATG
TTGAGGGAGCTAAGGAAGTCGGCGGAGCAGCTGATGCAGTTCACATTTGCAACTTTATTT
ATCGCTTCGAAAACATCTTGTAAATTTTCCACGTTATTTTCGCCGGCGGCCAAGTTCGTT
CTTTGCGGAAAATTCAACAATTGAATCCAAAGCGTTTCCCCTGCGCCACCCGCCCACTCC
TTGGCGAAAGCCAAGTCGAAATTGATATGAAAATTCGTTTTAAGTCGGAGAGAGCCTTCA
GTGCCACGCCCATAGCCTCAAGGCAGGACTCCACCCCACCAGCCCTCCGCCCCCTTTTTC
GATCCTTTCGCCTTGTTTTGATCATTTGCCTGTGATAAATTGTTCCATGTCGCTTGGCAC
TCTTGACTTTTATTGCTGGCCATGGGCAAGTCCACAAGTCTGCTGGCCATCAAAATGTCT
TTTGCTTTTTTATGCCATTTGATGCAACCGAAACTGGGTAACTTGGCCCAAATGCACTGC
CACTGGCTTTGTCAGTCGGTTTCAGTTTATTTGCCGCGCGACAAGTCTGTTTGTGTGTGT
GTGTCTGCTTGCCAGGCAAATACAAATTTGATATCATTTTTCAACGCCAATTCCAGGCAG
CCTCATATAGTGATAGTATATAGAATGGAAATGTTCTCTCGCATATGTTTGAGCCCTGAA
AATACACTGACGTTTGGGGGCGCGGCACCCACGGAGTGACTTTTGTGGTTTCAATTTTGC
CGCATGACGCATGAAATTTCCGCTCCTTTTTTGTGCGTTTTCTTCTTTTTTTGTATTCCT
CACAGCGTCATAGCGAGGCTGGTAAAAAATGGGCAAAAAATGTATTAAATTGAAATCTGT
GTTCGTTATTGATTGGATTTGATTTGGGTTAAGCAAGTGAATGGAATTTGATTTTTATTG
AAATCGTAGGCGACCTTGCTTGATAGAAAGGGATCTATTGATTTATTCTTTAATAATATC
ACCGAATCCCTTAACATTTTTTATAATTAAGCCTGCCTTATTTTGGATGGCCTATTAAAG
ACATAAGCAAATGTTATGCCCACACATTTTACTCTTTTGTTCATCATTTGTATGGATTTG
ACAATCGGAAAACAAAAGTCACAACTGGAAAATTATTCATGGTCGGGCACTCAGAACTAG
ATGGGGAATTCTTTCTCGTGCCCTGTGAAAATGCATAAACCAAACAGAGCGAGACCAGCT
AAACAAAAGCCCAGAACCGAGGGTCGCATAATGCACTTTTGCTTTTCTTTTTTTTTTTTT
TGGTTTTTTGTATGGTTTTCCTTTTTTTTTTTAAATTTTGTTGTGTGTCTCTCGTTTTTG
CTTCTTGTCCTGCTCTTTTTCCAGCTGAAATTTCCGGTTGGGCTTTTGTGTAATCCGCCA
GAGACGCGGCTTTGCATGATTCGGATTCTTATTTGTTATTGGTGGTTTTCAGAGTTGAAT
GACTGCCGTGGGCTGCTCAAAAATTCTGGACACTCAGAGTTTCGTCGGTTCAATCAAATT
GCAATTATCGTAAGCACGTGGTTGTGTCCTCCATTTGGTGGGTGCGGACCAAGTTACCTC
GTCGAAATGATCTACGATTCGTGACGCTTTTGATTTATGTGTGCTGAACCATTTTCACAG
CGATATTCAATGACTCAGCACTTGGATTCTGGATATCTCATAGATTTATGTATCTTTTGG
ACTTACAGACCGTGCAGTGGTGATATGAATGTGAACGCAGGGCTTTCTATTTCTAGGCAT
GTATCTTTTTGGGAATGAGGAGGCTCAGCTGGGCAACTTAATTAGGTTTGTTGTTGTTAA
ACAAAAGGCGAGTATCTTGTATCTGAATGGCAGGTAAACGGATTAATTTTTCGGCGCCTT
TCAAGACTCCCCATAGTTTCTCACTTTGGTGATTTATTAGGGTTCGTATTTTGTTTATTG
GCCAGTAAAATAGTTGACTGCTCCGCGTGTGATGAGCATTGTGGATTAGTTTCGCCAAAA
ACAATAAACCGAAAGTGAAAATACACACTTTTGATTTGCTCGCTTGATAAAATGCAAATT
CGATTTGGTTTGTGTAACGCATGATTAAGCAGTTGAATCGACAATCTTTGTAGCTATTCA
GTAATTTGATATGATTTTACTTTTAGCTGAGCGCCCGGGGAAAGCATCTTCAATCTGTTG
CATATCAAATTATTGGTAAATTGTTTTCCTTACCATCCTTTTTACAGTCATAGTGAAAAC
ATTTGCATTTCCATTGGCAATAACAAATGCATTCCGCACACATCAGCGTCACATTCTATC
AATATCAATTCATATTCCTTCATACGTACGTTTGTGTGTGTATCTGCAAGAGGGGAAGGA
AATTTTGTATGCAAGTCGACGCAGAATGTTATCTCTCTGGATGTACGGGGAAAAAAGTGA
AAATTATAATGAAATGCATTGGCATTGGCATTTTCCTCACGTACCCACAAAGTACATCAA
TCAAATTGAAATGCAAGCATCATGCCGGCGCTGCTTTTCAATATTTCGTAATGCATTTAA
CCATGCTAATAACAAAAAAGTAATGCAATAAATATTGCATATTTTCACTCCAGTCTTACA
TTCTCGTGTGGTGGTAACAATTTTTGCATTTTCCACGCGGCTATATATTCCAATTAGGGT
TCACATGAATTCAGAGATGGTCGCGTGATTTTAAGCGCCATATAGGAACTATGTATGTTT
TTGTATTTACATAGGTTGCATTCGAAACGAATGTGTTTTGAATTTATGGAGTTTAATAAA
CTTCGGATGTGTGCAAAATAAAATATTATGAAAATAAAACATTATAAAATCTATGGGAAT
GCAAATAAGCTCGTGTCACGAGCTATCACGGACACATCGCTAGCAACCAGCTTTCAAAAA
GAAAGAGCAACTGCAAACAGAATTTCGAGAAAAATTAAATTTATGCAAAGCCAAAAAGAG
ACGACTGCATCGAAGAGTGCGATGGAGAACGGAGAATGGGGAGTGGAATGTTGTTCTAAC
TAATTAGACACTTGTCATTCGTAGTAATGTTGTAATAAATACCGTTACAATGTCATTACC
GGCATTACTCGTTGGCATTTCTTTCGCACCACCTCGTCCCGTCTCTTTCGCGCAATCATT
CCGTCTCTTTCCACGCTTTTGGCCGCACTCACTCATCAACGCGGCGAAGTCTTTGTCAAT
GGCTTGTTAGTTTACTTGTCTCCACTTCTGGCCACCCCGCTCCCCTCTGGACTTTATTTA
AAACTTTGTTTTGCTTTACAGCTTAGAATTTTTAATGAGCTTTCCTCTACCGCGTACTTC
TTATACCCACTTTTTTCCCAGTAGTTCTTGGTGGTTTTCCGCTTTTCGTCGGTCATTTCG
TTCCTTCTTGAATGTCATCTATTTTCGAAGCTTGTTCTCTGCACACTTTTTCTGTTGTTT
TTCATTATTTTCTATGGGGCTTAAACGGGGGTCATTGCTTAGTTATAGTCACTTGAGACG
AACTTGACCAAAGAGTCAAGCCGTATTTAATCTTCCATTGAAACCAGAACCCAGTTCTCA
AGGGGTTCCAACTTTTTCAAAGTCTCAAAAGACCGTCATTTGCATGGAATGTTGGTAATT
TTTAAAGCCGTCAGAAGATTAAATTATAAAAATTATAAAAAAAGATAATTTAATTAGATT
TATTTCAATATTATCTGCTATAAAATATGTATATGAGCAAATAGGAAGCTCCACTAGATA
GAATAACTATCAGAAAATGTCAAATTTTGTTGTAAATCTCTTCTAGATTTACTGATTCCT
TATTGGACTTGGTTGTTCTTTGTCTCGTAGCTCCTAGAAAAAATTTCCCATCTTTAACCC
TATTTTATCACATCCTCGTTGCAACGTTGTCTTAACAACTTCCTCTGGTCTGCCCCAAAA
TGCATATATGATCGTTCCACTAACCTATCCCACCTTTTTATTGGTTTTTCCCAAAGACCC
CCTGTTACTGTTTTTTTTTTTTTTACCATTCCACTCATTGCACCTTGGCAATGCCAGAGA
ACCAAGAGCAGAACCAAACACAGAATGCGAAGACAAGACAATAAATGTCTTAACTGAAAC
ATTGGAGTTGGCTTATCGGCGAGTAAATATTGCCCAACATAATTTACACACACCAAACGT
CAGGGGGAGTGAGCGAGATGGGAATAGATACATGTAGGCAGAGGCGGGCAACAACAATTG
TGTAAACAGAATGCAGTCAACCTTTTTGCTTGGCAAACAGAGCCAAGATGTCTGGATAAT
TAACGCTAGTCAAAAGTTGGTCGGCTTTGGGGGGCGAGCGAGGGGCGTGAGCTGGGAAAT
TTCGGCGTAATTGAGTGGCTTATTGACTTGGGGCATATTTGTAGTACGAATTACACACAT
ATATTTGTATGTGCGTGCTGTGTGTTTCGGCCGCCCTTGTCATATTTGACCCGAGCAGAA
GAGAGAAAACGGAATTATAAACGTAGAATCCTGTCGAACCGGTTTTATAAATAGATAAGC
GCATAAAAACAACGTTCATTACGCAAGAATGTGCCCTAAAACGATGCAACCAAGTGCCTA
AGTTTTTGTTCGGGAGGAGCAGCATCATCAGCGAAAACCTGAAATCTGCATAGAGCAAGA
TTAATTAACTCGCCCCGCCAGACGATCAGCAACGTCGGACAGCGAGGAGCAGCAGCAGCG
ATATCAACGGCAACATCAGGAGCCACTGCAGCAGGAGTAACAATCTGCAGCAACATCGGT
GGCAGCAGCAACATCCACTGCAACTGCAGCAACTTCAATTGCTGGAAAAAGGGCAGCAAC
CATATCTCGAGCCTAAGCAACATATGCAGCATCTGTAGCAGCAACAGAAACAGAAGAAAG
AAGAATCAGCAACACTAGTTGCAACATACGCAGCACCAGCAACACCAACTAAAACAATAG
CTTAAGTAAAGGGAACCCCTTGCTGGAACAGCTTGTCTAGGATGCGACTCTTTGCCAGCA
GTGGCCAGGCTGCAACATCGCCAGCACTGGCCCACAGTTCCAGCGATGAGGCTGGCGAGG
TCATTGAGAATTCCCATACCAAGAGAGCAGGATGCTCCGTGCTGCAGAGCAGTGGTGGAA
AGTCAAGGTCGCTGGAGCGTTACTCGGGAGCACCCAAGATACACCAGCAGACGTTGGAGA
TGCTGCCGCCCTATGCCACGCCCACGTGCAGCACCCGTCGCCGACTCCTCGCCCCCTTTC
GATCGCTGAAGCGTCGCAGTCGGAGCAGCAGCAGCAGCAATGAGTCGCACCACTTTGGCA
ACCATCTCAACAACCTGGTGGTGGTCAATGTAGGGGCGGCCGCTGCAAATGGAGGTGTGG
CCAAGGCCAAGGCGAAGGCCAGCTCCCAAAGCGGTGACAGTGGAACCGGTGGCACCGAAT
TGGAGCATGAAATGGAACAGGATGACGACGAGGAGGATGAGGAGGAGGGCGAGGAGATGG
ACGAACTGAGCCTGAGTTACTCGCAGTTGAGCAGCAGTGGCTGCGAGGAAGCCGAAGCTC
CACCAGAAGATGTTCCTGATGATCGACAAGCAGCTGTGGAGGCAACAGTCTCTGCCTGCG
TGCAACACGTTGCCAATGAGCGGCGACGCAACATCCTGTCGCTGTACTCGTCCTCGTCGG
AGGAGCAGCTCCACTGCCGCCTGGGCGACATTACGCTGGTGGACGATACCTACTCCAACT
ACGATCCGCAAAACGATGCCGAGCGCATGTTCCTCCAGGTTGTCGGAATCTTACGCGATG
AGAATGAGGTTTGTGTACTGGCTAACAGTGGTTGGCTGAAATATTGGTCACGCCTATAAA
CTTTAGGTTACCATATGCAGTCGAAGTTAATACTTTATGAGATGCCTTTATATCTTAATA
AATACGATTTAAAAAAAATTATGTGATAAAAGTAAATCAAAAGAAAAAGATAAAACTCAC
ATTTACATAAAAAAGGTTAACTGTTTATTTATAAGTTCATCACACATTTTGGATTGAAAA
ATCGTAAAAAAAGATATTTTTTAATCTGCGATATCATTCATAATTTTAATTAAAAGAATG
CTTGCCCGCTTTATGTTTATCCATCTCTCTTATCCAGCATTTCCTTTGAAATCTTGATTA
ATTTCCACCCACAGACTTAAAAGCTTCGTTTTCGTTGTTGGTCGTGATTTATTCAAGTAG
ATGTGTCCTTGCTAAAAAAAAAGGAAATGGCAAACTGCTAACCGAGTTTTCTTTTTTCTC
CTTAATTTTCCCGCTTTTTTCCCCAGCTTTCCCTGAGCAAAACTTTTTCAGACTCACTTG
CAATTTCAATTAATTAATGCAAGCTAGGATTGCCGTTTTGAGCTTCACTGAGCAAAAGGG
GTAAAATGAAGGGGGAGTAAATCAAGACGGAATGAGCAAAAGTTCGATAAAATAATTGAT
TTAACTGCAGAATCATTCTAATCTCACCCCTGCTTAAATCGCAATTCTCTTTGCAGTCAT
CGCCTGGCAAAATGTCAATTTAAGGTACACATTTGTGCCATTTCTCTGGCATTTACTTAC
CTCCTGTGGCAAACACAAAGCATTTTTAATAAGCTCTGTGGGTGATGTGAGTTTTACATT
GACAAAAATCGGATCAAATTTTTTCGATTCTTGTTAGTTTTTTATTTGACAAAAAAGAAG
TAAAAAAATATTTATCTGATTTACATTTTTAAGAAATGAACTCGGTTTTTAGGCTCTAAT
AAATTGCATTACAAGAAAAGGGAAATACTTAGAGTACACTGATTTTTTCACCGTGCTACT
CTGCGTGATGCCATAGAAAATATGGCGACAGCATTCGCTTTTTTTTTATTTAACCAAGTT
CCCCGCTCGACAGCCGCAGGTGGAACGCATCCAAGGAATTGTTATGGAGTCAAGCGGATG
GTATTAAATTACACAGAGTTGCACTTTTTAAGTACACACCATGGACAAACGCCCTGCGAC
TATGGCCACCCAATCCCGACCGCCTTGTGGGCCTTGCAAGGATTCCCTTTGCCACAGAGG
CTCACAATGCATGAAGCCTGGACTTTTCTTCTCCTCCGTCGTTGCTCGCTGATTAAACTT
CTTCCAAGGAAGGCAGCTTTAAAAGTGCATTGCCCTCTTATCAGTGAGCCAGCCCATTGC
CACCCAGCCACTACCTAGTGCAGCCCAACCCCCGATGACTTTTTACTCAATGACTTGGAT
GGCAAACAGCTTTCTTGTCTCTTTGTGGCGGCGGCCACTTTGTTGGCTTGTTGCCACTAA
TTAATGGCTGAGCAATGAGTGGGGAGATGCATATTTATTGTAAACAACAAATTATTGATT
GCCAACGACAAGTTGGCCACAGCCTTTGGGCGCCTTTGTTGGCTGCGTTTCCCGCTCCGC
TAATTAAAAAATAAATGCGAGCCAACTCAAAGCAGCCACACACAAAGGATTTCAACTGAA
GTTGCTCGCAGTGCAGCAGGAAATAATTTGTGTGCTTAATTAGCAGAGGAGGTGAAAAAA
AAATTATAAATAAGAATGCTTTCCCTTGAGTTATGTGGGAAAAAGATAATGAGCAGGGGA
AAAACCACTGAAGAAGCTTCAAGAAATTAAATATTTATAGTTCAGGGGGGTTTATTACAG
TAATCGAACATTTTAAATCACTGAAAGAGTAAATCTTGTTTTGTGGTCTTATTAATTAAT
TCATGTATATAAATATATATAAAGAAACGATTGTTATTATTATATAGAAACCATAATACA
TTTGGCATTGCCAAAATATCTACTAAATTGTACAAGACTCCTTTTTTTTAATTCCTCTCT
ATCTGCTCCAATAATGCCCCGAAATAGAGGATGTTATTTACTTAGAGCAGAGCAACAATT
GCTCCGGGAAATGCCACAAACAAGTGCTGCAGTAGAAGAATAAGAAATGCATGGTGCGCC
CAGCCAAACACATGGACAACTGCCTGTGCAAGTGCATTATGGGGCATAAACTTGCCCCGG
GAGCCACAAAGAGTTAAAGGCTGGAAAAGCTAAGGCTAAAGTTCCAAATCAAAAACACAA
ACTTCAAGAAAACTAAATTAAAAAACTACACAGAAGCCGGAATGGAGGAGGCGGGATCCG
AAAAGAGAGTTGAGGGATCCTGGGAAAACTAAATGAAATAATAAAGAAAACGAACAAGGA
TGCGGAGTGGGTGGTGAACTGAAGTCCTGGGCTGGTCCAGGACTTCTTTCTCCTTGCGGG
GTGCTGAAACTTTTGCTTTGCCAAGGTAAATGCATTTTGCTTGTTGCATGCAAAACGGCA
GGCAATGAAAGTTTCTGTTGCCGGGTTATGGAAATGGAAAATGCCGGGAAGTGGCAATGG
GGAACGGAAAATGGGAAGTGGGAAATGGGGTGTCAAGGTAAAAATTGAAAAGCGAAAATT
TTCTCAGGGGAACGGGCGAGCGAAAATGGGCCAAATGAAACGTGCGCAGATGTTGCTCCT
TTCTCCTCCTGTTGCTCCTGCTTTCCTAGCGCTCCTGCCTTTTCCAGTTTAGAGTTACAA
AAGCGCCAAATTGGCGCAGCGGAAAGTCGGGTGAGTGAAAAAGGAGCCGGGGGACCTACG
TGCACGGACTTTTCGGCGTCCCAGTGCATACAAAGGACATAAACGTTAAAGCACAAGCTG
CCTGCTCTTAACTGCTAATGAAGAAGGAACTCAGCACACACTTCAACACACAAAAATGAA
CAAAAGCCGGCGATGCGAAGGAGTTAAGCTACGGAACAGCTGTATCTGATTCTCATATAC
TTGCCAAAACATAAACGTTTAAGATGTTCCAACCTAAGAAAATAACGTTAAAAAAAAAAT
AGTTTAAATAATCTGAAGTGGCTTAGGGTTTTTCCCCCTTAAAAATCACTTAAATTGCTT
TGCTTTGTAAAAGTAGATTACTTAAATCTATCAAGCATTCCTTAAGAACAACATGACATC
ATTATGCACGTAAAGCAGGGGGGATAATCGGCGTGGCTAACTAATCCGATTTAATATACT
AACCAATGTACACTAACCGGAACTGATTGGCATTAGTTCTTATGCTCTCCGGCAAGTCTG
GGCCAACATTTTAATCCCCTTAGGATGGGCATAATAAGCCGTAACTGCAACGTGAGCTCA
ACTTAGCTTATAATCATAATTAAATTAAAGTTGAGAAAGGCGCCTGCAAGTAGGCAATAA
AATGCGTTTGTGGTGTGGTGGAAACAATAAATGCATTTTCCTAACCAGTGAAAAGTAAGC
CGTTGGGCACAAAGGGAATATTGTAAAAAGGATGACGAGGCATAACAATATGGCTTATTA
TGTAATGTAGCTCCTATCATTTCTTCAATCAGCATATTCACTTACATTAATTTCCTTGTT
TTGTTTTGTGCTTACAGAAAATGCGTCAGTTCCAGAAGATCCTGGAGGATCTTAGCTCCC
GCGTTGCCCTTGCCGAGCAGACAAAAACCTCCTGGCTGCCACCCTCATCCGTGGGCGAGG
CCAATGAGCAGATGCAACAGTTGCAGCGCCTGAGGGACAAGATGACGACGGCCAGTGCAT
TGCTGGATGATTGCAACGAGCAGCAGTCCTTCTTCACCGCCAATCAGGTCCTGGTACCCA
CACCCTGCCTCTCCAAGCTGGAGGACTTAAACACGCGGTTAGTTTAGCCCCGGGATTATT
AATTCACTTAACTTACTAGAATGTTTCAACTACGACAGCATGAAACTCCTGCAAATCGCG
ATGGACGAGCGCCAGAAGGTCCTTTGTCAGGCTGGAGCCCAGCAGACGCACGAGAACGGC
GACGACGGACGCACCACATCGAACAGCGGCACCATTGGACCACTGCCCAATCTCGGCCAG
AGCGTGAAGCCGCCATGGGAGCGGGCCACCACAGCCGCCAATGTGCCTTACTATATCGAG
TGAGTATAGAGAAAAATTCATTTCGAGGTGCCAACAGATACAAACTCTTATGCTTAATCT
CTTTGCTAATTCTAAATGTGATAAATTTATCGAAACCTACTTTGTACTATAGCCACGAAC
GCGAGACCACGCACTGGGACCATCCGGAGATGATTGAGCTGATGAAGGGCCTGGCAGATC
TCAACGAGATACGCTTTTCCGCCTACAGAACGGCCATGAAACTGCGATCAGTTCAGAAGC
GATTGGGTGAGCTTAGCCTGAAGCACTTGGATTGGATTCACAGTAACTCAATATTGCCAT
CTCGCTAACAGCTCTCGACAGGATTAGCATGTCCACCGCCTGCGAGTCCTTCGATCGACA
TGGCCTGCGTGCCCAAAACGACAAGCTGATCGACATACCCGACATGACCACGGTGCTGCA
TTCGCTCTACGTGACAATCGATAAAATTGATTTGACGCTAATGCTGGACCTGGCCATTAA
CTGGATCCTGAATGTCTACGACTCACAGAGGACCGGCCAAATCCGTGTCCTCAGCTTCAA
GGTCGGACTGGTCCTCCTCTGCAAGGGTCACCTGGAGGAGAAGTATCGCTATCTGTTCCG
CCTGGTTGCAGACACTGACCGACGAGCGGATCAGAGGCGACTGGGACTCCTGCTGCACGA
TTGCATTCAGGTGAGTTAGTTGTGATGTCAATATAATCATTAAAATTACTCATTAATACC
AAAATCACTTTTCATACCCGCTAATAAATTGTAATTACTAATTTCGACAGGTGATTAGTT
ATTGCAGAAATAAAGTAATTTATTATGATTAAATAATTTTAATTGGACTATCACTATCAC
TGCAAATTAAAATTTATTTTCACAACATTAATCGTCGCTTGTAGCGATTTAAATTTATTA
AATATAAACCAATTTACTCATTTAATCGCTTGTAGCGATTTAAATTTATTAAATATAAAC
CAATTTACTCATTAAAAGCAGAGAAAATAAAACACCACTTAATATTTTTAGGTACCCCGC
CAACTAGGTGAAGTAGCCGCTTTTGGTGGCTCCAACATAGAGCCCTCGGTGAGATCCTGT
CTGGAGCAGGCTGGCATCTCGCAGGAGGCCATCGATGGCAACCAGGACATCTCCATCGAG
CTGCAGCACTTCCTCGGCTGGCTGCAGCATGAACCGCAGAGCCTCGTGTGGCTTCCGGTG
CTCCATCGCCTGGCGGCGGCGGAGGCGGCCAAGCACCAGGCCAAATGCAACATCTGCAAG
GAGTACCCGATCGTCGGCTTCCGCTACAGATGCCTCAAGTGCTTCAACTTCGACATGTGC
CAAAAGTGTTTCTTCTTCGGCCGCAACGCCAAGAACCACAAGCTAACTCATCCCATGCAC
GAGTACTGCACCACTGTAAGTGAAATAATATAACATTGTCTAGATTACGTTGTTCTAATT
TTAATCTCTTGGTTTTTCTCAGACCACATCCACCGAGGACGTTCGTGACTTTACACGCGC
CCTGAAGAACAAATTCAAGAGTCGCAAATACTTTAAAAAGCATCCAAGAGTGGGATACCT
GCCCGTTCAGAGTGTTTTGGAAGGTAAGTTTCCGAACTTAAGAACGTTATCAATTTGAAT
TAAAATTTTGCACTCTGAGACTATTTTTTTTTTATAAATAACACTAAAAATTTTCAAATC
TAGGTGATGCTCTGGAGAGTCCGGCGCCAAGTCCGCAGCACACAACCCACCAGCTGCAGA
ACGACATGCACTCCCGCCTGGAGATGTACGCCTCGCGACTGGCTCAGGTGGAGTACGGCG
GAACGGGCTCGAATTCCACGCCGGACAGTGATGATGAGCACCAACTGATCGCTCAGTATT
GCCAGGCTCTGCCCGGAACTTCAAATGGAAGTGCACCCAAGTCGCCTGTCCAAGTAATGG
CCGCCATGGATGCCGAGCAGCGGGAAGAACTAGAGGCGATCATCCGCGATCTTGAGGAGG
AAAACGCCAACCTGCAGGCAGAGTACCAGCAATTGTGCAGCAAGGAGCAGAGCGGCATGC
CCGAGGACTCCAATGGCATGCAACACTCCAGTTCCAGCATGACGGGTCTTTCTGGCCAGG
GCGAGCAAGGCCAGGTGAGAATTTGGACTTTATTATATGGTTTCCTTTTATTACTTTCCC
CTAATTCATTTTGCAGGACATGATGGCGGAAGCGAAGCTGCTGCGCCAGCACAAGGGACG
CCTTGAGGCGCGCATGCAAATCCTGGAGGATCACAATCGGCAACTGGAAGCTCAGTTGCA
GCGACTACGCCAACTTCTCGATGAACCCAATGGCGGCGGCAGTAGCGCCACCAGCAGCGG
TCTACCCAGCGCTCCCGGTTCCGCATTGAACTCCAAACCCAATACCCTCCAGACCCGGTC
GGTGACCGCCTCGCAATTGAACACGGACTCACCGGCAAAGATGAACCAACAGAACGGCCA
CTACGAGCACAACTCAAGTGAGTGGGTGGGATTTACTAGACTCAACTCGAAATGATTGAG
TCGCGCTTTGTGTGGCAATTATCATTGTTTAATGGGGAATAAATATCAGGATCTTGTTTG
TCTATTTAATCATATTTTCCTCTCCCAAAAAATGGTTATCTTTAATTATGAATATAAATT
ATAAATTAAAAAATATGGCTTAAGGGGAGTTATACATGTAAACAGTCAGGTTTGAAGTAT
TTTTCAATTTTTTAAATGAAATCATAAAGTGTACTCAGAAATGAAATCAACGATTCTATA
TAATTTAATGGAGCAACTTCTTAGAATAGTCAACAATTTTGTAAAGCTTAGGATTGCATG
TATACGTTACATTTAGGAACTGTTAGATAGACAAAGGTCTAGGAGAGGACTTAACTTAAT
GGCACGCAAAAAGGACGGGAGACAGAAACGATACCGATGGGGGAATTTTCCGAGTTGTTG
AGGGTTCGGACTAACAGTGAGTGACAACCTCGCCCACTAGCATTAACAAAGGGGCCATTC
TGCGAACTAACCTCTAATTGTGTGCTGTTCTTGTCTGTTCTGCTCCCATTCCGCCCGCTC
ACCCACTCTAATGTACACCCCCATCAATGAAAACCCGTCAACCCCATACTCCATCTCGAT
CGAAACTGAAACCGCAAACACACTTGCAGAGGGAATTATGCTGCCGGGCATGAACAGCGA
GATTCAGCAACAGCACGCCCAGCTGGCGAGCTTGGCGGCGAAGCATCATCAGCACCAGCT
CAGCGGAGCCCTGAATGCGTTGCACCAACAGCAGCAGCAGCAGTTGCAACAGCAGCCTCC
GCAGCAACAAAGGAGCATGATGACAGGCAATGGCGGAATGGACATTTCCGGCGGCATGCA
GACATCGGGCGGATATCTGGGCGACGACGGACGTCCACCACCGCCCCCGCACTCCAGTCT
GATGCAACAGCAGCACCAGCAGCACTTGAATGGTGCGGATATTAATGGCAGTCACTGTCA
CCTTTTGTACCCGGCTCAATTTTCCGACCACCTCTGTTCAGCTTGTGTTGAGTTTGGTTT
TCGTTTGCGGTGTCTACTTTAGGGCACTGGATTTTGATTTCATTTTCGAATTGCTTGTGT
TGTCTGTGTTGATGTCGCTTACCCTGTACAACCTTGTTGCAATACAAGTTTCCACTATTA
ATACTAATCAAGATTATTTCTCTTGCTCTGCTCTCTTTCCACTGCCACAAATCGCCATGC
AGATCTTGCCTAGAATGTGTTGGATTAAAGCGGTAATGCAACGATTAGTGTTGTCATCTT
ACCATTTCAGAGAGTTGAAAATATACAAATATGCCAGATTTTCTAATCGCGATTTTATGT
CTATTATCCGCAGAGAACTCAAGTGGCCTAGTGACCGTAATCACAGAGCAGGAATTGGAG
AGCATCAACGATGATCTGGAGGACTCGTCGAGCAGCAACACTACGAACACCACGACGACG
ACGACGACCACGGCAACCACGGAGAAAACTTGCGTGGAGCTGCAAAAATAACACCTTCGA
TACTTAATTGCATGGCATTCAACTATGAAACAAAACAATGAAACAGTATATGAATCCAAA
AGAATTAAATGCATGTGAGGAAATCCAATTGGCTGGCCTGCAAAACATTCTAAATAATCA
TACCTAAACACCTAAAGATAGATCCATATAACTATTGTGGTACATATATTTATACACTAT
TGCGAAGAATCAGATGGAAAAGAATTTCAAGAAGAGCTTCGAGTAAGCTGAGAACACTTT
TTAGTAGTTATGAAAGATACAAATCTATATATATTATATACAAATATCGAAGCATAAGTG
AGACATATTGAAAGCTGGAAATAATGCAGAAATGATTTAAAGATTAGATAAGCTGTAACT
CCAACACATACTTACATCCAATGATATAATAAAAAAGAAACAACTATATCATAAATGAAA
CATATTCATAATTTCCTAGTACATGAAAAATTGTTATAACTCGCACCTTTTTCAAACAAC
TGATAGGAAGCAAATCAATTTCAAAGATACAAGAAGAACCAGCTAACAGTTTTTGGTTAG
CTTTCATATCATTTTAAAGCTTATACAATAAGTGTTTTAAATGTAAATTTCGAAACATGC
AATCAGTTTTAATTTGTATCCTTATTTATTCCGATTTCTTGTGTATTATTTCTTAATATT
ATTTAATATTAATATCTGTGCTAACTGAAAGTGTGCTGCAATGTTTTTAATTAAAGAACT
ATTATTAAATATCACTGTCTTTATACTTTTATTTTGTTTTCGGTTGGTAGACAACAAGAC
CTTCATAAACCTAATCATATGCTGACGAATACGATCACTAAATGGACCACCTTTTCTATC
TACTTAATCAAATCGAATCGAATCTTATCCACTACCAAAACCCTCAAATATATTAGGTAA
TCCACAACATTCCAATGAAACTAGTCAAATTACACTTGGATAACTCAGATATACTTACGA
ATCAAATGATATTGAAAACTGCTTTAAAATACCTAAATACCACAAAGAACTAATCGAATC
GATACATATAGATGTCTATAACTTGATAACCAAAATCGTACAATACTCACATCAACATAA
GCAAAATATATATCCGAAAGAGAGTAAAGTTTTAACCTAGATATGCCATAGATGGATAAA
TATTTATGGATATATCAGATATTAGCTATATATTGACATGAAACTCTTTAGTTTATTTCC
TCTGAAATTCCACCTTTAGTTAACGAAATTATACAAAAATTAGGAACGAAAATAAGGACA
ATATGGAAACATTTTTAGAAACTGTTATCATTTATGTTTCTCATCTATCAGCTTAAATTA
TCTAAGCTAGGTTCACTTTTCACTAGAATTTTCGGGCACTTAGTAAAAAATGCAACACGA
CTATACTATATATAGAAAGAATTATTTATAAAGAGATATAGCTATCAACAAAATGCAGTT
AGCAAATTATTCAACCACTTCTGTGTAGTAAAATGTCCCAACTATGAGTATTTTTCTAAC
CCAAACCGTACCAACCCAAACCGAAACCGAAACGTAGTGTGGAAAAGATGTCCTACCAAT
AACCAATCAAGTTTAATAAATGAAAACCCTCCGTTTCAAGTTATAAACAAATGAACCAAA
ATCGAAACAAAAATGCTTAAGTCAACTATTTAATCATTAGTGAAACATATCCCATTCAAC
GGCAAATATATAAACTTTATATGGGTAAAGCCATCTCTAGGAGTACGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1378, 17036..17190, 17365..20829, 20893..21207, 21270..21575, 21727..22229, 22477..22564, 23817..24857, 24953..25185, 25522..25683, 25745..25904, 28009..28104, 28172..28304, 33878..34041, 34126..34231, 45781..45849, 46161..46251, 46322..46442, 46508..46641, 46754..46847, 46912..46992, 94731..94903, 98327..98477, 100061..100184, 102582..102739, 130037..130296, 130358..130558, 130672..130805, 130871..131229, 131571..131954, 132022..132142, 132243..132673, 132736..133036, 134413..135308
1261..1378, 17036..17190, 17365..20829, 20893..21207, 21270..21575, 21727..22229, 22477..22564, 23817..24857, 24953..25185, 25522..25683, 25745..25904, 28009..28104, 28172..28304, 33878..34041, 34126..34231, 45781..45849, 46161..46251, 46322..46442, 46508..46641, 46754..46847, 46912..46992, 94731..94903, 98327..98477, 100061..100184, 102582..102739, 130037..130296, 130358..130558, 130672..130805, 130871..131229, 131571..131954, 132022..132142, 132243..132673, 132736..133036, 134413..134567
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved