Drosophila_melanogaster Locus RpL3
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL3
Drosophila_melanogaster
RpL3
3R
snoRNA:Me18S-C1096, snoRNA:Me18S-A425, snoRNA:Psi28S-291, snoRNA:Me28S-G2017
1510..1594, 1946..2029, 2676..2895, 3413..3505
5280
ccgctggcaatcatatcctgaacgatcttctgaatgcgcggctcgtcctccaccttcat
gaagggcacatggttcatcagatagttgatgcaacccttgccgcccagatacgccttttt
cagatcggtgcgctccagctccgattccacatactccttttcatagttgttgatatcctc
ctcggtgatgggcttgaagattttgctccacaactccagccacgacgacagcttggactc
gctctcatcgtcgtcgtcgatcacgccctgctcgtcgtacagcgcccgcttctgcgtgtc
ggtaagcacctggtagagcttcgatagcaccttgaacttctcggtggactccgccttctg
ctcctccggcactcgatcgggatgaacgagcagcgagagcttgtggtatgccttcttcac
ctccttctcgccggcgccccgggccagctccattagcttgtacacatcgcgcgtcccaaa
atacttttcgcacagctccagcgtcgacattgctaatttcgtattttgtatttttatttt
tcgcaccaacactaccaaacgcaaaatgcgccaaaacgccgcgccagtgtggcggtgcgt
ggggcagacaaaaattcctttgtttaatggtgcgaaaaaatctttgattttcctgtttac
agcaatttggttattatttaacaagtaaaatggtattctatgaattttgttttaactatt
gataatttttgagagcctgcgtgataagtaacaaaaataaattggagaattgaacatttc
agtgctgcacaacattgcatggttggtgtcccaactaaaaagtaacccgtgttaagaacg
tatgagggtggcatccctcaaaatccatggcgagcagtgttaccgtactgcgaaaagtga
ccttaaacccatctcaaaaaatataccaaacgtgtatttctcagcaaagttaccactggg
cacactacacactatataacgagacggaagtcggaatcgtttcttttccgttttacacgt
ctgaagagaacagacatggtgagcatctcgatcggataaaataaattatattactatgtg
atgtgtcaaaaagatggatgattgcaagttaaataattgattagtttggaaacagtagcg
ttataatcactctaaatgtaactaatacaaacaaagcgtaattttaatgcataatttgca
cttgcaacatccacgtgttcacctaacctcaaagtgcagaaacgcattgtgctaatggat
tttctccattcattttgcagtctcatcgtaagttctcggcaccccgccatggctccatgg
ccttctaccccaagaagcgctcagctcgccatcgcggtaaggttaaggccttccccaagg
atgacgccagcaagccagtccatctgacctgcttcatcggctacaaggccggcatgaccc
acattgtgcgcgaggccgatcgtcctggctccagtaagtaccagcatccacctctatcaa
ctaacaactactttccatgatgagtatactagaagatttatggttagaacacatatgatt
aaccgtgattatctcaactagggcggactgaccaagcccactctgtagatgatttctctt
agggaataccattactcggtattaatggcttttctttctcttgcagagatcaacaagaag
gaggtggtcgaggccgtcaccgttctggagaccccgcccatgattgtggtcggtgctgtc
ggctacatcgagactcccttcggtctgcgtgccctggtcaacgtttgggcccagcatctc
tccgaggagtgccgtcgtcgcttctacaagaactggtatgtatccgaggaccacgtggtc
gttcttcctactccatttgtcgccattttctttgcaccgggtgtacacacacacaaaatg
gcagccgacacgtgctttctactcgagtctggatgatgaaacgatggtatctgaatgagc
aaattattgttgagaagccttttaccatctgctgccttccttctgatcggcctcttagaa
aataagcgattgattttgctgcaatacaatatctattgttttttgaagtataaatcaacc
agtgcgctgttttgtgtgtgtgcgaacttccgatcaacagtgattccctcgtgtaatata
gacccctattaaatgtaaaacaaaatcataaagttcttcgatcagcttgctgagagagct
tttcaaatcgctaaacgttgtgtgagctgtcaggttaatcttgatcatggggcgcacaag
caagcccctggttaattgaaattgcctgacgagtgagcatgacaaggaagactgcatctc
cgctcgccattcgtttgcgatgaggcgcacttcctgttctatctcgccccacataaacag
cgcggctaagaagttggagttgttgcgacaccccaatggattgctacattacgctcgttt
ctgaccactgcgtctccaacttgaccatcgtccatatcaggtacaagagcaagaagaagg
cattcaccaaggccagcaagaagtggaccgatgatctcggcaagaagagcatcgagaatg
acttccgcaagatgctgcgctactgcaaggtgatccgtgtgattgcccactcgcaggtaa
atatcaatttcaattatgtattccatatttcccgacgtccttggccttgttgcgccactg
gtgctgggtcctcgggctcggtgcctttggtgcgcctggcctaaaaagcattcgcgctgt
ggttttcaatgcacggtttagggatgcaacgtcgcagagcaatctgcccctcgggtggcg
ggacttgatatattccagtaacggtgcggagccgttcaggcgatgatagcgcggttaaac
catatcacgtacagtcccaatttccaataccacaaggtggatgaaactaacctgttgtgt
actttttctctatttgcctgtagatccgcttgatcaagcagcgccaaaagaaggcccatg
tcatggagatccagctgaacggcggctccatcgaggacaaggtcaagtgggctcgcgagc
atttggagaagcccatccaggtcagcaacgtcttcggccaggacgagatgatcgactgcg
ttggtgtgaccaagggtaagggtttcaagggtgtcacctcgcgttggcacaccaagaagc
tgccccgcaagacgcacaagggtctgcgcaaggtggcctgtattggtgcctggcatccgt
cgcgtgtgtccaccaccgtggcccgtgccggtcagaagggttaccaccaccgtaccgaga
tcaacaagaagatctaccgcatcggcgctggcatccacaccaaggacggcaaggtaagca
ccagtacccattattcccaccattccactttaatcgggctgtagaagaaatctgtttttg
tgatgataaaaccttaaaaataatatcgacatcgaaacaaaaaaaacttgatgaaccatg
atatttataatgataggactgataacagatcttcagctacataagattaaatcctgaatc
cccctgccgcaagaccacagtaatctgatccagaatgtatcgctttgcttttgcaggtca
tcaagaacaacgcctccaccgagtacgatctgaccgacaagagcatcacgcccatgggtg
gcttcccccactacggtgaggtcaacaacgacttcgtcatgatcaagggctgctgcatcg
gctccaagaagcgcatcatcaccctgcgcaagtccctgctgaagcacaccaagcgctctg
ccctggagcagatcaagctcaagttcatcgacacctcgtccaagatgggtcacggtcgct
tccagacccctgccgacaagctggccttcatgggaccgctcaagaaggatcgtctcaagg
aggaggctgccgctaccaccgctgctgctgccgccgccaccaccaccagtgcttaaacaa
aatgtcgtgtccgcgttcaattgtctgctcgcttctaccaccaactgctgcggtagggca
gcgatcaataaacagattttggctaagctgactcattaatcttttcaattgcatctaatg
ggaaaagaccacgtcacagattttacaatcgattaatgttgattaggaggtggaatcatt
agtttatttctcatgatagtttaatatatgtacatacccaggctaaattgttatttatta
tacctccttagagctaaaagtaaaataatattaggacactagtaaatagtttatctacaa
taaaagagtaccaccaaacttaaacactcgtagaacatttatagcaaaagagattagaaa
tcgccaattgagttcgatgtgatttgctagaataattgggtgtcctccggatcagcaggt
tagcatcgtagttcctacggagagcattgctacaatgccactgactcttggcaactgatt
gtccgtagtctatagttctgcttttatatgacactcgagtatgggtaaactactccatcg
tgaccagacattcatgggaatgcagctgtaacaatacttggctacaattcctctccggtt
acttggtaaaaaccccccacagctatcctataaatagggtactttgggtagctaagcctc
agtccaaaaccaacgctgaagatggccattaagtctctgattttgcttacttccctgctg
ggaataagccttgcagcggactattgtgctctgcccacgtgcctggacaagcacatagcc
tgcaacaacaagggagtaagtagtgatagctggccaaaacctgttggtgctcacccattc
tcgcccagaatttcagtgaaaattgtcccaaggacgtgcgtgaggtgaagatcgagccgc
accacaaactcatcctcaatctcttcaacgagttgcgcaacaacgtggctggaggcaaaa
tagaaggactacccaaggctgttcgcatggccaagatgtcctggtgcgaggagctctccc
atctggccttgctgaacgtaaagacctgtgagtccctgccagataaatgtcgcagcaccg
agagattcgcctacgccggccagaacaacgccgtgttccagtacagcggagccgagacgg
agtacaccgatgcggaaataataaaggagcagatcgagaactggtttgctgagcgctcga
atgcatctcccgagatcctcgccagcttcccggaggagcttcccaacaaggcggtgacca
agttcaccatcgcggtggccgagaagaacacccatgtgggatgtgccgcggtgcgcttct
c
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1037, 1280..1472, 1666..1834, 2500..2635, 2963..3352, 3596..4280
1035..1037, 1280..1472, 1666..1834, 2500..2635, 2963..3352, 3596..3955
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved