Drosophila_melanogaster Locus CG1142
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG1142
Drosophila_melanogaster
CG1142
3R
snoRNA:MeU5-C46
1553..1868
3321
TCGCCCCCACCACCCCGCGGATTCTGGTCTCGACCGGAAGCCGTATTGGGCGGGGACGG
GCGGCGGTCCGGTGCTGAAGCCGGCGACAGTTGCCCGAGTCAGCCACTTTCAAAATTTGT
TGGTTAAGTAACTTAGTAGCTTAGCTTCGGATTTTCGTAACAAATTTGCTGTTCAGAACA
CTTCCATGTACGCGGCATTGCCGAGCAATTTGCCCATTCTTTTGCTGCAGCGAACTACGT
TCCAATATTTATTTATTATTTATTTTGTTATTAAAATGCATATTTATACAACTTATTATT
TGAAAGTAACAATTTCTTTTTTTACAGTGAAACTAGAACTCTCAAAAATAGAACCCCAAA
TGCATTTTTGCTCGTAACAGGCAAACGGTATCTTGATACTAATATACGGGCATGTGTAGC
ATTACGGATTTCGAAGAGTATTTCTACTAGTTTTTAAGTTTTGAGATTTTTAATGCATAT
CGATTTCATGAATAAAGTTTCCTTCCAAAAACTAAATATGTATTTCTACTTATACTCAAT
AATCTCTTTTCCATGAGCATTGCAATATGACGACTATTACCAAGCAATTTAGAAGCATTG
GCACATTTAGGCAGTATTCAGCTATTAGGTCCACCAAGCACGAAGTTATCGGTCCTCGCA
CTCGGAACTGATGTTTTATGTGGAGGTTTACTTAATTGTACGTTCAAAATTGCTTAAGCA
ACTAATTGTTATACCTTAACAAAGAAAAAATAAAAATTGGGGGTATTCCATTAGGTTGTA
AGTCGGTTGTGAATTTTTGAATTTAAACCTTTAGATCAAATGTACTTGTCAGAAAAATTA
AATTAGAACACAAATTTTTTTAAACTAAAAGTAATTTAAGTAATAAATGTTCAGGAATGC
CCTTGCCAAGAGCTAGTATTTTCCAAATTACATGCAGTGCATTTAGTATATTTTTGACAG
TCGACCTGTGAGTGTGTGTGCTACTACTACACGGTCACACTGTTTGTATGTTATAAACAA
GCGTGGTTGCCGCACAAAATGGATTCTATTTTTCTGGTAGACACAACAGGACGCCAGGAA
TTCAATGGCGAGCAGCAGCAAAAGAAGATTGTGTACAACAAAGAGCTGCTCCTGACAGAA
AGTGACGCGCACAGCGAGGAGGACGAGGAACAAAATGAGGGCGCAGTGGAGCTCTTTGGC
CTAAAGTTGAACTCCAAGGAAGTGCTCGATGTCGTGAATTCCCTGCCTGACCGAAAGAAG
CCGGTATCCAAGGTTGCCAAGCAGCTGGAGGACCTCTGCGAAAAGGTCGAGAGTGCAGTG
GAGAACTCCAGCAAACCGAAAGTAGTGCCCCGGAAGCGGGTAACAGAACTGAACCACGAT
GCTCCGCATCTGGACCTGCGGCAGGAAAACCTGGAAAGTAATATGAAGAGGACGAAACAG
GCCTTGAATCCAGGACTAGAACAGGCGCATGCACTGCCCACCGTGGGAAAGAGGCAGCAA
CCCATCATCAACAGAGTGAGTGTGAAGCGATTTGTTCGTACAAACAGCCCTTTTGCCCAT
GATGAAATATTCGACATCGGAGTTTGCGCATTGGCGACAAGACCTAAGGCTCAGACTCTA
GCAAATCTAGTTTCATCCGTTGTAATCTTTGCTGCTGCACTCCAGAATTTGCAGTGGCCG
TAAGGCCAGCGGGACACCAACAGCCAGGGATCAAGACTATTATCTGTCATTGAGTCCTAG
ACAGATAGTTTAGTCTCTGGTTTACAGAACACCCAAATGGAAATGAAACACGCGCTTTTG
TCGACCCAGGAGCCAGTTAGGTCTAAGCTGTTTGTCATGGTGACGACGTCTTTAGTAATC
TGAGCGCAACATATTGGAAATTTCAGACCCTACCTTGCTTTTATTTTTAATCGCCTTCCT
TTTTTCAGGCTGAACGCTCAAAGACCAAGGGCAAGGGATGGTTTAATCTGCCCGCCACAG
AGATCACCGACGAGATGCGAAACGAACTGAAAATAGTTCAGATGCGATCGGTTCTGAACC
CTAAGCAATTCTACAAGAAGAACGACCTTAAGAGTCTGCCCAAATTTTTCCAAATCGGTA
CTGTGCTACCTTCGCATTTGGATCACTACCAAGAAAAGAAGTCCAAGAAGAAGCAGTCGC
TGGTAAATGAGTTGTTAGAAGACGAGAGCTTCCAGAAGTTCAACAAGAGGAAGTTCAACG
AGGTTATTAAGCGCACAGACAAATACGCCTATCGGAAAAACTTGAAGAAAATGAAAAAAC
TTAAGAAAAATAAATAAATATAAAATATTTTAAAACCTAACTTACTCGTCTCTATATTTT
ATTTGAACTTAAATAATGATGGGGTAAATAGTCAAGTCAGAAAGTAGTCACTCCAGAGAT
CGTGGAGTATCGCAAGATCCGTATGGTTAGTACCTTTCTGCGAAATAGAGGAGTTTATTT
TATGTTCTCTTCCTTTGGCCAAATATTTAAAAATCATATTCCTCAGTAAGATTCTTTATA
TTGTGTGTATTAACAATATTTTTGACAAACTAAATTGATAACTTTATTCTAAATTGTTAT
AAGTGAACGAGGAAAGTTTCTTTTTAATTTTATAACCAATCTTTGAATCATGTCTTCCAT
CTAGTTTCCGTAGTGTAGCGGTTATCACGTGTGCTTCACACGCACAAGGTCCCCGGTTCG
AACCCGGGCGGGAACAGAAAGATTTTTTATAACAATTTTTATATATATTTTTTAATGACT
GTGTTTTAATTTCGTTTAACTTAAATTTATGATTTCAAAGTAGAAGAACAGATCGATAAA
TTTCATATAAAGCTGGTCAAGAAGTAAATGTTGAAAAGTGGTGAATTAAGGTATACTTTC
AGGCATCATCTCTTAATAACCCAAAATCGGCGCACCGGCATCCCTTGGTGAAAATGCACC
CATTACAACGTACAAAAACCAACTTTTTAAAATTTTATTTGCCAAATCCACTAAAAGACA
GGGTTTTATTGGAAGCCCCCGTACCACAGCCGAACGCAGCAAGGTACCTTGGAGTGCTTC
TGGATCGCAGACTCACATTTCCCAAGCATGTGACTGACATCAGAACACGCCTACGTGCTA
AGTTGGCGAAGCACTACTGGCTACTTTGTTCGCGCAGTAAATTGTCGCTATCCAACAAGC
TGACAATTTACAAACAGATATTAGCACCAAACTGGAAGTATGGATGCCAAATCTCGGGCT
TGGCATGCGACAGCCAAATAAAAAGGATCCAGGCTATTCAAAATAAGGTAGCAAGACTCA
TCACCGGCTGCGAGTGGTTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1514, 1928..2321
1038..1514, 1928..2293
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved