Drosophila_melanogaster Locus CG33936
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG33936
Drosophila_melanogaster
CG33936
3R
snoRNA:Me18S-G1358a, snoRNA:Me18S-G1358b
13399..13473, 14444..14518
19563
AAAAGATTACTATTGGGGAAGACAAAGCAATCGCCATACGCTAGGCGATTTCTACATTA
ATACTTTTGTTTCCCGTTCGGTGAACGCATAGAAATTGATATTAAAATTATTTTTTTTAA
AAAGTGCGCAGTTTGCATTGATGACGCAGCAGCGCAGTTTCGCTCTCTGCGGCTGTTAAC
ACGCTGTAGCTCTCTTTGGGCTGGCGAACAATATGGCGTCGTCGAAATTATGTCGTCGCC
CAATTTAAAGTCATACGAAAAACCATAAAGATTATTAAAAGCGCGTTTGAAGGTTTCTTG
AAACGCCCAGTAAGCGGAAATAGTTTTGGTTTGTTGGCAGGGACTCGATATAAATTTGAC
TCTCTATCGTTGCATTGGTCTTTTGTCTCTTGTCTCCCTCTGTTCCCCTTCCACAATCTT
ATTGTGTGTGCACTTTGCACTGTTGGGCTAACATAGCGTGGTGTTTTTCGTTGGAAATAC
GCATTTTCGACCATCTTTGCTCGGTTCACATTTAATTTATTTCCTACATGGCTTCTCTCC
GTTGACTGGCGATTTCTTTTTAGCCTGTCATCCTTCATTCCCCTTTCCTAACCACTTTCT
CACCACACCAGCAATCAACGCTCTTTTTGCGTTAACAGCGCTCGTTTGGGCTAGAGATGA
GACCATGAGTTTATGTTACGTCGTGTCACGATAAGAATTTTATTTTACATACATTTCGGT
CCAATTTGCGTTTGATTTTATTGTCAAGAGGAGAAAATACAAATTGAAAATAATTTTAAA
CAAACATTGTATTCGATTTTATATAAATAAGTGTTTCTTTTATAGCTAATGTATTGAAAA
TAATAATCATTTCGATCATTTCAATCCTACATACTCCTGGTATTGTTAACTGCTTTCAAC
CGGAGAAGTTGAGTGACAGACTCACGCTCTCATCACCAAATTGCCACCAACAGAGCTCTG
TTAGCTCGCCAGTCGCAGTCATCAAGCGTTGCGAGGTCCGCTCATTTCTGTTAGAGTGCT
TGGAGACTTCACTTCGCGTTTGGAGGATCAGATCCACGTTGGTTTTTGGCTTCAATTACC
CACAACTGTCATCGTCAGCCCAGTCAGCGCCTTGCTAACTAAACTAGATAATAAAGTAAT
CACTTTTCCGCGCTCCCCTCCCTCTCTCTCGGTCGTGTTAGTGCGCTCCGCGATTAATAA
GAAACGAGTTAAAAAGGAAAGCAAAAGGAAAACTGGCAGCGTTTTCCTCTTGCAGCTGAG
AAAAACCGCAGGACGCAGCTCAGCAGCAGCGTCGCAGTCGTGTGCGTTGTGCATAAGAAA
AAAGAAGAAAAAAAATCCTGTAATATTGCAGAAAAAACCGTAATTCGCCACTTGAAACGA
AGGAAAAACGAGGAAAAGCAACTGCGTCGTGCACCATTTTGTGATATATTTTTGCCCTCC
TCCTTCTTCAACGATCCCTGTGCAATTCTCTGTTAAAGAAAAAATTAAAATAATTACTAG
CAACCAATTGAATTTCTGCGAGACCAACATAACACATAAAAATTTCCAACTACTGTGATT
TGAACAAAGCTCTAAGTTTTTGATTCAAGCCTGTGTAATTTCCACCCACAACGAATTGAA
AAAGTAAGTGAATTCAAATGAGAAAAAGAAAATTATAATTTATTTCATTTTCCTCTTCGC
TCGCCTACGTTGCTTACTCACCACTAGTCGATTCCCCACGCTCTCTCTCTCTTCACCACA
GTCACCAATACACACGGGCTCGCCTACGTCACTTTGTCGTGTGTGTGCTTAGACTAGCGT
TGCCATGTCGCGCGAATTACGAAGACAGGAACAATAAATAAATAGCAGTTAAATAAATAG
TAGAAAATGCCATACAAAATATATGGGAATTGACTTTAAATTACATTTTTGAGTTTTCAA
AATAAAAACTAAATTTTAAATACTTAAATTATAAAAAAATTAATTAAAAAATGAAATAGT
TTCCACATTTCTTGAAGAATATACTGTTAACAGCAGTTAACGAAGTGTAAGCAGAAGGAA
CAAGTACAATGTTATGCATTAAGAATATGAATCCCTAATCTCATTTCATTCAGTGCAGCT
GTTCAAGTTTTTTCTATAGTTCTTTGCCAAGAAAATATTACGACTTGCCAAAAACCAAAA
CCCCAACCACAAAATGTAGACTTTGAAGCGAAGGACGTCTCTGCTGATAAGTGAAAAATA
AATGACTGATAGCTCAAGTACAAACATGCACATAGTGATATGCGTATATACATGTGCGTG
CATTTGTGTGTATATACCCTTCAGCTATCTCCAAATTTAAATAACATTTTCCTCTTTATC
GCAGTGACCGAAGAAATATCTTTATCTGCACACTCCACAATTTTAATATTATTTTTGCCT
GCAGTGCGTGACTTGAATTTTTTGCTCACTCACTCTTTCGTATGACTCATAGACCCGCAT
AAAAGCAAGACGAGTTCGAATTATCTACGGATTTGGGATTACGGTTCTTATCGGCGAGTG
CATAGGGGGTTCTGGCTGCGATGGCAACCCTGATTGTTGGACAGTCGCCCAGCTGACTTT
GTTTTTCCAACTTTTCTTGGTGACTCACTTGCCTTTTTGCTGTTTTTCTTTTTCGTTAAC
TCCAGCTCACCTTGTAACAATTATAAAAAGTACATATTTGCTCGTGTTTTTTTTTTCGGT
ATAAGTTTTTTTCCTTTGCATTCGTATTTTTCTGTGCTGACGCTTTACATAAAGAATTAT
CTCGTTTTTTCGTATCACCTAGAGGCACGTTTTCTGGCATATGCACATTTTGATTATAGT
CGGCAATCAAGCACTTTTAGTGACGGAATTAAACGAAATGACGACTTTCTTGAAATTTCT
GCCGTCTATTTCGCCATTTCCAGTCGAATTTTCGTCGAGATAACAGTGAAAAAAAGATAG
GAAACGAATCAAGCGCTAATTATTTGTGATTGGTTCGGTAAACAAAAATGTTTTTGAGTG
AATCAGAAAGAGCGAGTCAAATAGTCGATGATATCGAGTAGGAAACACTTGAACAAATTT
AAGCACTTTTCAAGGTGGATTCCTCTAAGTTTGGCAACGTAAAATTTGGTTTTTCTACGC
CGAATTAAAAACTTTAAGTAAAAATCTTGTTAAATGGAATTGTTAATACAACAAATTCTA
AATTGGAATTGTTCTTAAGCAGCGATTATTTTAATTGATTTGTTTTTTTTTTTATCAAAG
TTCATAGATTGAAATAGTATTTGCTTATCACGCTAGTGATTCATGGATCGATATTGTTTG
TCACGATTGTTTGAGAACTTTCCCGATCCCGGATGACTAATCCCCTTGTTGGCAAAAATC
GCTTATAATTCTTGGCAAGTTGAGCAACAACAACACGTGTCGTTGTCGCTAATATCTAAA
ATTATATAAATATGTATGTTCTCGCGAAAAACACACAAAAAGCAGCGCGTTCGTTCAAAC
AAGTTTTGGTCGTTTGAAAAACAAAAACAATTTGTTTTGATGACGGCTCGTTTCGAATTG
TGTTAATATACATAAAAACAAACAAATTATACCAACACTCTCATGTATGTATCGTATATA
AAACCAGCCCTGCCTTTCATTTCCCTCGTCGTTTTATTCTACCTTTACTTTTTGTTGTGG
CTAAATGGTTTTATATAAACAAGTAAAAATTGATAAGCGAACGAGACCGTTGGACGCGTG
AACGGCCGCGGCCTCATTTTCAGTTGTTTTCTTTGGTTATAGGTCGCGTGTAAATGGATG
CCGCACACCCGTGCACCCGTACACCGCCCAAAAAACCCGATGCCGACCATCCACCCACCA
TATGGCCGGGCATACGATCGAAAACTTCGGATCGGCTCGTACATTTCGGGCCTTTCATTA
TCTTTGCTTGCCGTTTTCGAAATGTTTTGTGCATAGCGCTATTTTTAGCACTCTAATCCC
CTATACTTGATCTTCTTTTTGTCGGCTGTCGTTGTTTTCTCTCTTGTCTTTTTTTCTCGT
TTTAAGTTATGCAATTTTGTTTTGTCTGTCGGTCCCTTTAGAATAACAGTTGTGATCGAA
ATACTAATAGAATTTAAAGTTTTTAATATTTTCGTAAAGTTGTTTGTTTTAAAATCATTT
ATCTTGAATTATAGATGAAAGACAAAACATTACATGGTGGTTTTTTTTTATCAAGCAAGC
GATACTAATTTAATGACCGCAGCTGTTTCTTTTGGGGACAGACTGTACTGCTTCGATTTC
GATCTTGATTAAATCCCATTGAAAATAGGCATTTAGAATGCACATATATCGGCTTTTTTT
GGGAGCACAATTACCGCGTCCAAATGCGGGCATAGATTTCAATGTAAATTAATTTGGTAT
CTGTATAAATTTTCTTTTCTTCATCAATCAATTTCGACACATGTACTTTATTCACAGAAT
TTTCTTTATCTAATGTGAAAGACATCGCTGGTATACATAAATAAATTTCTATATGTTTTG
TTTATTGTCTGGCAGAAAAGCAAAACGGAAATAGCTGAAAAACAAAAATACCGCCAGTAT
ATTTAGGTCAAATAATAAATTATCTGTATTTTATACATGTGAGTGCGAATCCTTGAACAC
AAGTCCTTGTCAACGAATTGAGGCCTTGATCGTTACCAACTGTTCGACTTTAATGCAATT
TTAATTTCCTGGCTTATGTAGTACATGTGTATGTGTACTTATGAGGAAACCACAAAAACG
AATAAAAACAAGAAATAATATAATACGTTGAATCGAACCGCAAAGAGAAGAGATAAAAGC
CACCAACAACAACTGGCTCACCTTGTGGTCAAGAGCTAAAATTTTCTTTCCATCCAACAT
CGATTTTCCCATTGCAACGTCGCCCGTATAACCTTTCTTTTGCCTCCCCAATATTGTGTT
ATCTATTTTCTTGCCAGTTTGTTTTTCCTTTGATTTCAATTTTCTCCAATTTGCTGTACA
GGTTTTTTGTGTGTGGGAATCGATTTAGGCGCTCGATTGGCTTTAGTGTTCGCCCCCCTC
CCACAAATTAAAGTTGTGTGCCCGAATAAAAAAGGAATAAGGAGAATAAGTGAAAAGCTC
CTCTCGTCGTCAGGAAATTTAAATCCGATGCGGTGTTGTTGCTGCTGTTGGTTTTTCCAT
GGTTTTTTCCTTTATTTTGCCAATGCCTGTGGCGCGCGCATATTCACCACATCTGGCAAC
CATGGCGACCGTTAAACTCGCTCCCCCGCCCACACACAGAAACCGTTAGCCAGACAAAAT
GAAAAGCGAAACTTTTTGGCCCAGCCTTTTCTTTTGTCCGTTTCCTTGCTCCCGATGATG
ATGATGATGATGATGGTGGTGATGATGCCTCGCCCTGTTCTTTGTCTCCTGTCTTGGTCT
CCAGTTCATTGCCTCTTTCTTCTTGCAACTGAAGAAAAGGAGAAGGAATAAAAGAAGCGA
ATTTGTAATGCATAAATCAATAAAATCAACGATGCACACACGATGCTGTTCTTGCTGTTT
CAATATCAACGCCCTCGCCACCGCCCAGCATCAAGTCATCAACTAAACTTATCTTGGCTC
TGACTCAGCCGCAGTCATAGCCTCCTCATCTCATATCGTCTTATTACGAATGATAATACC
CTTCTCGATTCCACTGACAAAGTTCAAGCGCCAACGGCAAAGTTCAATAGCACAAAATGG
CAGTTGAAAAAGTATATATTTTCCTTATTACAGTCGCACTTCCCTATAGAAAAAGCTAAA
AAACTGGATAATTATTCTATTCCACTTGTTTTGAATACAATCGGTATTTGCAGTCTTCCC
ATTTTTAATTGAAATTTCGAGGTTTTTAGGTACCGATCCTGATTTAAATAAAAAGTGTAT
ATATAAATAGTGATTAAACCAAAAAGGAAGTTCTTTTCGTATTTCCATTGTGTTTAACAG
CCGAAAAACCATAATGGCGAATGTCAAGTTCAAGCTAGCATGGCTTCACTGTATGACTGA
AATTCTTCAACTCCATCCCATGACTCAAGGCTTCCGCATCACTCATTGTTTTTGTTTTCG
CATTTTCCGTCAATCTCTCCATCTGTCAGCCATTCATTCAAATGACCATTGTCTACTACA
GTCGAGAGTTGATTTTCAAAGCTCGGCGAAGAAATAGAGTCTTTGAACGGCCTTCGCTTT
TCTGCACATAAAGCCAAAGCCAGATCTCTTTCGGTTAGAGAGAGATACTTCTTCTTTGTC
TCGAAATCTATATATGTATGTGTATATAAGTATATCTTTCCTTCTTTCTGTTTGTTTTGC
TCCTTTGTGCACTTACGTTTTTTGTGAATTCTATAAAACTGGTTTCTTTTCGGCGGCGAT
GTGTGCGGATTGTTAAATCGCGACCATAACACCAGAGCTACGAACTCCATTCCATTCCAT
TTCCTTTTGACTGGTGCTCACAGGCTGAGGTTCAGATTGAGACTCAGTCTTACAGTGTTT
GTTGTCTGCTTCAGTGATTTGATTAGCCCATAAAGCCGAGACGTTGAGGTACAGTGAACA
TAGCGCTGGGTTTTTTAAACTAATTTACTTATTTGTTTCGTCATCTATTCTCACTGCTTT
GCACAACTTACCCCTGAGTTTCGCCCGCATTTTTCATTTTCCACACTGTATCGTAAATTG
AGTTTGACCCGCTTTTGATGGGAAAGGTTGACACTCATTGCAGTTCGATAAATTTTATAC
TATAAAATAACTATAAACAGCCTTACAAAGTTGAACAAAATTAGTTTTACTAAATAGTAA
ACTCTTATATATCTATGTATATTTTTACCATAGCCCACATGATGCACTGTAATTCTTATG
CTACTATTGTCGCAATATCAATTTGCCAATTAGTTACGCTTCAAACGTTGGATAATATCC
AGTACTTCGCTGTGATACTTCTCCTCCTCTTTCTCCGCACTCTTCTCGGTTTCTTCTGGC
TCCCCTGCAGCGTTGACGTTGCCCCATATGATGATGATCTTCATCATCGCGGTGGTTGGT
TTCTGTCGGTCTCTTGGGTTTGTCAACTATACTTCTTCATCTCCGTTTCTTTACTTCTCC
TCCTTCTCCTTCAATTTTGGACTCTCCCCTATTCCAGGGAAGGCAATCTCCAGCCAAGAG
AGCTGGCTACTCATGTGGACGTCGCTCTTCTGAAGCGTTTCATATTTCATTTTCCCATGC
GATTTCCATTAATCTTCCATGTGTGTAAAAAGGCAACCAAAAAACTACTTTATAACCATT
TTAGGGATTACTAGGGGGTGCACGGCAACGAATATTATTTACCGCCGACTACAAAATGGA
TAATATAATAAAAAGTACTGTAAATAAAGCTTCATAAATTATCATTAAATTTTTTTAAAG
CAAAGGTGTCCAAACACAGTTTTAGATTACCAAGGATAAATGGTTTAGCAGGCATTCTTT
TTCAGTGTAGTTGGGCATTGTAACTGCACAACTTGCCGTTCGTTTTCCTCTTTTCCTCTT
ATTTGTTGCTTTTGTTGACCTGTAGCTGGCAGTGAAGAAATAGCAGAAACAGCAGAAGGA
AAGAGAGCAAAAGTTGTGGTGACTTTCGCTGCACGAAGAGCGGAGTTTTGCACACTTCTG
CGAGAGCCTCCTCCGTTCCCTCATCTTTAGCGTTCCCCTTCAACACCTTTTATCTGCTCC
CCTTTTTAGTCTCCTTCCTTTCCGGCCAACGCCTGCTCCTTTTATTTTTTACTTAATGGC
CTTTGGCTGCTGCTGCACACACACTTGCACATAATTCATAAAAAATGGCTCAAGTGAATT
ATTGGCGCTCGTAAATTCTTATAAATGAATTGTAAATTCTTATAAATGAATTTTATTAAT
ATATGTATGGTCAGTGGTACAAAAACCGGGTTCGTTCTGGTTAAATGCAATTCAGATGTG
CATATGTATGTGTGTAAATATGTGCCTTTATGGCAGAATTGGTTAATTAATTACATGTGC
TCGAATGAAATCGCTTCAATCAATGTCTGCTTCAGATCAGACGGCAACAAAAGATGAATC
GATGTCTGGCGAGGATCAGTTACTTGAGCTAGCCAGGTGTTAAATTTAACATAAATGTTA
AGAATCATATTCAAATATCTTAAATGATTTCGAAGTGTTTTTATTTATCTTCATTTCAAA
AGTTCCATGAAATAAAATACATAAAACAAACAACATTATGCTAATACGAAGAAAGAATTT
TATTCGAATCATATGGATTTCCAAGAATGTTGATATAAACACATGAAATTACGGGGAAAA
TGCATTTGAAATACGTTTATCGATAGATCGATGAGCAATGCGCTGCAACTTTGATTGCCT
TTCTCTTCGGCCAATATACAAGACCCAGAATCCAAATCATTTTAAATACTTGAAGACCAC
AACTAATGACATTACGGCTGGTCTGTACTTAAAGTGTGACAATCTGTTTATTGCTACCAT
TTGCTTTGCTTCTTGTGTATTTTTGTGTGTTTTCTCCTCCTCATCGTGGTTTAATGGACG
CCATTGTTGTTGACTTTTGTGGTTCGTTCTTCGGGTCCTCGCTTCTCCTCTTCTTTGTCT
GGGTCCAAAAGAACCCGGGTTCAAGGTGAAATCAGTTCATGTCCGCAGGGCAGCCTGTCG
GTCGTCCGTTGATTATTTGTATCCTGCCACGCAGGCGATCAGTCTACAGTAAAACCTCCC
TGTAGCGAACCCTTTTCGAAGTTAATAATGGGTAAAAGCGGTATTTCAAATTTAGATGCC
TTATTAGATAGTTCTTGGCTGCAAAACTATCATCATTTTCTAGTAATTCTAATCTTGTTT
ATTCTATTAATGCTATTCGGTCTGAACTGTAAAAAAAAAACGATAAGTACCGTGTCCGTC
TGTCCAGTTTTAACCCTCCAGTGCCTCATCCCTATTCGCTCTGTCTTTTCCCGTAAACAT
TCAAATCAATAGGTTGTTTGCAACAACCCTCAGTTTTTGAACTTGTACTCACTTCCCGGG
CATGTGCATGTGGAGTTTTTTGACCTATCGCACAACTTTGGTCGCCGCTTCAACATTTTG
TTGTTTCCAGAGCTGTGTAATTTTGAACAGGTGTTTCCCAGCGTTTCATTTTTGTTTTTT
GGTTGTGGTTTGGTTTACCAAACATACTATACACGTTAATCCTAAGCTGCCCTGCCCCTC
AATGTCTGGGATCAGTCCTTTCATTCATTTTCGAGGGCGTTGTTCAGGGTTTTATTCATT
TTCGCAACAGAACCAAAATCGCCGGAAACATGACCTCTCGAGGCGATCATTTATAATGGC
AAAAATAATACTCCTTCAGTCTGAAAGGAGATTTCTGTAGTCTTAAATGTAGTCGTCTCT
CGGTCGTTCATAGATTGTAATTTATTTTGATTAATGATGGGCGGCAACGTCTCTCGCTCT
CCTCTTGGCCTCCTATTTCTTGGCATCTTCTTTCTTCCCCAGTGTTCCGTTAGTTTTATA
TTTTGTTTTCAATATTTATATTTTGTTCATCAACTCGTATTTTAAACCAATTTCATTGGC
ACGCTCTACTGTTGTATTATACGTAGTATCCACTGTGTGTATCTAAAACATTGATTGATT
ATTTTAACCACTTTAAAGTATTTTGTTGGGAAAACATCTTAATTAACCTCTTTAAAACGG
GAGGTATAAGATGTGATTTCCTCAGTTGGAACTATAAGTTTTTGTACCCACACTTGGACT
TTACAATAGAATATAGGGTCAATCACACTCAATATAAACCAGTTATCATATTAGCCGGGC
TTTAAAGTATAGCTAATGGGGCCTGGTTTAGTTGGCGAGGTGAGTTGAGGGTTAAGACTG
TGAGCTCAGCTGCCTGACCGGAAGCTCCGCGCATTCTTGCGACTTGCGTTTTGAGCTTAA
GCTTAAGCCCCTGAGCTCAACTCGGTTCTAAATTGAGCCGAGCAGCCATCTTGATTCTCA
CTCTCTTTCTCTCGTTGTCTCTTCTCTTTTGGTTTGTGCCTCCTTTTGCGCACATTTTAA
TAAAGTTTAATAATTCAATGGGTGATGTTGTCTCTTTGTTGCATTTCATCAGCATATGTT
TGTTGGTTTTACTGTTGCTGCTCCTTTATCTTTATCGTTGTTGTCTGGTCCGCTTTACGC
GCTCATTAATATGCAAATGTGAGTCAGAGCGGTTTATGTTTGTTGTGGTTGTTCCTGGAG
TTATACATGGATCTTTTTATTTCTTTATATTCTTTTTACCTTTTATACTGCCCGTCATCA
TCATCATCTTCGTCGTCATGTCCGTTCCTCGAGCCTTTCCTGTTGTAAATTCAGTATTTG
AATGCAGGTCAACAGCACATTAACCTGCGTCCTTGTAATTTGTTTGCTATCGTCCGCTTT
CATATCAGTGGATAGCGGAAAGTGAGTGGTAGTCGAATATATGATACCCCACAGCGATAC
CCGATCCTGAAAACCCCAATCAATTTGACTCGTTCATGTTTGACTTGCATGATTAATGGA
CATGAGCCACCACACCTGAAGAAATAAGCTAAATAAGAGCTGAATTATTGAATAAATGGA
ATTATTTCATACGCGTATGTACATGTTTGTAAAATATACACGTTTTGCTATGCATAATGC
ACATCCAGATAAGCTGTCCCTCAATAAAAATGCATAATACCGGGGAATGCGATTTATGAA
CGGTTTCTTCTCACCTCCCGCGATTTCTATTCTGTTATCGCTTTCGACTTGCGTAATAAT
GCCTTTTGCAATGGGGAAACCACGCGCTAATTTTTGCCTCTCTTGCTAATTGTTTTGCAC
TTAGCACTTGCATTTATTTTATTTTTCTTATATTATTTTTTACTTATGCAATTTACTTGA
ATGCGCATTTTTCACTCTGCTGCGTAAGAGAGCAAACAAACAATGACGTCACGCGCTTAA
GTGATGTCGTCATAAAGTTTGCGCGAAAGAATCATATGATTTCCTATTTGCTTTAATGAC
CAACACTTTAACACACGAAAGCAGAACGACACACGTTCGCTAGATAACAAAACGAATTCG
CTTAAAAATAGCAGAGGTCGTTAAGTTGTCGGAGGGGGGTGAGTGGGATGGGAAGGAGGC
ATACAAAACAAAATAAATAAACCCAATACATATGCAAAGCTTTTATTCTTGATATGTATA
AAAAAAAACTTTGGCACAGCAGCCGCGCGTGCTTGTTGACGTATGTACATACTAACGTAC
ATATATTTTTGTATGCTCACGTACAGTGAAAAAAAACCGACAGTCCAAACGATTCTTTTT
AGATATTTTTATGTAATTATTGACCTAAGAAACATGTTTTTGTATTTGATACACTACCTT
TTACTGTTTCATCGTTGGTGTGATATTCTATGCAAATGCTTGAAGAATAGTTTAATAGAT
TTTTCTGTGCACATAAAGAGTCAAAGAGAGGGAGAGAGATATTCGCCAGCCAATTTGTTG
TGTGGGCAATTTTTCCTTTTATTGTTGACATTTTGATTAGCCCACCTCCAATATATAAAA
TGCATGTGTAACTACGTATGTGTGTGTGGGGGAGCGCGAAAGAGGATGCGAGACGGCCAG
CTGTTTTGACTTTGCAATTAAATGACAACAGCAGGAAATCAAGCCAACATATGTACATAC
AAACACACTTGAACATCGCACATTGTTTGCTCTGCGCTCCACACCGCAACTATAAATCAA
AATAAATTTTCTCATACAAGCAAAAGTTGCGTTGAAATAAAGGCAAAGCTAGGAAAATTA
TTTATGGCTGCGCCCCACTACACAAAAACAACACCAATACACTGAATTCAGTCGATTGTA
TGTACAAACCTTAGTAAATGCAATGCCAGTTTAAACATATGTCACTTTTTCTCCCCCCTT
TCTCCATCAAGCTCAAACTCACCACAGCAAATGTTGCGCTCTCAAAAAAAAATACTCCCC
ATGCTACGTTGTAAATGTAAAAGTTGCTGAGGCCATATTTTGTTTGCTTGTAGTTTACAT
GCGCACATCTCTAAAACCTGTCTATGTATTGAGCAAAAATGTTGGTTGTTTTGGCTACAG
TTGTGCAATGGTTTATTGTGTTGAAGAGGAACCCCCCTCAGCTTAAGCCATTTATTAGTT
TGTAATATACGACAGCAGAGCTATGTAGCTTTCTCACCACTAAGGTCAAATTTTGTATAA
CAGAATATCGCTCTCTTTATTGCACACAGGCGCACGCACACATGCACACATCCGCTCACG
CATTCAGAGCTTCGTGTGCCCATTTTGATTCTCGCCCCGAGCTCCAAAGTCGCAATGAAA
ATAACAGTAAATGTTATTGTGCTTGTGCTCAATTCTCCTCTCTCTCTCTCTCTCGCCCTT
TTACCTTTTTTCTCTCGTTCTCTCTCATTCCTTCTTTGTTGACCATGTAACTGATGGTTC
AATCTCCCACCTCTTTTTATTGTTGTTGTTGGTGGATGATGGCTTTTACCATTAGGTTTT
GACTTTACTTCTACACTGCGGGAAATGAAACGATTAAACTGTAAGAAATTCTAAAAACTT
AATTTTATATGTTTTAAGAGATCCATTTTAGTTCTTAACTAAAATCTTTTTTAATTAATT
ATTTTAGTTACTTTAAATTAACTGAATACATTTGTGTATACGTTGGGAAGTGTCAGAAAC
CAGTTTATATAATTTATTCAGTTTGAATTTCACAACATATTGCAAAACGATTAAGGTACA
AGGGAGTGCGTACTTTGAACTGCGCCATAAAAAGATGTATCGTTCAGTGTATCTCTCGGA
TTTCGCCCATAACTCTCTCTTACTTTGTTTTTGATGGATGTGCAGCTCGGCACGTCGACT
TTTCGACTTTGAGAAAGTAAACTGATCGCGATAAATCGATACTGGCCAGGTATTTTCTGT
TAAATCGATCGACATAAACAATTGGATACTTGGGGAATATATATGGCACTAGTTTGAACC
GTTAGGTGTGACTGCTTTATATTCATTAAGCATAAAACCAAACTCGTTTAGCTTACTACC
TCTTACTACGGCTCGTTCTCAGCTTGCTGGCGAAACTGGTTTAGGCCCGACTTTGTTCCC
TCTCTCGCAGATGAACCTATAGTGTGTATATCTGTGTGCGATATGCTTGACAGCCTTGAA
GAGAGCGAGCGGATAAATGAAAAACAACATAGTGTTTACTTGTTATGTGGTTTCTGCTGT
TGTTGCTAAATTTTTTATACAGCATACATTTGTATTTTGTGTGTGTGATTGTGGGTCTTG
TTTTTATTGAACGTATTGCAATGCAATTTAGTGCGACATAGTTGCAGATCATCAATATGA
AACAACATAATCCATTTTAATTGTTTCCATATGAGGAAACTCATAAGCAATAATCAATAG
ATGATACTAAAATACTATATTTCAAATGATGATATTTCCATGCACCACTCTGAAGCTTTT
ATTAGCATCGTGCAGATTATGGATTTCTGAAAATTGAAAAATTACATTATGCTATGATAA
ACCTTTTACAAGGAGAATTTACTAATTTTGCCCTATCTTTATTCGTTTTACAGCTCGTAC
TCTGGATTATTTACGGCAGTCACGAAGCAAAAAACATAAGCGCAGCCTAATAATTGGACG
AACTGATTAAACAACAGTTAAAACAAGGCCCGCAAAAACAACGGCGGATCAACAGTTGCT
AGTCGCAAGTTGCAAATCGCTAGTTGCACGTTGCCAATTTGAAATTGCACGCTTCCACGA
CTGAGAGCAGGAAGGAAAGGAATCGCTGCCGCAGCAGGAAGCAGACGAAACTTCGCTGGG
CGAAAGTAAAAGCAGGGTTGGGAAATAAAGCAAATCAAACAAACAAGAAATCGACCGCAC
AGACCCACAAAGGCGCTTTAGCCAGCCATGGAACGTGAATCTAACCCAATGCAACCCATG
TGCCGCTCCGGTTGCGGCTTCTATGGTAATCCAGCCACAGATGGTCTCTGCTCCGTATGC
TATAAGGTGATTATTTTCGTTAAGATCCAGCAAATGAACGCAAATATTAATCCTTGTTGC
CTTGTCTATCCCTCAGGACTCGCTTAGAAAAAAGCAACAGCCACCTGTGAGCAGCACACC
TGTCTCCGTTCCAAGCCCACAACCTAGCCCCACATTCAGTCCGGCCATCGCAATCACCAA
CACCGCACAGCCCACAGTCACCAGTTTACAACAGCCACACAACGATGTCAAAGAGGTGAG
CAGAGTTACGGAGATGTTTGCAGAGGAGTAGTTCCAGTTTCCACTATCAAGATTAGTTGT
AATTTCAAATTTAAAAACGTCTTTCAGTCTTCTTTAAAAGCTATATTTTGTACTCCTGAA
AAGCGGTCCTCTTAGCTTAGTAAGCGTTTCTTGAAATTAGAAACTGGAACTAGTCTAGTA
GAATAGTAACTAAGATCCTTGCATGTTACATACTTATGGAACTTTTTCAAATGATGATAC
TTCCATGCACCACTCTGAAGCTTTTATTAGCATTGTGCAGATTATGGATTTCTGAATAAT
GAAAAATTTCATAATTTAATACATGACTGCTTTGATTTGCACGAAAACCACATAGGCTCG
GCGTTTTGTGCCCTGTTTAGTATATTTTTACATTCAGTCAGTGATAATTACTTTTGACTT
TCGGACATAAATTCAGTGTAATCTTAAGTGAAATTGTTGAAACAATTTGTTGTTTGTGCA
AATGAACATTAGGGGAAATCAAGAAGTTGGCTTGCGGTGTCGATTTAGTGATCTCTGTAA
CTTTTGTGTCCGTGTGGATGAGTTTACTATCCTGATGATCCTGCCACCAATTACTCCGCC
GCATTTGTAAATAAGGTAAAGTGTCCACGGTCTCTATCCGCCAGTGACCACTCCAAGAAG
CTGCCGCTTCAGTTATACAATAATCTTAGAACGACTTAGAGCGGGGATTCTGAGATTTCG
TTTCAGTTTTAAAGTAGAGTACCATTTTCCTTTGATCTTGTTCGATAATTGCGCTATTTT
CTTCTTAGTTAATGTTTGATCTGTAAGCGATCTCAGAAGCCCTTATTCCTGCAAGAAATC
GTTCGGTTTAATGTCACTTATTTGTCAATTCCATTCGGTTTCAGTTTGGCAGTAGCTTCT
GCTCGGAATCAAAATTTTCCTATATTTCGGCCCTTATTTCAAAATTAAAAGTCTTTCCAA
ATTGTTAATATGGTAGTTACCATTGTTGCCTCTCCGCATAAAAAAACTGGTCGTGTGGTA
CCTCCCAAAAGTACCCCAGTTGCCGACAAATCTCGATCCGTTTCCACGCTTCTATCGACT
CATAAGCGAAAGGGGCCGATGAGCCTTGGAATCAAGCGTGCCGCAGCCGGCGCGCTAACG
AGTCTTAGCGGACCGATAGCCGCCGGACCTGTGGGCCTTGGCCTGGTCACTGGAACGGAT
AGGAATGGATTCCCGCAACACATTGCGGCCTCAAAGGGTACTGAATGTTCTTACTGGGTC
TACCGGCGTCGCCCAGGCGCACTAACCTCGTTTCCCACCTACACATCTCTCCTATACTTC
GATGCGATGTTGCAGCACAAGCGACAGCAACCCGTCCAGCAGCTCCGATCCCGCCGCCAC
GCTCATACCTCCGGGCAGGGACATCAGCAGCACCCGCTTCTGCCTCCGCTCGCCTTGCTG
CCAAGGTGCCTGGTGCCCCAGTCGTCGGATTGGTCTCACACACCGGAAGCAGCAACATAA
GCCAACCTCCGTCAGTCACCAAGAAGAGCTCCCTGTCCAGCCGTAAGCTTGGAGGTGGCA
AAACCACAGATTCCAGCATCAAGCGGCGCGTAAAGTTCTCGGCAAATGTGCACACATTCC
CTTCCCTTACAAACACCAAGAAGTCCACCCGGATTGGCGAGCTACAGCTGAAGAAGAAGG
TAAAGAAGCTGAAGCGGATCCGATCGCGTCGGGAGGGCGGAAGTGGTGAGACAGCGCGTG
ATCTCCTTAACTCAAGTGGTATAGCCGCAAGTAATCTGGACATTTACAAACACGGCGTTA
TCGTTGATGTGGAACCAGTTAAAACACCAGAACCACCACGTGTTCTGCGCCTAAACGTTG
TGGGCAAATCATCGCCGGCGACGGGAAAATCTGCATTAATAACAGCGCTGCGGCGTAAGG
CTAAAAGATCAGCAGAACAGGAAGAAAAGTCCAAAGAATCTATAGCTACTGCTACAGGTA
GTAGGACCGGAAAGCCCAAGACAAAGACGATCAGAAAAAGTGGTGGTAGCAGCGCGAAGA
CTCTGCTCGCATCCAGCTCTCATTTGGTGGATAGTAGGGCTGGCTTAGAGGGGAGGAAGA
AATCAGTAGTAACGGCGGCAACTGCCAGTCAGCGGGTTAGTCATAAACAAAAACAAAATG
GGCGGCGAGGCCATGGAAAAATCTGAAGGCGGCGATCAGCCGGAGAGTGCTGGCGAGAAG
GAGCAGGTGCATCAAGGAGCAGACCAACAGGTTCAACGGGAAAAGCGTCGTCGAAGTGTG
TCTCCTGATGGGGGCGATGTAGGCAGTGTAAAGATGGCTGATGTGGTTTTAGAAGGCGCA
TCGGATGTTGCCGTAACTAAGAAGCGGGTAAACATTAACCACAACACATCATCATCGCAT
CGCCACTCTTGTTTTCCTCACAAAATAGATTCTCACTCGGCCGATTCGATACGTATTCTT
GGCAACAGTTGTACAGTTGACGGTGCTCTGCTAAAGCCGAAAAAACGCCACTCAACGCCA
CACAGCGAATGCTAATACATTTTGATGAAACAGTCGAAATTGTTTAGTCTAATAAAAGAG
GAAATAATATACTAAAGCAAAGTTCTTCAAGGCTTTTTGAATGCAGATCGAGGCGGCGGA
CGAGAATGTATAGTTGTGGTTTAAATAATAGATGCTGTGTTTCCTGTGTTTCAATCTACA
ATTAAATTAAGAGATTAATAGAGATTTTCCATTCCCTTTTTGATTTGTAAAGCTCTCGCC
CTTCACTATTATTTTGCGCTCAGCTATGGAAAAGCTTTCTTTCTGTTGGAAAATGGCTAG
CAAATCTGTTGATGCTATCATATATTTTTGTCATGTGATTGAAATTCCGTTTTTGTTTTA
TTTCCGTTTCCGCAGAAAATCACCGAAGAAGCCGCCGCTGCTGCCAAAGTCAACAGCGAA
GCCATCACATCGGCGACTGGTCCAAACACTTCCACACAAGCAGCCGCCTCCGCCAACGAG
GAGGATGACAAGGACAAGGAAGACGATAAGGATGCCAAAAAGAAGAAGAACCGATGTGGC
GAGTGCCGCAAGAAAGTTGGCCTGACCGGTAAGTGCCCGCCGTGCTGGCTCTTGTGTTCC
CAAATGATGGTACATCATTTCTAACGAAATCCATCTTTTAATTGTAGGTTTCCAGTGTCG
CTGCGGCGGTCTGTACTGCGCCGTGCATCGTTATTCTGATAAACATAACTGCACATTCGA
TTATAGAGAGCATGGCGCACAGGAAATCCGACGCAACAATCCGGTTGTCGTTGGCGAGAA
GATTCAAAAGATTTGAATTTCGATATTGTGCCAGTAACAGTAACAGTAGCCGTAGAATGA
TAATAACCAACTACACATGATAAGAGTACATATATATATATATGCTGCGCTATAACAAGG
AAAGCAACAAGAAAAACAACACCAGCAGAAAGCATAAACACACACCACACAAAATCACAC
AGAGTAATGCTAAATGAATCGATAAAAACTGTAATTGTAATTTAATTATAATGTAAACAG
CAATTTCAAGCAACAATAGTTCAGAGAAACGATAACCAAATACCCCGCAAAAATGAAGCA
ACAACTGGAACAACAATTTCGATGCTCAACAACGTTAAGCTAGCAACGTCCAGCAGCAAG
CTGCGGCAGCAACTTGCCACAATGCACCAGGAAGCAGCGTTCAGCGGCCAACACCTTTGA
ACCAGACGCGTGACAGCGTTAGCAAGTGCAACAACAATCACCGCCGCGTTTGTGGAATAC
GCAGAGCAAACGCAGCAACATCAACAACAACCAGCACAACCGATTGCCTTGGTCGCCTGC
TGAGCTGGGCCGAAAAAAAAACAGTCTTGAAGAAAACACCTTTCATCGATCAACGTTGAA
ATAGTTTGTTATTCCAAATACAATTTGAAAATTGTTTGTATTTAGCTAAAAATCCAACAA
ACAACACACGGCCACATTTGCAACGACAACAAGCACACAACAAACAACAAACCTTTGTTT
CATGTTATCAAACACCGCAACAATCTTTTAGTAAGACAATGTGTGTCATTTGTTTTTGTA
ATATGTTGGAGTGTATTAAATAAAAAAAAAATTCAAAATGCAAAGTATGAAAAGAAATTT
TAAGAAAAATTTAACAAACCCAAATTCACATACAAAACAAAAAAACCAACCAAGCAACCA
ACTCTTTCTCAATTCTTAATTATGAGCTATTAAATGAAAAAAGAAAAAAACTAATATATA
TTAATTAATTATGTATATGTATTAAAAAAGAAAAAGCAAGAAAAAAATATGCAAAATTAA
GCGTAAAAAAACAAAGCCCTCACCACAAAAAAAAAAAATGTAAAAAAAACCTGAAGAAAA
GAAACAAAGAATAACGCAGTTGTGTAGAGCTCCCTAAAAAGTTTGCTAAGAATCCACGAC
CACGCTAGACACGAGCGAGAGAGAGTATAGCTATATAGAGAGAGAGAGAGAGAGCGGAGA
AGCGCGATTAGTGTAAAGCAACGTGGAGCATAACAACTCCCCTATACATAGAAATCTAAA
TATAATTATAATTAATTAGTGAATCAAAGCAGGCGAATGCAGTGCAAGCGGCGTTTTTTC
TTCGTTTTACTTTTTGCCCTCCTGTCCCTCTAACATTAAATTGAATTGATTTTAATTTTC
TGATTTGCGATGAATTATATATATATATATGCATAATATTAACTATATCTACATCTATAT
ATGTATGGTAGGATATGTAAATCGTGTGAAGCATACACACATATAGTTTCTTTGGGTATA
TGCACATTAAGGCGAAAAACAAAAGATAAAAACCATTAAAAAAGCATATTCTATCTATAT
ATATATATAGCGGTTACAAAGAAAATTCAGCAAAAATGGCAAACGAAAAATGCAAAAAAT
ACAATAAATATATATGGTTCGTCTTTAGATTTTTATTGCTTTAAGCGTTATTTAGTTTTT
CTTTGTTTTTATTAAAACACACATGCGTGTACACAACAAAACAACCAATCCCTTTTTAAT
TTAGCTTTCTCCATTCTGTAGTACATAATTTACAATTTAATTCAAATCAATTACACCTAT
GCAAATAAATTTACATTTAGAAATAAATTGTGTTGTTAACCCTACAAACAAAAAAATACA
AAAATGAAAAAAAAAAAAATCAAAACAAATGTTGTAAGTAAAACTAAACTTACCAATAAC
AAAGAGGAAATAATGCAATAAATTTGATTCTACAATTAAAATTCCCGCAAGACCAAAACC
AATCTAATAAGTACATTTTTGGCACAAAGAACTGAGAAGGAATCGTTTTCGCACCACAGC
AACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1622, 13553..13985, 14056..14214, 17115..17307, 17387..18563
13887..13985, 14056..14214, 17115..17307, 17387..17532
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved