Drosophila_melanogaster Locus CG13594
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG13594
Drosophila_melanogaster
CG13594
2R
snoRNA:Me18S-G393
10844..10961
25167
ATACATACGAATGTGTATAGATGATATATGGCTAGTCAAAGCAATAAACAGTTCATCTT
CACAACTACAAATGGTTTTTAAGTAGGCTTTAAAAAATTAATTAATTTGTCCCCCTACTC
GTATTTAAGCCCAATTGAATTGAATTAAGCCTGTCGATATGCCACTTGCGATGAGTCCTT
GGCCGGGGGTGACTAGAATTTATATGCCCGACCAACTGGCAGCACTCCATTGTGCGCGGC
ATTAATAATAATAATACAGTATGTAATAGTCGCGTCATAAATACTCGGACCAACAGCTTC
AGTTGCGAGGGTGGCGATAGATTTACGACCCTCGCGAAACTGGAATTCGCATAAATAAAT
ATTTTTTGTATTGCCTTTCCCGTCTGGACACCACCCACCAGTATGGTGCGCATTATTAAT
TTCGATATCTGACGGGCAATTATGGTGCCCAAAATGGGCGGCGTTCTTTTTAGCTCATGA
ATTAGTTAATAGGGGATCCGAAAAATTTGGATTGCTCATACCACCACTACTAGTTGCAGC
TCATGATTAAAGAATAAATATTGTACAGGAGCCATTCTGGATTATATTCAGAGTTTAAGC
AGAAGGAAATTAAAGTAATAACTAGTTTGGTCATATCGGTAGAAACTTTGTTGTAAATCC
ATCCCTTTATGCCTCATAATTCGCATTTCTATGGCCAGTTGTGGGGCAATTATTGACAAG
TAATTTGCATTTCACTACGACAATCTATCAATGACTAGCTCGTCATCGGCGACGCCTGTG
CATATTAATTGTGGGCCATTTTCACGCCGTCTGTGTGCCAAAGCAGAAGCCAAAGGCAAA
GGATGCGGTCTCTCCGGGCGCCTGCGTCCTGCGTCCGTGTGCCAGTGGCCCAGTGCCACG
AGTTGCATGCCACTCCGAAGGCGAGTCCGAATGCGAGGCTGAGTCCGAACCGAATCCGAG
CTCAGCTACGAGACACCAGCATCCGGAGGCGGGCTGTGTGCCAGTTGTAATTGGTGCGTC
GAGGCGAGTGGACGCGCTGGCGGATGATTGATGCGAACATTGCGTATACGTCGTGTGTGC
GGTTCAAACGTTCGGCGGTTGTGTGTGCGGACTGGGAAGCTGGTGAGCTGAGGAGCACTA
GCTAACTCGAGGACCCGTTAATTGTGCGCTTGACGGTCTGGCATTGGCCGTGCGAATTAT
AAACCGCTTTCGAGGGCCGCCGGCCGATGTTATCCTGGCGCTCGTCAATGAATTATAATG
TCCTAATACCAATTGACGCGGAGAGCAACGTTGGGGGAATGAATAAAATATCAAAAGCAT
TTTGGGCCCCGAGCTCTGGCTGGCGTTATCATCGCGAATGAGCAAGGGCAATTCTCCGGT
GTGCCGATGCTTAAGTTGATTTCATTGCTCGTATCTGGGCGAGCACACATCCCCTTTGCA
TTATTAAATATTCAGCGTTTATACGCAACAACAAAGAGTCGTTGCTCTTGCTTTCGCCCT
TTGCCCCATTTTTTCCCATCTCGTCTTTTCGCCGAATCTCAAGCTGAGAAGCAAAACAAT
CCTAATGTACATTGACAGTGTGGTCGGAGAGGAAGCTCCTACTGGGCCACGTCGCCAGCC
ATCTATATCCACATTCACATCCACATCCGGATTCGCCCAGCGGGCTTAGCGAGTCATGTT
TACTTAATGGATACGCCCGGCAACTATTAAGTGCTCCCCAACCGCTCCTTCGCCTTCAAT
TTACCATCTAAGCTGGGCGGAGCGAATGTTAGATTCAATATGGTCCTGCCAGTTAGCCAC
ATTATCTGAATGTGCAATACAGCCACGGCTGCAGCTAAGCTCGCTGGCGGAGATTAAGAG
CACCCTGCTAGAGCCATTATGCGCACTTATTATCATTATTATCCTGGAATTACCCCACCA
GAAATACTGAGCCCAGAATTACGGACTTGACCGACCCCGGGGACGGCAACCTGCATTGGT
TTATCTCGCAGGCCCCATCTCCAGACCATTACCCTTCCCACAGGACAACAAAGGCATTCC
GCGCAGGACTCGCTGCGTCCAGATTCCTTTGCTTTCCTTTTTAATTTTAATGCGAATCTT
CCTGCTGCAGGACAGCGGCTAAGGCGGCAAAGGGCGGCAGGTGAGAGCAGCGAAAGCGGA
ACCCCAGGCAAAAAACAGAAAGAATTAAGCCAAGTTGAAGAGCGAGCAAGAAACACCGCC
AGCGGGCGGTCCAAAAGCCAACTTCATTTACGTCTGAAACGCAGTTGAAATAAACGACTT
CACGACACTGGCGGATTTCCTAAAAAGTAAGTTAAGCCTATGCCACCACCTGTCATCCCT
CACCCATCAACCAACCATCCACCACCCACACCCATCTTCACCTGCACCCGCTCTCAGCAT
TCCGGAGCAGCTCATTAAGCCCGGGTGTCGGGAAAAGCTGGGAAAGTTCCAAAGTACCGG
TACACGGTAAATAATGTGGCAATACAATTGGAATATCCATAAGGTTATGGTTCATTACTA
CAGCCGCATAAATCATATTTGAGTTTCCTCATATTTTATATGACATAATGCTCTTAGTCA
ACTGCATATTCTATGTAATAGGCATATTTTTGAAGCTAATATTTTCTGAGGAAAGCTCCA
AGTCTATATTAAATTGAAGCAATTAAATATAGAACACTTATCCAGTTAAATGAATCGTAA
TTTAATGGTTTCGAGCGCAACTTGATTCCAAGTTCAGCGCGCAAGCGAAAGTATCGAGTT
GATTTGGCTTAGACAGAAGTTCTTTGAGGCCGAAACCCCATATTTTCCGCCATGTAAGTG
TGCCCGTGGCCAAAAGGCCAAAGTGGGAGGCAGTCAAAGAGGATTGTGCTTTTGGCCAGT
TGGCATTGTTTCAACTCTGAGGCGGATGTGCCGTCGGAGTCGGCATTTCTGCTCCCGCCA
CTCGCATTCCGCTCATCCGAGCCAAGTTCCCGCATTCCAAGCCGTTTCCTGCCGCCCCTC
CGCTCTTCTTCCATCTACCATATATTTACAATTGTCGAGGGCGGCTAATTAAATTTCACA
GCGTGGGCTTGGACGAGCTCAAGCGATTCAGTTGGCCTACTGTGGAGCTCCCGCTTTTGT
TTGTGTTGCACCTACGGGCGGAATCGGGAATCGGTAGTCCGGAATCCGAAGCCCGGATGC
AACTGGCAGCACTGCATGTGGTTGTCGGGGGAGGGGGTGGAATGGGGTGCCCGAAGGTTT
AGGAACGGCAACAGCTGGCAGCGGAGAAATATTAAAAGTTTTTACCTACGGCTTCCTGCC
AGCTGCCACATGCCACATCCTCACTCGGCTGGTGGCGGAAAGTGGGATCCCCAACCTAGC
GCAGCCCAACACCAGGGAACCTAACCGAAAAATGTCACACAAATGTGGACCAATGCGATT
TATGTGCAGCAGCTCAGTTATGACAATGCCAGCAATGCAAATTCACGCTTGGCCAACCGA
ATGTGCATTAGACAATAATACTGGTAGGGGGTGTTTCACCCATATGTGGCACGTACATGT
ATATGCTAACCAGGATCTTGCAGCCAGGCTGACAGAAGCAGCAAGGACGAGCCAGGACCA
ACCAACAGAAACTCGATTGCCATCGCATAAACAAAAATGTTGCAGAAATTGCTGTAATGC
GGCGGAGCATTAAATAAAAACCGAAAATAAAATTATGTTTATTTTCCCATCTCAACGCAA
ATGTGTGTGTGCGAGTGTAAGTGTGTGTGTGCTTGTGTGTGGCTTCTGGAGGAGGTCTTC
AGAAACTTGCCAACGACACAAGAAACTTTCTCTTGAAGCACTCTCCAAATTATGCTTTTC
CTTCTTGTTTTCCTTATGGGGGGAAACTTGCTTACACCGAATTCAAGAGACGTTAACAAC
GTTTTTCCCCAGCTGTGGACGCAGGGAGGGGGGGCTGGAAAAGCGGGGGCGGACGGTTCG
TATTTATATACAAGTTCTACAAGCTGCGATAAGCAAAAGGAGAGCACATTCAGATGGGGC
TCAGATATTTGACTACGAGGGAACAAACAATGTCAGGCGATTCAATTACATAGTTTCGAA
ATACGGAGACTTTAGCATCATTACTGTCCTGGCCCATTGTGACATTATAGGCCATTACGG
CATCTTAAAGTTGGGATTTGATTAGGGAGTTGCATCTGCTGAATGTTAAAGTGCATATAC
AAGAGTAAGTGTAACTATGAACTAACTAACTAACTTATAGGAACTCCCGAGTTGGTGGAA
GCTAGCTCACATGGATGATCCAACAAATTTTCCAACCAGAAGGCACACAAATAAGACAAT
TTTTCAATACTTATAATTATCCATTTGTCACCGCTTTTCTGTCGATGATTGAACGCCAGG
ACTTGAAATTTTCAGCAAAATGTGCGCATACACGAGGGAAAACACTTGACACACAGCCAT
ACGAACGATATCGCTTCGTGCTTATCGCAAAACGCATCGCAGCAAGGCAGAAAGCGTAGG
AGAAGCTGGGAAAGCTGGAAAAAGGGAAAGCCAGAGGGAAAACTCGTGTGCGACAGTTTG
CCATTGTGCCAAATTGTTAATGCTCAGCATTCTCGGCTCGCCTTCTCCTTTTGGCCGCTG
CCTCGTCTCATTGTTCCTGGCATTATCATTGTATCGTCGTCATCGCTGTTATTCTCCTAT
TCCCCTGCTTTTCCCGCACCCTTCCTTTTTATTTCATTCGCTCTGCTCTACTCTGTTTTT
CTTTTTTATATTTTGCGTCTGCCGGGAAAATGTAATGCTTCTGCTGGCGTCTGGCGGTCG
CGGCGCCAAAGTTTCTTTATGACCTCTGCTCTGTATCGGGGATAACACCCCACACATACC
ACATATATATATATATATATATATATATATATATATGTAGATATATATATAGTATCCAGG
CCACATTTGTGTGGGTGAATTGATTGATAAGGTTGCTGTGAACAAAACAGAAAACAGGAG
TGGCAACAGAACGCAGTTGTAGAAATAGCTCTGCTGGTGTCGCCACAGTTTATGACGTTT
TCCAGATTACGTATACGCAGCGCTGGCATTTGAAGATTACGCATACGCAGCGTTGACAAG
GCAAGCAGGCGAAACTCGAATGCAGCCACCCAAAAACCGAAGGAGAATCTCAAAACATGA
CGCTGCCGGCGGCTAGCTGGGAAACTGAGAAGCTGGAAAACTGGGAAGCTGGGAAACGAG
CAAACTTCGGCCATAAAACGAACGGCCAGAACCGCAAAGCGTTTGCTTAGTTATCCCCGC
CAGCATCTCGCAAACTTTTCGCTTTAATTCCACTTTCCGCTGCCTTTGCCTCATTTTAAA
GCAAATATTGTGGTAGACTTACAAACATCCACTTCCACGTCCATGTGCGATTGCCGCCGG
CCTATTTGCTCCTCCACATGTGACTCAATCCGACCAGACCAGACCCGTTTTGCATGGGCA
TCATTGTTGCAGCAAGGACGACAACAAGGCTGCCAATAAAAAACATCCAACAAATTTGAA
GCGCGTTGAAAGTTTTACGAATCTCGAGGCCCCAAGTTATATGCAACTAATTACGTGCGT
TACATTGTGCGAATTGTAAATGGGTGTGTGGGGGTGTGGATATTTGCACGGCCATATCTG
GTAATTGCCTTCGCCATTTTACGGCCCTGGGGTCTTAGCCTAATGACCATAGGCGTGCTC
CGGACTTGACCACCGTCACCATGGCCATCAATAGATGCAGAAAGTTGGGCCAAGTTCTTC
AAGCTAATCAGATTTACAGGCCAAGTGAATTGCCAGTACGTAGTAAACATGGCTTACAAA
GCACCACTAAAAGTAAAGAGATGAAACTAAGCAGGTTAGCGCAGTATTACTGCAGTTGTA
AAGTCGTAAAGTAGATGAAGTATAGTGGAATATGGCTTATAATCAAAAGCAGCCCACTTT
GAGTTTCCCAGGGTTTGACCCGAACGTTTTCCAAAAGGAAAACATAACGCCAAGGACTTC
TGACCGATTTCTGCATTTCAATGGGCCAAAGACTAACTAACTTAATTTGGTTCTCCAGTT
CAGATAGCTGAAGTCACCGCAAATTTCGAATATATCCTTGCAACACATGATGATGTTAAT
TATCTGACTTTGCTGCACGGCATATTTTAGACAGACTATTGCGGGGTGTGAAAATCGGAA
GAAGGAGGAGAGATTTTCCCTTACCAGCCAACGTTTTTCACGCCCTGCGACAGTGAGTTT
ATGACACGAGTGTAATATAATTCATATTGTACCGAAAAATGTTAATGCCGCTTGAAAAAT
ACCTCCCAATAAATAATCCTTAATGTTCCGTGTGTGTGAGTGGGTGGCTGTGCTGGTGTG
CAAGTGGACGGGAGAGCGGGAGGGCGTATGTGTAGCTGGTGACACCGCCCACCACCCACA
CCCCCTGTTATTTTATGCGGTGTAACCGCAACACATACAACCTAGGTGGTTGGACGAGGC
CATCATGTCCTGACAGTATTATGACGTTGCTCGTCGCCCGCTCCTAACCCGGAATCTCTG
CCCGTGACATGGACTTTAAAGCCGGAGAACCAAGGGAAAACAAAGCGAATGGAGAATGAA
ACATGGCCGCGACAAATTTGTCAGCACAAGGGTGTCCAGATGAAATAAATGGCCCGTTTT
TGTTTCGTTTCTCTCGCTTTATTAATATTTATGTGTGTCTGGGGGCGTGTTTTTAATTAA
GCGGGTCCACGGGACTCCAACTTGCACCAGAACAGCTCCCGGGGCAGCAGTCGGAAACCG
GAGATGCTGCTCATCATGTCCGCCGGAGTGCGATCCGTAGGCTTCAGGTGGTAGCGCAGG
ACCAACTGGAAGATCAGGGACTTCACCTCCATGAGAGCCAGCCGGTTGCCTATGCAGCTT
CGTTGGCCCACTCCAAAGGGCAGGTACGTGAACTGCCGGATCTCGTGCTTGTGCTCCTCG
TCAAAGCGCTCCGGTCGGAATTGCTCGGGTTCCGGGAAGTTATCCGGGTCGTGATGAAGT
GCCCCCACGTTGATGTGCACTAAGTCGTCCTCCCGCAGGTTAACCACCACCTCGCCTTCC
TCATCCTTCAACTGGAAATCAGACCCACACATTCGATCCACGATGAACGCCGGTGGCCAC
TTTCTCAGCGACTCGGACACCACGCAGTTCAGATATTTCATGCCCATCAGGGTGTCGTAG
TCTAGTGGCTTCTCACCCAGCTGCTCCTTTACGGCCAGGATCTCCGCGAGCAATTTTTCT
TGCACTTCGGGGTTCATCATAAGTTCGTAGCTGGTGAAGCTAAGGCAGGTGGCCACTGTT
TCGAATCCTGCCGAGAAGAACAAGAGGCACTGGGCCAGCAAGTCGTCATCGTTGAATTCG
GCCTTATCCTGCTGTGCTGCACTCTCCGCAGATCCTTCTTGCTCTGCCTTAAACTGTCTC
TGCGCCTCCATCAGCAAATGAATCATATCGGGCCGCACGATACTCTGCTCCTTTCGATAC
TTCATGGCACCGAAGACCAGCTTTTTGAAGTAGTCCACGTTATTCATGTCCATCACGGGG
ACCCGAAGTGCCTAAAAGGGCGGAAAGGTTTTACAATTTGAAAAAAGAATGGAGTGGTGA
TGTCTTTACCTTCATCAATTTTGGCATCAGAATGTATAGCATTACTTTGAGTCCGCCCCA
GAAAGTAAACTCTGAAATGCGCTGCCCGATGGAAAAGAACTCGTTGTTGGGATCCTTGAA
GGAATTCACTTGGATGCCAAAGGCAGCCGTCGCGATCACGTCGTTGGTGTAGCGCGTGAA
GAAGTCCTTTAGCTCCAGTTCGGAAGTGCCGGCATCCAGTTGGCGCTGCACGAAGTCCAC
CGCCTCTACATTGCAGAAATGGATGAGCTCGAACATCTGTCGGATTTTGAGGCTGGTGAA
AGTAGGCGTCAGGGTGCTGCGCATTTGCTTCCAGCGACGATCCCGCAGACTGAGCAAGCT
CTTGGAAATCACGCTGGTATCGTTGAATCCTTCAGTTATCCCCTTGCGATGGTTGGTGAA
GGTATCGAAGTTCTTGATGCCCACCTGGCGAATGAGTTCCGGGTCGGAGAGATAGTATAG
GGGATCCCGCAGGTTGAAGACTCCATAGACCTTGTGCTGCTTCAGGCGCAAGTGCAGGTC
AATGCTAATAGAAACGGTAAAACGTAATTAGAAGGAGCTAAAAAAAATCGTCATATTTAC
TTGCCTATGTTTTATGTACGACTCTTTACCCATCAGCACCGACCACGGAATATTTCCTAG
CAGAGGAATTGGCTTTTCGTGGGCCACGCCCCTCTTCGAGAAATACCCGAAGGTGTAGAC
GGACCATTTGTACAATAGCAAACCGATGAAGGCTACGAATATCGACAACTCCACGAAAAC
CATGACGGGATTTTGGGGATGGAGCGTGGGAGTAGGGAGTAGGGGACTCTAATCGAGCTG
CGCAGCGCGTGGAGGTTCCGAAAAATTCAGAGAGCTACTTCGCCAGTCAACAGACGGTAC
GCCACTGAAATAAACAATGTGCGCTCTTTCTGTATATATATAAGCTATCTCGGAGAGAGA
TACTATAGGCACATATATAGCGGGAGAGAAAAAACCGGCAAAACGTGTGAGTGTGTGTAT
GAGTTTACCTGATTAAGCGAAAGCGAAATAAAAAACAAACATTAAAAGAATAAGTTTGCT
TATCAATTAGCATTGGAAGTCACAAGAACATAATATAATTATATTTATAAGAACTATCTG
AATGCTATTGCATGCTCCATTAACAATATATTCAAAAACCACATAAGCTACAAATTTCGG
CGCAACTTTCAACCCCATTGCGAAATGGGAAAATCAAATGACGTAACTGAGATATATAAA
TAGATCCTAATCGAAATATTCCATTAGATGGTAGCAAGATGGCCACACACAAAACGGATT
AATTCGAACAGATAACTCCAATCTGATGACTAAGCTACTTTGCTGGTTTCCTGGAGTAAA
CTCACTAAGGTCCATGAGCATGTGCGACTAGTTTCAGTTCTCAGCCGGGATGAACATGGC
GTTCGGCATGTCATGCCTAATCTCATTGGCATAAACTAATTTCAGCACTAATCCCCCAAA
GCGACTCAACTATTTATTATAAAGGACTTAGCGAAGACAGCCCCGTGGAGTGGGAGCCTG
GGGTTGCTTAAGGAGCCGAGGGAGCTACGTGCCTGGGATCTTCCCGCAGCGACGACCTCA
AACTAAAACTCGAACTCAAACTCGAGCTATGTCCCTCGCTGCATCTACACTGGCAAAGAT
ATAGGCCGATTGAAATATGTCTAATTTATTATATATACAATTAAAATAATGGTTGGGTTT
TCCACTGCACTGCTTACATTGGTTTTACGCGGAAGGATCGCTAACAAATCAGAATTCCAA
ATTTAAAACACTCTTCCAAGTGGAGCAGAATCCTTTTGAGAAGTACAACCCCGCATGATT
TTGTGAGTTTGAGTGGTGCAATTGCTTGTAGTTTGCAGGTTGGAAAAGTTTAGTGTGCCA
GCATCCAGCTTCTAACTCGCTCTAATCCGAGACGTCCTGTGCGAAGTCCTTGGCCATCCA
ACTCACGTCCCGGCCAAATGACAAAATTTGCTTGCATTTAGTGCGACGCTAACGGGAAAT
TATTGCACTGCTTGCAGGACGAGGGAGCGATGGAGCCATGGAAAGGACCACAAAGGATGA
TGAATACAAAAAGCCAACAAATCGGTTGGCAGGCAAAAATCCCATTTGATTCAGCGGTCA
GTCAGGAATATCAAATGAGAGCAAAATCAATCTCTCGCTCGTCCTTTGAGCTCCAGTTCT
CGCCCGTCTTGTTGTTGGGAACTAAGTCTGTCTTTCAATGGAACTGCTGTTTGGGGCCAG
AGGCGCAGAAGGTCCCGAAAAAAGGGGTGCGCTTAAGTACTATCTTTTCTAATGTCCTTC
TTTTGATGATATATATGTACTTGCAGTACTTATGTTAGCTTCCCACATGAATGAGATCCC
TGTTTATAAATCTATCCTACGCCACTGGCCATCTTCATCGTTTTTGTTTCTGCTGGATAT
CAAATGTGTTTACATTGGCAAAAATGGGTCGAGGTGGGCGAGTTCAGGGGGAGGTGGAGT
GGAGTGGAGTGGGGCAAATGGCCAAGTACTTGAAGACGTTTTTTTTTTGCACTTCATTGG
CAACCGATGGGTTTGGGCCATTTGAATCGTTCGTCCTTGCAATCGACCTCGTCGTTGGCT
TTGTTGCTGTTGACTTGGCCGTTTGCGAGTCTGTTTTCACTTCCCTTTGCCTTTCCGTTC
GCCATTAGGACTCAAGTGCCGCCAAGTTGTGCTCCTAAGTGGGATCCTCTTTGATGTCCG
CCCAAATACCCAAAGTCAATGTTTTGACATTCTGACTCTAATTAGGCCAAAACGCTGTGT
TTTCTCTAATCAAACGGATAATAACGCTATCGCGGCCGCGCACACAAGCGCAAACATTTG
CCCAGCCAGTAAGTGTGTGTGATTTCGAGTGCCCAGAGCGGTGTGCATAAGGTGCTTCGA
GAGGGAGATGGGCGGAAGTGGGTGGTGCACTTGACATATATCCTGCATTGACCATAACCA
CCCAACCAATAAATCACAAATACTCTTACAAAAAATCTAAAGCTCATCTTTATTTTGTGT
ACCATTCGTTATGATTGCATCATTAAATAATTTAAAATGCTTTGGGCTTACCTTTAACTA
TTAACTTTAATACAGTTGATTGAATCGCTTTTGGAACGCCTTGAGGCAAACACTTGGCCA
CTGTTGCTGATTCCGAATACGAGTTTCGTCTCTTGTACGTATGTCCTGTCATGCTGAATT
TTAATGTGGCTCCCTTTCCTGATGTATGATTTGATAATTTATAATTAAAATAAACAAACA
ATGCAGGACATCATAAGTGTTTGCTACTCCGAATCTGAAAGTATGCAACCCGTATTAAGT
TATCTTCAAGGATTCCTTAGAGACCTATGCTGCAATCCTGGGGCCTGGTCAAATCCGCTT
TGAATAACTGCTTATTGGAATGCCAAAAATGTTTCTGCCCGATAATCGCGCCATAAAAGG
CTTAGCCAACTGCATAGTGGAAAAGGACACACACTCACACACTCGCACGCCCCGAAACCA
CATTCCATATAAAATGTTAATTTATTGCCATTGTGGGCCATTCCACAAACGATGTTATTA
TGCAATCGCTGGCAAAACATGCCCGGAAAAATGCCTGAACACACAAAGCAAATCGGCCGA
ATTTCAGTTTAAATGTGTTTCTATGGCGGCGTGACCCCAAATTTATGACAAACGGAAACC
GTTTTAGCTAGATTTTTCGCCAGAAAATCAACAAAATGCAATAAATATGTGTACAAAAAT
AAAGCAGCCAATGGAGAACAGTGCTCTGCCCTGGCCCCCCGGCCCACTTATTGATTCCGC
CCGATGCGCCGCCTTGTCGTCGGGATCTCGTTTTGGAGAAAGTGGCCAAAAGACAATGCC
CGAGCTGGCGGCCAACACCTGCTCGCACGTGACCCGGCCCAGGAATTTATGTGTGTCGAA
GGAAATCGAAAAACATTTTTTATGCACACATCAAATTTATGGCCAAACAGGGCCGATCTC
TCCAAATATGGACTCGGCCAGATAGCCTTCTCCCACTCCAATCCAATCCACTCCTCCCAT
TTTGGGCTTCGCGACCTCCTGCACTCCCCACCCAGCATTCCTGCGTCAAATATTTACTCA
CGGAGCCCGTCCGCCGGCAACGCGACTCCTGTCAATTGCAAATTCCTGATCCAGGGGTGC
GGGTCAGCCATGTCCCTGCATAGATGAGTCCTGCTTTGTGCGCATACCCGTGCACTGGGG
TATCCGGAGTTGTCCGCTCGTCGATGGAGGCCAGATTCCACAGCTTCAAAGCTTATTTCA
AAGTTGACCAGCACTTTTCCTGAATTTCTTGTGATGGCTTTAAATTATCATAAAATTAAT
GATAAATGGGAGAACAAGGAAGGATACATGGATAGAACTAAAACATATAGAAATTTACTG
GTACTATTACTGCTCTTTCATCATATGTACTTGCCGAAATAATCGAGATAATAAGTGGGT
TAAGTCCCCCATATGTTTTCAGAGCGATCGAACCACTTGCCTTTATAGCCTTTACCTAAA
ATCCTGTTCTGGCTAAAAAAAAAGAATGCCCAAATGTGATAAGGATGCTTACACAATATG
GGCCTTGACCCTCGTTCCCCTGCCGTCACTGTGCGCACTCATTCAAATTTATGCTTATGC
CCAAACGCTGATTATGACAAATATGTCACGGTCCACCGAACACGCCACCCTATTACCACC
CACTTACAACCCACCCACCACGTGGTACCCCCCCTCCTTCTATGGTGGCCTATTATTTCT
GTGGTCCTGTTTGTTTGCAGGCGCTTTGTTAGCCCTCGGTCAGTTGACGAAAATCCCAAA
ATAAATAAAAGTTGTATTATTAGCTTGGTGGAGCTTGGTAGCGGAGGGGCGGGTGGGACA
ATGGATGTGACAGGATTTCTGGCTCCATTCAGACGGCCACTAATGACACGCACGCAGAGT
CTCAAATAAATATGGGCACACCAAATTTGTTTTATATATATTCACGCATCGGGGTGTGTC
AACAATTATACTGTGCAAATTGTTCGATGTGTGTGTGTGTGTGTGTGGTGCTGTGTCACC
TGCCACATTTGCTTTATTGCCACTCATTAGAGATGCTCGTCGAGCGGCAGGTGAACCCTT
CCACCTGTACCCCGCAACCCTTGCGACTTTGGCACTCTCGATGTTTTACATGTTGCTCTG
TTGACTTCCAGCACGTATTAGTTTTTCCACCCCGAGTCCGCCCCTCATCAAATCCCTGCG
ATTTGACAGCAAATGACAAAAGATTCCGCTCGCCAGCTGCTGCGACACTTTGATGAATGG
GGTCACCGAGTTGCGGCTCCAGGATTTACGGCTCTGCCGAATAGGATACAAATGTAAGGC
GCTCCTGCGATCGGAGTTCACGTACTCACATGTACGCCCAAAAGTTCAGAACACAATTGG
TCCGCGATTCTAAGCAAAACTTTCTTCTGACAAATTCCTATTTCTTTACTGCTACTACGT
TACTGTTACATTTCAAGTCCGTAAGAGCATTAAATTACTGATTTAGCCTGTTTTGTATTG
CTATAATTACCACAATGAAACAATAATTGTGGAAACTTAATGCCTGTTGTTTATTAATTG
TTTTTGCTGAACGAATAACGATTAAACCTTCAATAATAGCCGCATAGTAAATTGCAGCTT
TATTGCTAACGGATTATAATTATTCTTCATCTGGCATAAATAGCATTGAAATTTAAATTA
GAAATCGGACTACGATTGTTTTTGCCAAAATACGGATTTGGTCGAACAATTTTTGCCAAT
ATGGCAAAAATACCACTTTTACAAAAAGGTCTATCCTCAAAAATTATCAAAAAAGTATCA
AAATCCTTTTAGAATGAGTTTTTTGCACTGCTAAAGGTCCAAACTAAAGTTCACTATCAC
AATCCGTTGGATTTTCAAAAATGAATTTTTGACCAATTTTCGAATTTTTTATAAGGGGTA
ACATCATTAAAATTTGAAAAAAATTGAAAAAAATTAAAAGTTTCAAATTTGAACGCAGAT
CGATTAGAAATGTAATTACGAGTTGATCAAAGTACACCATTCTGAATTTGGATCATAGAA
TCGGTTTTTTTGGCGAAAATACTGAGTTTTTGGCAAAAAAAAGAGGTTGTAACCTGCGTG
AATATCATACATCCATTTCACTTATTGTTCGCTCTCAATTTCGAGGATTTCAGAACCATG
ACTTTCCGTTCGGCAATTGTCGTGGCAACGGCGATTACATTGAGTGTGCGATGCGTAATT
GTCGGCATTTCTGCCGGACTAAGTCGAGCAATCTCTCTAAGCCAACAATAGAAGGGTCTG
TGAAACCCGGATGGCGTAACTGAGCCGGAGCCGGGCCAACAAAAAAAGGATTATTTTGAT
TATTTTGCGTGTTTGCCGGCGAAAGTTAGTGGGCGGCTGGGCTGGGGTCTGTTTATTTCA
ATGAACTTGCCTTTCAAACGAAATTTTATCATGCTTGGCCAGGCCGAGTTAACCATTTCG
CATTTGCCCGAGAAGCTTCGCAACAATAAACCGAATGCGTGAACTGAGCACTTTTGAATG
AAATTTGCTTATGCCTGTGCCTCATATTCTCTCCTTCTCAATCCCGCAGACATCCAATCC
CTGTGGCTAACGAGCTGGCTCAGCTCCGGGAAGACCAGCGGGAGGACCAAGCGGAACACC
GGCGAAGGATTCGGAATCGGAGGCGGAGGCCACGAGAAGCGCGCAGTCAACGTTTACACG
CTCCAGCAGCCGCATAAGTTTCCGCTTCAGTTGGACGTGCACGTCGGCGGTAATTGTAGC
TTTGATTGCCACCAGGAGCTGGACAGGATCCGTCAAGCCGGCGTTCCAGCGCCGCTCCAC
CAGTCAAAAACACCTTCCTCGGCACGGGCCGGGGAAATCTACGAAACCAAGTTTATTGAA
TGCTCAATGGGTAAGCAACCACTCCCTCCCAGAAACAATCACAATCAGCAGGCAGCAATA
AGAATTTAAATTAAATTTTCGCCTTTTTCCGCCCCTCGTGTGCGCTTTTCCCGGGGATTT
TCCCTTTTCGATTGCGGAGAGTTGAAACAGAAACGCCGTCTGCTGTTTGATTCCAAAGTT
CAATTTGCATAATTTTGTTAAGCAATATTTTCGACTCGGCTGGGGTAGGGATTTCCATGG
GTCATTCATACGGTTTCCTATCACTCCAAATCTGTTTCAGTAGCCTAAATGCCGTGCTAC
CCTTATCCTTATAATCATGTATTTGCTTCAGGGGAGTCAGACAGATAAGATACTCTTAAA
TAATACTCTACTCTTGATTTAAAGCACTTAAGATGAAATATTTAAAATTGATTCGATTCG
CCATTCAATTGAAGTAAATCACAACCCTTTTCTGTTGTCTGTGCAGCCCAGACGATGGAC
GACATGGTCTTCCAGTGCAGCAATCAAAACTCGATCTATGTGCTGAATGCCAGCTACGGT
TCCTATGGGGTGAGTCCTGCCAGTCTGCGAGTCCACTTGCACATCTATCTGAGCCTCTTT
CGCCCTTCTTTCGGCACTCTCTGCTTCGCATCTCTCCACCATCTTGGCAGGACTATGGCA
CATATGCGGCAACAAAGCGTGAAATAAATGGCAGCCGGAGCAGAGCAGCAAATCCAATTG
GGTCGACTTGCTCGAGTGGCGTCCTGCAGCATAAATTCAAAACTTTCGGCAGTGCCGCAG
CAACAGCAGCAGCCGCGGCAGCTGCAGCGCCACCAGCCATGGATGCAGCAGCGGGAGGCG
CAGCAAACTACGTAAATCCTGTCGCTACATCAATGTCAACCGCAATGTGTTCACCGGCAA
CGGCGGCAACGGCGGCCCTGCAAAAACTGTTCAATTGCAGCGTCGGCGTCGCCTGCCAAA
ATGTCACCCACGCCCACAGCAACCACACCAACCAAGGCAGCAGCAGCATCAGCAGCAGCC
ACATCCACATCAGTGGCAGCAACAACAATGCCGCCGCCAGCAACCATAACAATAGCTGCC
TGTCGGCGGCAGGCGGAGTGGGCCTCCAAGGCGCCCGGAATCGGAGCCGGAGTGGCGAAT
GCCTCGATGGCGCGGCGGGAGCGGTTACCTCGCCAGCCGGAGGCGGAGGAGCAGGTGGCC
TCCCTCTGCTCCCAAAGAAGAAATGCACCAATGTCAAATCAGCGCTTATTGCCAAGAAGA
CAAAGTTTCTCAAATATCTCGAAGAAGAAAAATGGCGCAGCAACGCGGCAGTTCCGGAAG
ATGCTGGTGCCATCAGGTATGTAACACCCAGACACTCGGAGAAATTCGAACGCACCTGAG
CTCAAGACAATATAATATAATAATTTTGTATATATAATTTTGTTCACTTGCATATTCCTG
TGAGTAGCGGAATTTTTGATATTCCTTTCAATTTATTTGATACCAGTTATATATTAACTT
ATTTTTTCGAGTGCACTTGGGGCGAGTATGTGCGTTTGAGTCAGTGTGGCAATCTCCTAG
CCGTCGCAAAAACTTATAAATTCCCATAAATGTTATAGGGCGTCGTGCAACGCGCTGCAA
ACTGTGGCAAGTTTTATGACGGCAATCCGGGGGACAAGTGCTGGCTGGTTCCGCGGTCCT
AGTTGCCATGCCGAAGTGGTTTCTCATTAAGTTGACTGAGGACCGTCAAATTCCTTCTCG
TCCGGCATGCGATTATTTCATAATTTCATAATTAATTATTGAAGAGCAGCAATCGGCGTT
AGTTGCCATTTATAGCCGAGTGAATCGCTGAACCGAACCCATCGAGGCCATTATTCCAGA
TATCGATTGGTCACTCCCCTTGGTTTCTACGGTGGCCACCTAGTGGCCAAATGCGCCTTT
CTTGTCCGGACTGCGGCTTCTAAGCGCTTTCAATTATCTGTCAGCGGACACTTTGTTGCA
GCGGAGAAACTTTGTGGCGTTGTTCACGAAGTCATAAGTTCTGATCATCATCGCCGAGCA
AAGTTACTTCCCGCATTTTCCACCCCATTTTCCGCCCAGCAGTCATTTGCGAAATTGAAA
AATTAACGCGGTCGCCGTAAACATAAAGTGAGGCGAAAGCATCGGCGCTTAAAGAGGGCT
TAAGAAGTTGATTAAAACGCCGATGCCGCCCAGCCCATAAAGGCACATATTGAAGTGCAA
TAATCACATTCAGCGAAACTTGGCGCCCAAGTTGCACTCACATAGATGTTACGAGCTACA
CCCGTCCCCAGACATCACTCATATGCACTGTTTTTTGGGGGCCCCCTCCCCACCTATCCA
TTTTGCAATAATGATGTCAGAAGTTCGCTCGCTCACTGAACATTTTCACTGGCAAAGGCG
GCTGGGAAAATTTCATTAATTGCACCGGGCGAAAAGGGCGGCTTCGCTTTGATTTATTAG
TGCCCTGTGCTCATTTAATTAGTAAACGCCAGCCGGGAAAAATGCAAAGCCCTTCGTCCT
CTTCATTCTTAGGCATTTCCACGGCGGAAACTCTCCGGCGCGCATTCATCAACTTTGTGG
ATGGCGACACCAGCAAACTGACAGGAATAACTCCCAACTCGTGTCGCCAAGTAACTGCGG
AAATTTGTTGTGCAAAGTTATTCGCTTTTGCATTTTTCCCACCGCTTTTCGCGGCCTTGC
GCAGCCCGCTTTTCCGCTGATGCGGCTTAAAGGCTCCCCGAAGGTGGCTTAATTCATTGT
GGACACTGGCTGCAAATGTTGGTGGCGCCCATTTCCCAGTCCGATTGTCGCCGCAAATTA
AATGGGAATCATTGTGTTTCAATTTTAAGTTCTTTTGCGGGCGGCGAAGTGTTGCAGACG
TGGTGAATTATCGCTTTTATCGATCGATTTGCCTTTGTTATCGCTCGGATTCAAACGCTT
TTGTGATGCTTCTTTTCATATCTTTTGGTTTCCGCCAACAACATTTTAACTATTTTGTTT
TCATAACACACCAATGTGTATTATTAATATGAATATATATTGTTGATACTGATTTTAAAT
CAACCAAAAAATAGCTACAGGATATTTTTGTTAGGTGAAAACCATTTTATGATTTCTGTT
GAGCTAACGCACTGTTTATATTTTTCCAGTACGATAGAGCCTTAATTTTCCTGTAAACGT
CAATTACCATAACCATGTCCGTAGCTGCTTATTTCCCACTTTATATCAATTTTTATGGGG
ATCATGCTCGTCCTTGCTAATCGCTGCGAGTCCTTCCACGCCACTTGCAGCCATTTGATA
CGCGTTTAGTTTAGTCAACCAAACGCTAAATAAACTTTCATTTAACATGCTCGACAGCAA
TGAGGCGGAGCCATCCACCCCGAGCGGCAACAACAACGGCGGCAACTTGAAAAATCAGAG
CAACAGTCGGGAGGCTGGAAGTGGCACTGGAAGTGGCAGTGGAAGTGGATGTGGAAGTGG
GGGGCAGCCGAACAAACCGACCAACTGGAGCATGCATAATGAGGACACCAGCACGTCGCT
GGCCAGCCACCAGCAACTACAACAGCAGGCGAAATCGAGTTCCGAGCTCTACCAGGAGGC
AGCCGACATTTTGGGCCTGAGTTGCAGCCTCTGTGATAATTGCCGATGCCTGGACTGCCA
GGTGAGTAACTGTGGGAGTGGGGAGTCGACGGTAGAAGGGGCAAACAGCACCTGATTTGG
GTATGATTCATTAGGTCTCGATACGCTTACTGATGAATATACAATACCTGTAGTCTTATT
GGTTTGCTAGCTAAGCTTTAATAACTTAATAGAGATGAATTGAAATCAGGTTTTCATAAG
TACGCCTGCCTTGTTCGGCATATCCGCAATGATGACTCCCCTCTTCCCGGCCAATCAAGA
GCTCAATCTCGAAAGTTAACCAACCAACCATTCCCCCACAGAGCGGCTACTTTGACTGCG
ACGACGACGATGAGAGCTACTCAGAGCAATCGCTGATGGACGACGAGTACGACGAGTTCG
ACTGCGGTGCGGAGGAGCTGCAGGCGGCGATGACAGCAGCCCGGCACCAGGATGTGCCCC
GGATGCCCTGCTGCCCGCTGGGGGCGAGTTCCCACCTTGCGCACAAGGTGGACTCCCCGG
CCGTACATATGCCCCCGCAATCGGAATCCCTGGGCCATCGGGTGGCCATCGATTTTGATT
TAATTAACGCCACTTGCAGCCAGGTGCTGCAAAACTGTGAAACATTCAACGATTTGAGTC
TGCTAGATTCCGCCGCCGGAGCCGAGCGTCCTTTCACGTAAATCCAGGTAGGTGTCCGGC
GTGTTGCACAACTACGTGTGTTGTTTGTGGGGCATTTCGTGAATTCCGGAGCGCTGTATG
ACAACCATATCCCCATATCCCCGTATATCAGCCAGAGCCCGTTGGCAAGCCGATTTGATT
TTACCTGTCGCCGGCAGTACCTCCTCACCGGGATCTGGGATTCGGGATCTGTCCGAAATC
CACTGCGGACTCGCAGATTGCTACAGCAATTTCTCATTCGTTTCCTGGCAGCGAGAGTGA
AACCGAAATTGGGGCTTATGCAAAAATGAGCAAATTGCATTTTATTCTACGGAAACGCAA
CAAAAAGGCTCTCGACTTAGAGATACCCCATTCGTACCTTATACCTTAGACCGTGAGATA
ATTTCCGCCTTAGATCTCAAAACTACTTAATTTGAATCCAGTAATTTCTGTCTTTGAAGC
GACATATAAGCGCATACACTCGTACCAAGTTCAACTGCCCCAGTTCTTATGGATCCACAA
ATCATTAGTACTTTTGAGGACCGCTCCATCCTTGAACCCAATGAATGCGGGGTACAAAAA
TGCTGCTGAGTTGGCAAGCGAATTGCAGGGGGATCGGGATGAGTTCCAGAATCCGGACCG
CAACAGTGGCAAAATGGCCTGGCACTGGTCAGTTTATTGCATTTAGTCAAGTTTCGCTGT
TTGCATGGACGATTGCTGGCAACAAATGAATGGCGGTGTTTCGAGGTTTGGGGAGCCAGG
AGATTCGGAAGCTGAGGGCCGGCAAATTTGATTTTCCCACACACACACACAGACAGACAG
ACACACACACTCCCACCGACAGCAGGAAATTTTCCATATTTGTTGAGGGCTCAAAGCAAT
ATGCAAAACATGCACTTCCGTTTGTTTTCCCCCGCTTTTTCCGAATTAAACTTTCCATGC
TGCTCTCGTTTTATTTTGCAGGACTTTTTGTTAGCCGCCCATTCAATTGAAATGCAGTCC
AACAAAGGGCTCAAAAGCCAGGCTGAAACTATGAAAAATTCATTGCTATCAGAAAGGCAA
GCGGCAAAAATGGCAAGTCGAGAGCGCAACTTAAATCGAATTACATTTACGAAATGAAAT
TTAAAGAGCCAGTCCTGCCGAGTGAGTAATGACTGCTACAAGCGGTGGCAATAAATAGGA
TGCTCCTCGCCCGCCAATCCCCAATATCCCCACCATCCCCACTGCCATCCCTTTTGGCCA
TGCTCCGCTGCTCGCTGGCAGCCAAAGCGTCCAAAGCCTACCATCTAAGCCCCGGAGGCT
TAGTGTCTACAATGATGCACTGCGAGAAGATGCTGATCCCGTTGCTAAGTCAACGTCGTG
TTATAAACCTGAAAACATATTAAAATGCTGTCTTTCTCTAGAAAAACGGATTACATCTGG
TGCTGAAAATGGTAGTTGGCTTGGTACTCATTTGACATATTAAGTTAGAAGCACGCAACT
TTTTCGAGTGCAGCATGTGGCCAAGTGAGTGTGCTCGAATGCGAGGGAGTGGCCGTGCCA
ACACATCAAGTGCATTTGGTGTTGGCCAACACCTCCCCGAAGGAGCAGCACCCAGAGCTG
CGCCAGCTGTTGGCCATTTGCCAGGCACTCGCTGGAATTTCGCTTGGCCAAAAGACAATG
CACTAAAAAGGACGCTTGGCCAAAAACATGATCTTCGGCGCCCTGTCCGTGCGAGCTACT
TATGCAGTTTGTGCCCACGGGCACTGGGCTTTATTGAAAACTCATTTTACCTTAGGTTTT
CCGACATGGCCCATTGGGCACACCGTTCCCACTTCCCACCCCCCACTAAAAGCAGTTAGA
TGGAAGCGCCAGCCATAAAACCGCTCTGCAAATGAAATTTTACGCAATGCCCACAGAGCT
AAAACATTTTGTGGGCCAGCTTTTATTTCAATTTCCCATTCGGACGCTGGTGCAATTTCA
TTACCATCCAATAACAACACCTGCACTTTGTGAATCCACAGGAAAGCATGTAAAAGCAAG
GGATGAGAGTAAAGAAGTCAAGGTATGAAAATAGATACAATAATTTTCGTATTTCTAGCC
TTGCAACTTTATCGTGGAAAATGCTTTAATAATGCCATACCTTATCGACCTGAAACTCGA
AAACTATTTTGTGTTCCACTCCAAGTGGTTCCCCACTTAATCAACCCCAGCACCCAAATC
AAACTTTTCCTGCGGTCTGCGATTGCCAGTTTAGCTGGTCCAAAGTGCTCCTAACCACGG
TGCGCTGCAAATCCGAATGCAATTGCCATTAGAACCCGGCCGCAGCACGCCCACAACCAC
GCCCCGCTTAATGATGCTTGATTTAATTAATGCCGCATTACCTACGTGGCAGGACGCAGT
CCCCGACTTGGGGCACTGGGATTCCATTAGGGATTGGGACGCGGATTCGGCTGGGAATGG
GGAATCGCACGGCCGGATGGCAATTGGAAATTGTGCGCGTCTGTTGGGGAAGCAGCGGCG
ACAGGATGAACCACATTGCCATTTGCTGATGATGATAATTTATTGCCCCGAAGGGCTTAT
GGGGGCCTCCAATCCACTTCTCCCCGCCCTTGGTTTTCCGGACCCCGCCTCCTGGGCTCC
TTGGAGGAAACGATTTCCGCTTCGGCCTGCCTCGGGCGTGGGCAAATATTTGCCATGGCT
TTCTATTTCCCCAGCCAGGCCAAACAAATTGTTTACAATATTTATTGTTTGTTCGATGTT
CTGCGGCCGTTGACAATGATGAAATGGCAACGGACCCACCGCCCGGCCGGGAAATCAGCG
CATGTGACTTGACCAAAGGAACAAGGGACCCCGAATGTTGATGTCTGGGTCACGACAACG
GCGTCAATGCTCATTTCCGTCGACATATTTTCATTTCCTTTCGACTTTCTGCTCCGCCTT
CGCTGGCTGTTTGTCCAAGGATTACCAGCAGCTGGCTCGTCCTTCCGCTCGTCCTTCGCC
GCCGCCGAATGAAATGTAATTCATTAAACTTTATTGTCCAGCGTTTTCCACTGACCTCGC
CCTGAGTTCGACTCCAGTTTAATTTGTTGTTGCGGCAGGAAAACCTCATTTATTGCCCAT
GTACAGGAAACTTTTCGGCCGAACTCGAAGCACACAAAAATAAAAGCAAAAACAAAAACA
CGAGCAAGCGCACACAAAATCATAATTAAAATTTTCAATAAAATCTCCGTAAGTAGGGCG
AAAAGCAAACAGAACCGCTTTGCTGCCTGCTAATTATAAATTATAATTTTCCAGATCCTT
TGTTGCCAAAATTAATCTTAATGAAATTATTCAAACAAAACTTTTCTGCAATCGCTGGGG
CGGCTTTTTCCCGCCCGCCGGCAATTAATTTCGTCCGACATCCATTGACAAAGTGAAAGC
ACGTTTCGATAATGAAAGCCGCCAACGGCCACGCCCCTTCACGCCCCCACTAATTGGGCC
AACAACTTGATTCCAGCTGAGCAAATTTCCACACTCGACACTGGCCCTCGAAAGTAGCCT
ACACCACATAAAAGTGGCGAAACGAAAGGACGAAAGGACTCAGCCTCAGCCCCTTTGAGC
TCCCCCAAAAAGTATGCTATGTAATTGTTGGGGCATCGAGCAATTGCCTCAGATGTGAAG
AAACTGTTCTGCTCGAAGGCTCCTCCACTGCAGTTTCATAAATTTGAAATTCAAATTTGG
TACTCACATGCCGCAGATTCGACTCCCAGATACCTTAAATTAAATTCTGGGAGCGCCTTT
AATCTTGGGGGAGCTAACTTGGCACAAATCAACATATATGTATGTACGTGCTGACAGGCT
GACAGGTGAAATGCTATTTGCAGCCTGTTGCTGAAACCAAATGGGGGAAAAGTGGGGGAC
TAGAGTTTTTAATTATGCCCAACAGAGATTAATTTTTTGGCCTGGCATTAGTTTCTATTA
TGCAGTTTTTAGAGGCACCTACCTACTTTATATTTTGTTAGATTATACCCAGCTTGGATT
TTAAGGAAGGTTCCTGGAACAAAGCAAAGTTTTGGCTCGTTGGTGAAAGTTGGAAGTTCT
ATGGGCATGCAAATTGATTTGTGTGTTGTGTGTTCTGCTACAACTTCCACCCACTTTCAC
CTCGTGCGTGGGCGCATTCATACGTATCCAGTTGATAAAGGTCTTGTTTGGCTGGCACTT
TGAGTTTACATTTCAAGCTCGCAGGCAATACAAAACTATTAACAAGACATAGTCGGGGAT
AAATTAATTAAAATGTCAACCTGGATTTATTTCGTGCGTGCAGAACTTGACAAAAGTTGT
AGCTTCCTGGGCGTTTTGTGGAAACATTTCCAAGGAGCAGCCTGGCAGAAAGTCACAAAA
AGCCAACAGGAGTGGAGGGGAGGGTCTATGAATTTTTTATGAGCACAGAGCGTGCATAAA
AATTAAAATTATTTGTGTGATTCCTATGCGAGTGCACACTCCACCCACTCAGCCGCAGAG
TAAACAATTGCCCGCCCTTATTTACCTTTCAACATTTCTATTTGCACAGGTGACGCGCTG
GCAGGCGGGAAATTCCCCGCCCAATCAGGAGTAGGAGTCCGCACACTGCAGCTAATTAAA
GTTTAACAACGGTCAGGTCGGAGCCCATTAATTGCAACTGACACCTAGCACAGTGGCTGC
CAATTGTACGCGGACACAGCGCGGCTGGTGTTTGCGTTGCATTTATTTTCTTACTTTTCA
TTTTGTTTTCAATTAAGTTCGATGCAAATAGAGCATATGGCTAACGGGAAGCCTCCGCTG
CCATATATCCTGCATAAATACGCAATATGTGGCCTGTGTGTGTGTGGGTGTGTGTGTCTA
GTGGCATTGTGCAAACGTGGATAGTTGGCGAGCGTGACGAACTGGTCAACAAATCGCAAA
TAAATTAATTGGGAATTGCAATTTCAATTCAATCCAATTCCGAAGCAGCGGAAGCTCAAT
TGAAAACCAGAAGTGTTCCGGCGATGGCGATTATCAGTGAACATAAACCACATATGGAAA
AACAATGAAAACCCAAAGCGAAGTGTGCCAACCAATCTCATATTCAAATATGAATGTTAT
CGAGTTGCAATGAGTGTAAGCCAAATCGAATTCATTGGGATTATGCAGCTCGTAATCTGA
AAACACAACTACTTGAAAATTCAATGAAATATTTATCCCTAATCTGTGTAAAGGGTCTAT
GTTGTTAGTGCTTAAGTATGTAAGAATTTTAGTGTGATGCTTTTCGTTCGTTCATTGATT
TCAAATCAAAGAGAAACATTGAAAATATATATTTGTGTTGGAAAAGAAGACGCGTGTCTG
CGAATTGTTTGCATGCCACGGGTTGGTGTTTGGATAGGGGCTAGAGGGCCAGGGTCGAGG
GTCGAGGGTCGAGGGTCGAGGGTCGTTCCTTGGCCGCAATTCGAGGATGCACAAACGCAA
CAACCATGAGATTAGCTTCAATTAGCCGTTAACAAGTGACTGGCGGACAGAATCCCGAGG
AGATAACAGCCGGCACAAACATAAATGCAATCTGGCCGAGATAACTGGGGCTGCTCACTC
CGGGAGTTGGCCATTTGGAGAGCGGCTGCCAGTGGGCCCAGTTCGCTCATTAGTCTGGAA
GGGATCCCCTGCGGCCGGAGACAAAGGTGGTAAAAAGTCCATCAACTGCTTAAAATGTAA
TCAGAGTTCGGCCCACTCGCCATATCTTACATATCTTATCGCTTTGACATGTGCCCGGGG
CCTTAGAGTGAATCGCGGATTCCGTTTTTGGCCAAAAAAACTCATTCTGTGGGTCATCTT
GCGGGTCATTTAACCGAAATGGATAATCTGGGCGTCGTGCTCCTGGTCCTGTGCGCCTTC
AGCTTCCTGCTCTTTCTCCTGCGAGTGAGTATTCTCCTCAGAGCCGTCTGTTTATCCCGC
ACTGCCCAGTGTCGTCTTCCAGGTGCTTCTGATTGCCTGTCGCTCGTACTCGATGTCGTT
GCGCCCGAAGCAGGAACAAGGTGAGTTCTTCAGGCATTTGAGGAGGGCAAACATAAATAT
TTGTCGTGGTTGGGCCACTGAACTCGTTCTCGAGATGAGGGAGAGCAAGAGTTCCCGGCC
GCCATAAATCAAGGGCGACATTAATATACATATATATATATATATATACGTATGCGTGCG
TTCGAACATATATCTATTTGCGCACATTTATCATATCGCCTCATTAGATAAATTGCGAAT
GCGAACAAAAAACAAAGCCCTGGCTCGACACTGGTTTTGTCGCCTTATCAGCTAATGATT
ACAAAGCAAATATGTGCGTTCTTCGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1162, 2110..2305, 14269..14589, 15046..15128, 15230..15915, 17937..18240, 18521..18886, 23389..24167
14586..14589, 15046..15128, 15230..15915, 17937..18240, 18521..18877
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved