Drosophila_melanogaster Locus RpL13A
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL13A
Drosophila_melanogaster
RpL13A
3R
snoRNA:Me28S-U2134b, snoRNA:Me28S-U2134a
1715..1791, 1904..1978
3494
CCTCAATAGCCATAAAAGAGAAAAGTCGGACATATTGTCAAAAGTCAGGCCCCAATTGC
ACTTGGAGAGCCGAAAACAAGGTCAACAAACTGGTTAGCAGCAGCAGTCAAAAAAAAAAG
AAAAAAAACAGCCATATTAACTCGAACAGCGAATGTGCCATCGCTTACGCTGACCCAATT
TCGAAATTAGCGAAAAAGGAAAGGGACAAACAACTTGCCCCGGTACAGGAACTCCGCGCT
AATTAATTAATGGCAGAACATCAAACAAGGGCATCTAATTTAGAACGCCGCTCGCTGCAA
CTCGGAACTTGCCTTATAAGGTGAGACGGCTTTCCTGCTCCCAGATCACGTGTGGAAATC
TCTTGTTGCTCCGTCGATTTGTTTATTAAGTGAGAACACCGTTGTTTTGTGGGGGTGGCA
GGGTGGGAGCGGTAGGCACGACCCACTCGCTTTCAGAACTTTTTCAGTCTCTTCCTCTCA
GCACTTTTTTCGAACGCCGAAGCACACGCCTTGCACTCGCCCGCAAATAGCAAATGTCGT
CATGTGAAGCTGTATTCCGTCAGCACTTAACTCGCGTCTTCTATCTACTGCCTCTCTTTC
GTTTAAAAAGCGCGTTTAGCGTTTGCGGCAGACGAAACTGTTTAAACTTTAAAACTTTCT
AGCGATGGCAGCAAGCGTCGAATCAACGAGTATCGATTTTCGAGACTTATCGATATAAGG
CGATGCATCGATGTATCTGACTAATAGCCATTGGCAAACACTCTTATGACACAATGAAAT
GAAGAAGGTTCAATTTTAGTCAGAACATATTGCAACATATTGCAGTTACCACAGGTATAT
CTTTACTATTTAATTGTTAGTAAAACGGAAAAGTATGGAAAGGTGACGACGTCAGCTAGG
AGTGTGTCTCGGCTAACTAACAATGTGACCGTATACAAACATCAATCCGAACTAGTTCCG
GCCGCCAAAGCGACCCTGCGCAGCGATGGTCGAACTGTCAACGCAACTTCCGCCTTCTTT
CCGTGCGGTTCGTAAAAATGACTGGTTTAACGAACAGGGTAAGTGCCGAAAAAAGGCAAA
TAAAGCGGTGCGAGCCTTAAGCAAATGTGTGCAATTCTTTGCGCGCAATAATGGCCAGCA
GTGTGAGAGCTAAAATGAGCAACCAGGCGCGTGAAAGTGCTGTTCTGAGTGTTCGAAAGG
GCGTCGCGCCTTACACGTGCCGAAAAACTGGGCATCTGTGCAAGTCTTAAGTGAGCTGGT
TGCCCTAAGGCTAAGAAACAGTGCAATCAATTGGATGCTGCTGGAAAACAACGTGTCTCG
GGATAAGAGGCCGCCACACACATTTGTTTATGCGCTTGCGGGCAAACCTAACCTAACAGT
GCTCGAGTTGTTTTCGTATTAAACTTGAATTTCCCTTTCAATTTCAGACCGTTGTTATTG
ATGGTCGCGGCCATTTGCTCGGTCGCCTGGCCTCCGTGGTGGCCAAGTACCTGTTGCAGG
GCGGCAAGGTGGCCGTGGTCCGCTGCGAGGAGCTGAACCTCTCGGGACACTTCTACAGGA
ACAAGATCAAGTTCCTGGCCTACCTGCGCAAGCGGTGCAACGTGAACCCAGCCCGTGGTC
CATTCCACTTCCGTGCCCCCTCTCGCATCTTCTACAAGGCAGTCCGAGGTAAGTAACCCT
TCGCCACTCGAAGGAGTGCAGTTGAGTTGAGGCGCAGTTCCATGATGTTTTCAAACTCTA
TTACCTACATTATTTGAACGAGAAACCGTGTAAACAAAACATAACTGAGAGGTGTTGCCT
GCCACAGCTGCTGCTGCTCTTTAAGACACCCAATAGTTCTCGCTCTAATCCCTCTTTTCT
TCTCTTTTAGGTAAGCAATTCAAACTGTTTGGGAAGCTGATCCACGCGACATGATGAACA
TTACATTCTTACCTACATTATTTGAACTAGAAACCTGTAACCAACTCTCAACTGATGCAT
TCATCTAGCCAAAGCTCGCGCCACAATTGTGAATCCCTGACTCACCGGCTATTTTCTCCA
TCCCATTCTAGGCATGATCCCACACAAGACCAAGCGTGGCCAGGCCGCCCTCGCCCGTCT
ACGTGTGTTCGACGGCATCCCATCGCCCTACGACAAGCGTCGCCGCGTCGTCGTGCCCAT
CGCTATGCGTGTGCTGACCCTGCGCTCCGACCGCAAGTACTGCCAGGTGGGTCGCCTGTC
GCACGAGGTCGGCTGGCACTACCAGGACGTGATCAAGAGCCTGGAGCGCAAGCGCAAGGC
CAAGCTCCGTGTCACCCTCAAGCACAACCGCGAGCTGAAGAAGCTGACGGTCAAGGCGCG
CGAGAACATCGCGAAGGCCGCCGAGCCCTTCAACAAAATCATCAAATCCTACGGCTACGA
GGTTTAAGGACAACAACAAGGGCAGAATTACATACGTTCAGATGCGTAGAAGTTTTTTAA
AAGAGAATAAAACAACATCTAGTTTAAAAAACAAATTCGTCTTTGAGGGTCTCCTATTTG
TTTGCACACAGTAGTGATTAGCCATCGTGGATGGACTTTTTCTTATTGCAGTTCAAATGA
CTTCACCTTGTCCTATTCTTTTATGTTTTGAATCTTGATATGCTTATCAGATTCTAGTAT
ACCCTACAATTTAATGTTATTACGTTTGCAAACAGGAATTTGATCTTTATTAGGGAAAAT
TGTAGCGATAAAATACAACTACATATCTAAAGTAGCTTTCGTAATATCAGCGAGTTGGAA
CACTGATACCTATGTTTTAGCTGTCTTTCCAGATCATTCGAAAGATTTAGTATGTCATCA
TAGCTGGGCTCTTTCATATTTTCAAATGATTTGAAGAATTCCTTTTCGGATTCCGCTGTT
TCCTTGCTAATGCTGTTTTTAGCTTTGCTCAAACCGACCATGATTTCATTGTGGATAGCT
TGTATTCCTTCGAATACTTTAAGCATTTTAAGCGTGTTTACCATGACGACATTATCCTTG
ACGATCTCCTCGTAGGAAGTCGCGTTTCGAACTATTGCGTTCGCTTGCGTTGGGTCCATT
TCCATGTACTTGCGGTCCGAGGATGAGTTGCGCTGCCTTTCAATTTCCTCTCGAAGCTCG
CTGGCGACGTGCTTCTCCGCGTTGGACAGAACTCCATGTTAGCGCCCCAGAGAAGCGTGA
AGAGTAGCATTCTAAATGCCTCGAAGAAACCCAGAAATTGGCACAGGACCTCCTTGTCCG
CACCCGGCAAGTTGGTGATCGGCGGCAGCGGTGTGGTCGTTATCCAATACCCACTGTTCC
AGTAGGTCGGTGGAGAGGTCTCTACGGACTCATCGGAATCATCTGGCTTTGCCTCGTTCA
AAGTGGGAGCCCCTGAATCCGCTGGGGCGCCACAGGTGTAGCTCTGAAATAAAAAAAATG
TTTCAGGATATTACCAAAAAAGCTACAGCTGCAATTAAAAGCGAATGCATTTCGCTCAGT
GGAAAGTCTCACTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 1427..1667, 2051..2494
1037..1057, 1427..1667, 2051..2403
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved