Drosophila_melanogaster Locus exba
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster exba
Drosophila_melanogaster
exba
3R
snoRNA:Psi28S-2442a, snoRNA:Psi28S-2442b, snoRNA:Psi28S-3186, snoRNA:Psi28S-3571, snoRNA:Psi28S-3091a, snoRNA:Psi28S-3091b, snoRNA:Psi28S-3385a, snoRNA:Psi28S-3385b
3393..3532, 3604..3747, 4013..4155, 4431..4574, 5339..5473, 5512..5644, 5661..5810, 5830..5969
7806
CAGAGCACATACCGCGCCCCGGGTCGCCGCTTGCGAAGACTCTGCAGGCACAAAGTCAA
TGTCATGCCTGTACACATTGGCACCAAAAAGCAGCCAGCACAGCTGGGCAGTCCGATTCC
CCGAATAAGGTCCAGAATCAGGGCGTTTGTGAGACGAGCGAGCAGCGTAGAGCCAGCTGC
CTTGGGTTGTGCCTCTAGTAAGTCTCCAGATCTGCCGATACCATGACCGAAGTTGTAGTG
ACGGCGAGCCACGAGTTCTGAATGACAAATTCATTACGGGGGATATCGCCTCCTGATCCC
TTACTTACTGCAGGCTATACGCGCCTCCCGCTCTCCTAAACCGACCTTATGTGGATAGTT
ATTGCTGTCCAAGGAAGCCAGCATGTGCACCAGCTCCTCGATACGTTCATCGGACCAACC
ATTTTTCGGAAGCTTTCGCTTGAAAAGAAGAATTATCCATGGAGTTATCAATTAATTTGG
GTTTAATTTCGGTTTGATTACCTTTTCGAGCAGCTCCTTAAAACTGCGCTGCTTACTGCG
TTGCGCAGCCAGTCCCAGTTGCAAATAGTTGTCCGGCACTAGTTTCTCTGGTATATTGAC
CTGCTCAAAGTTCATTTGGCTTTTGGATAATGTAAATATAAACTAAAAGTAAACAATGTC
TATCGCCGCTTTCAGGTGCGCAAAAAAAAAACAGTTAAATTTTCTTACTGAGCAAGTAAG
GCGGCGATGCCATATTGTTTAAATAGCTGACAAATGGACACCTTTCGATTTTGTTTAAAG
TGGAGGAAAAATATATAATATATACAAAGGCGTATTTTCGAAAATAAACTCCTCGCAACG
CTACTAAAATGGACTTAACTTAATTTGTTGAATTTGTTAAGGTTAAATATGAATTTTGTT
AATGCAAACATGACTTTTGTGGAATCTTTGATTCCGTTAAATGTCCGGCAGCGCTGCACC
ATTTTCAGGTCCGGTTAGTGGGGCCAGCCAACAGCTTCACCAAAATGTTGCCACCTTTTG
GACACCTTAGTGAGCTCTGTACCATTGCGTACGAAGCAGGCCACGGTCATACCGCAAGTC
ATCCAGAAGAAGCAGCCCAACAGCTACGCAAAAAGTTACTTTTATTCGCAGCAAAACAGA
TTTTTTTGTTTTAATCGTAAGTATAGGAGTGAAAAATAGCGCTAGAGTAGACCTAAGTAC
ACAGAAAGACAAATAGGGCGAGTAAAATCGCGGTCCTGGTCATTTCTCTGGCCTTGACCA
ATCCTTTGTCTGCGCTTTCGTTGGAAAAGGGGTTATGTACGAACTGCGTGCGTACCTAAG
GCCAGATTAGTCATCGGGCAGTCATATATTCATGCAAAAAATCATTTGGTGGCCGTCGGC
CTTTGTTCGACTGTACCTTGCTCATTATTTAATAAGCGCGACAGCAATATACACACTTTG
AACCCCCATCCCACATTTTTTCTCACCGTTTCCCCCTAATTTTCGTTTTCCCTGTGCCCA
TCATTCCGCTTTCGCCATGTCAGTGTATCGCTTCAAAATGGCGCCGAACCACATGTCTTC
GTTCTCGGCTCGTCCGCTTCGTTCGTGCGCTCGTGTGTCGTCTCATTCGCTCTCCGAATT
TCGTTTAACAAAGTGGTGCGAGCAGAGGGGCGCTGGATTCGAGGCAAACAACACATATAC
CTAGTAACCGATTGTGATAGCTGTTAAAAATAGAATTCCGGACGTAGTCTGAGCAAAATT
GTTAACGTTTATTTTGAAGGCATAAAAGTAAATTCCGTTACAAAAAATTATATTTTCTAT
TTGCTCTCCCCTTTTCTTTGTTGTTGTGTGTGTGCGTGCGTGTCAATTTTACCGTGCAAA
AGCTCGCTCATAAGAAAAGAGAGGTAAGAAAAGAAGGGATCTGCCATCTGTCTCTTTGTT
TTTCGTCGACTCGAGTGAGAAGCATTAACCAGCCAGCGCTTCGTGAGGTTAAATTAAATT
ACATATTCTCGCACGTTCGTTAGTTGTGAAAAAGCAACAGGCACACACACACACACATAC
ACACTACACTCGCACACGACTGATTTCAATTGATTGCAAGGACACGCGGAAGCGGCAAAC
ACAGGGCCAGACTTAATATCCTTGGGTGAAAGCGTAAGTTGCCGTTCCTTATATGTACCA
ATGTGTACTTGATAGCCTAGATAATTTAATTTTTGCGTTTTCGCTGCTATGACAATTTTC
CCGGCCAACTAGCACACAGTCATCGGCGCGTTTTTATGTGCACTACATGCACAATGACCT
CATTTCCCCAGCGCGCTACCTAACACAAGTAACCACGTCAAAATTTCACTTTATTCTGCG
TTTCTATGTCGATTTCTTGGTCGCCTCACCTCTCAATTCTTTTTATTTCTTTTGTCGACA
TTATCAAACTGTAAAATGCACAGTGGGTATGTGTGTGTGAAAAAGAGAGATAATTAAAAA
GAGATGTGAAGTGTGCCCGTTCTCCGCTCTTGAATGTGTGTGTTTAAAGCACATGTACGC
TGGCATTTTTAGGTTAAGGCTTTCTTAGGCTCAGTTTTCACTAGAGTTTCCACTTAAACG
CCGGTCATAGGTGAAAATGTTGTAGTTTGATTATGAGCGCAACGAGAATACATATACAGG
GAACGGTTTTCCACCGCTTGGAGACCACCTTAGTCATCTTACACTAAAATTAAGATAAAT
CTAAAAATGAATCTAGTGGCCATGATAATTTAGTCTGGTCAGAAATAAAAACTTACAGGG
GCAAACCAAAACCGCTTCCATCTCTGATCCACATTTACCTTTGCAGCAATTTATTGTATG
AGTCAAAAAACTGAAAGACCAGTGCTATCGGGTCAACGCATCAAGACCAGAAAAAGAGAT
GAAAGAGAAAAATATGACCCAACGGGATTCCGTGATGCGGTCATTGCTGGTCTCGAAAAA
ACTGAAGGCGACCTGGAACAAATCTCTAAATATCTAGACAGCGCGGGCAACAAGCTCGAC
TATCGTCGCTACGGTGAAGTTCTCTTTGACATATTGATTGCAGGAGGTCTACTAGGTAAG
TTTTCCGCTGCAAGTAATGTGTTTAGTCTCTTCACTGACCCTTTTCCATCCTCGTTTCAA
TTGCAGTGCCTGGTGGTTCTATATCTCAGGATGGCGAAAAGCCGCGCACAAGCTACTGCA
TCTTCGATGCGCCCGAGAGCATGGAGAGCATGCGCAACCATGAGCAGGTTTGTAATCTTT
TAGCAGGTCATACTTAAATTATGATTATGAGTAAACGAAAATTGGTTTGATTGCAACACA
AGTTGAGCTCTTGTTGTTTTCCAAGCTAAAACGTTTATTTACTACTAAATGATTTTCTTC
GGATCCACTTAAAAGTATGAAATTCGTGAAGTGGCTGCATATCATTAGAGCTGACTATAA
AGTTTCAAAAATGTAATCGGTGTCAAGAATATGCAATAACAATCAACACATTTACTTGTC
TTTGGTTTGTCCTAAACACTAACGTTCTGAAGATTTCTTATGTGTCAACAACTACTCTTT
ATTCAACACTATATATATATACTATATGCATGCAACCACTGCGAAGGTCACGCTATTGAA
TCAAAGTGCATATTATTAGAACCGGTTATGCATCTCAACAACTCAATCGGTGTCAAAATA
TGCAAAATAAAAAGCCACATTTTACTTGTCTTTATTTTGTAAAATTACTACCGCCAGCAA
TCTAAAGATTTCTAATGTTGCAACAACAAATACAAAAGCCTCCTGCGTGAGAACACAGTA
AAATTTCACCATCCGCTAACAGGGGCAATCACACTTTACCTTTTCCAGGTATTTGTCAAG
CTCATCAGACGGTACAAGTACCTTGAGAAAATGTTCGAAGAGGAGATGGGAAAGGTTCTA
TTATTCGTAAAGGGCTTTACTCCTAGTGAACGCATCAAGCTTGCGCGTATGACAGCGCTC
TGGTTAGGTAAGTCTTAACATTTATGTTCCTGTTCCTCCTGTGCATTGCTTGCGTCTGCC
CATTCGGTCTTTCAATTAGTTGTTTCGATAAACACTTGTTCAACTTGCAGCTGAGGGGCT
AAAGTAATCCTTCACTTGGTATACTGACTCTTGGATGAACTAACCACATCTAAGGGCCAC
GAGCCCAAGGACAGGATTGCTAGCCGGCCGTCTAAACTTGTTTTGCGAAAACATTTGACT
AACCCTATATTTAACCCTATTTTTGATCAACAGTCAACGGTTCTGTACCGCCAAATGTTT
TACTGGTACTAAACAACGAGCACCTAATCAAGGATGGCATTGCATTGGAGTTTCTACTAG
AGCTGTTCCAGACGTTCAAGCAAGAGAAGGGCATTGCATATCTGATTCAGGCGCTTAAGA
AGGGTGGACTGGAAAGCAAGTAAGTTTTTAGTTGTGATTTGTTTTTAGCCCCGGAATGTT
CTCAGGAAGATGACTCAATGATCCAGTTGTGCATCTTTAATTGATATTCCTAGAGTAAGA
AAGTTCGACGGAGTTTTACCCAATTCGCAAATGACCTTTCGCTTCATTTGGGTGCTGATT
TAATTTCGTACACCTCAATACGTCATTTAAGGTTGATTATTGAATGCGTTAACTTAAATT
ATTAATAATGGTTCCACTTTTTCACGTTTTTCCAGACTTATGGACTTTTTCCCACCGAAC
AAACGTACTGAGGAATATTTTAAACAAGTTTTTCTTGACAAAGAACTTAACGAGATCGTC
AAGCTACATAAGGCTCAGGCTAGCCAGGAGGCGAAGCGTGAGTTGCAGCAGGCGCTCATC
GATGATATCAACGATGAGAAGCCATATAATGAGATAACCTCAGACATTAAGGACTTCTCG
CAGCGCACCAACATTCCCGATCATGAAATAATTGTTATTGTAAGTCGATGCGTAAATAAT
CCAACTGGATGATTTCCTTACTAAATCTCATGTATGATCTTTACCAGATTTGGTCCACCA
TCATGTCATTGGGCGAATGGAACAAGAAGGAGGAGCTGGTTACCGATCAGGCTGTTCGTC
ATCTGAAGAACTACTGCCCACTGTTGCAGGCTTTCGCCTCGACCGACCGTTCGGAATTGG
CCCTAATCTTGAAGGTGCAGGAATTCTGCTACGAGAACATGAACTTCATGAAGGCCTTCC
AGAAAATCATTTTGTTGTTCTACAAGACCGAGGTCCTGTCCGAGGAGATCATCTTGCGCT
GGTACAAGGAGGGCCACTCAAACAAGGGCAAAATGCATTTCCTTGAACAAATGCGAAAGT
TTGTCGAATGGCTTCAGTCAGCCGAAGAAGGTTAGTATGTTTTGATAAATGTTATCAGCG
TGCAATTTTTGAGAATGGTCTTGTCTTAAATAGCTTGATTCTGGTACGTAATTGCAAGAG
AAATTTGGGTTTTTTGCTTGCCTCGTTGATTTCCATTCACTGAACAACGTAGGCCAATGA
AAACCTGGACAATATAAATATTCAAATTTTGCTTCCTTCGAAACTTTACACAGTGCACTT
TTTGAGAATGGTCTTGTCCTGGATGACATTTTCATTGTACAAAATTGCAAGAGCATTTGA
GTTTTTGCTTGCCTTGTTGCCTCACAAAATCCGAGCATCAAAGGCCAATGAAAACTTGGA
CACAAATAGCTGACTTCACCGAGCATGCTTCTTACCAAGCTTTTAAAGTGTTCCCATTAT
TAGGAACCAGTTTTAAAGGGTTCATGTACAGTATGCAAAAGCGAAAGAATGATTGGGTGC
CCATATAACCCAATGCCGTGGTTAATTTGGCCAATAATCGTTTGGACAGCTGCATTTGTC
CTAGTCCGCATGCACAATCCCCTCATAAAAGCTCCGAATGGTTGCTTCATTCGATTGAGC
CAAGCGGGGAGTTGTGCCAAAGCATTTGAATGGTTGGGTGTCCAGATAACTTTCCATAGT
TAAATTTGGCCAATAATCATTTGGACAGCATAACCGGAGCTGCACATCTTTTCAGTTTGT
ACCAATTGAAGCCCCCATACTAACATTTTGTATTCTATTCTCTTTCAGAATCCGAATCTG
AGGACGAACAAAAGAATGGCGAGTAAGAACTTGGTTGATGGCTAAATGAGGATGAACACA
AACGGAGCCGCCCTTTAGCATCCCCATCCAAAAATTCGAAACCAGCACCTGCAACAGCCA
GTCGAACTATATATAAAACTCACCCCTATGAATTAATGTCATTTTGAAAACTCCACCTAT
ATAAAACTCAAAAATTCCAACAAATAAAGGAGAGAGTAAAAAAAACATGCTAGAAACTAA
ACGTTTGCAGTCCAGTCTGATATCATTCACGAATCTACACTTAGTTCCCGTTTGCAATAT
ACCGGCAAACCCATACTATATATGTTAATAAAAGTTTGAAGTGGAAACAGCAGCACGCTC
CAAATTAATAGAGAACATCTGACCGCCAATAACGTCGACTACTACGACCTGCAGTGAGGT
AGCTGGAGTTCCGCGGAGTTGATGCAACAAATAAAAAACCAAAAGAGATACCACAGAGAT
GCTTTGTGTGAATTCGGGGATGTGTTCCGTTTGCATGTTCGCATTATTCATCAATAAATT
TTCCTCATATATGCGTTTAACAAGTAGTACTCACTCTCGAAGGATTTGCCACGGCGATGA
AAGGAAATTAACAAGTTATATTTGAAAGATCAATATCATTTAGCAAAGTTTCGTCGAACA
AAATCTATGGATTTACGAAATATAAGATACATGGACTTAGCACATGTATACGTATAAAAC
CATTAAACAACCCAAAGTATTTAACTGAAACGCTGAGAAAGCATTGTATTTAAATTTGAT
TGGCATATAGGGGCATATTTTTGTTTAACAAATTTAGTTGGCATTATGAGGGGTCTAACT
TCAAATCAGTTTTTTAAGGTCTTAAAAAGATGTGGTCCGATTCTATATTTAAAAGTTTGA
CAAAAAACCAAATCCGAATGCTGGATCCCCATTTCTGCAACTTCGAATATTTTGTACGTT
TATTGTTACAGACATGGCCAAATCTAGTCGTCATTCATTTGTGACAAATATTACAAGTTT
TAAGAAGTTACCTTTTTTCTTTTTGTATTACTTACATTGAATAAGACATATCCCGAAAAG
TATGCAGCACTATTTTGGTTCGGAAGATACAATGTTTGAGATACGCTTTACTCGTCTAGT
TTTAGTTCAACGGAAAGGCATCTTCTAAAGCAAACTCGTGGTGCTTCCAAGTTACAGGAA
TCTGCGAGTTTAGTCCAGACCTTCTGGCTTTTTTATGTTCTAGGTTTTCATACAAACATG
AGCAAGTTGACTCTGCTGATCAAGAATATGGGTGTACTTAATTAAGACTTATTTGAAGTC
CTAGATTGAATTTCTTAAAATAGTTTACCCCATGTCTTGTTTTTAGGATCATTAGAACAT
TGCAAAAGGAAGTTGTTATACAGTTAAGTTTAGTTTTTGGAAATACTGTTTTTTATTCAA
CATAAATTTTGTTTAAAAGTAATTTTTCTTGCATTTTGTATTTCATGTAATGTATATAGT
ACTCGATGTTATATAATAACGCATATGCTACTTGTATTTGTTTGCTAATCTTGTAGTTAT
TCATCATATTGAACTTGGTAACTTGGTTAGAAAATGAGCTTGAAGAATACACTATGAACA
TTGGCGAACATGCGAATACAAGGTTCAAATTTACTGTAGCTCCTGCTCCTGTATGCTAGT
CGTGTGTTTGAACATGGTGTGTTGATTTTTAGAGCCTGATATGATGGCGCAGCGTCAGGT
GGAAACG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1155, 2806..3054, 3126..3226, 3828..3966, 4233..4398, 4655..4898, 4967..5309, 6048..6806
2817..3054, 3126..3226, 3828..3966, 4233..4398, 4655..4898, 4967..5309, 6048..6082
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved