Drosophila_melanogaster Locus nord
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster nord
Drosophila_melanogaster
nord
2R
snoRNA:Me18S-A1597
9007..9122
13831
TCAAAGCGTTTCCAAAGCATCGCCTCGTCGCATGTTGCATCCACAGCAGCAACCCCAAG
CAATCCCCAGCCAAAGCTGCACTCCACTGCACTCCGACGCCTCCGTGCCGCTGCCACTGC
CACTGCCACTCGGATCTAATGTTTATCTTCCGTGTTTCGGCCAGCTCCGATTTCTTGCGG
GGCACTTTGCATGCGGCTGGCTGGCGGGGATCCCCCCCCCCCTTCCGAGACGCGGCCGAG
TGGCGCTCAGGCTTTCCATCGAAAGTCACGTGCGGCACATAAAAATCAACGCACATCAGT
CTGCTCCGCCGATTCTGGGCTCTTGTTCTTGTTCTGGTTTTCATTGAAAACGAAATCCGA
AAATCAAAATGTTGGCGCGACATAAAACAACACAAGCCATCAATGGGGCAGGCCGAAAGC
GAGGGCATTAATTAGGGGAGAGCCAAAGTGTATGTATTGTTTTTCTTATGCTTATTCTTA
TTCGTATTCTTTTTCCCATACCCGTTAATCGCTGGGTAAAAGGGGTATGCCCCGTTTGGG
GTGGAGTTCGTAACATCGGGTGAAATTTTTGAAAACAATAAACTAATAAGAATCAGTTAA
GTAGCCATAATTATGCAGCATAGATCCTACTTTCAATCGTGTGAAATTAAAGTTAATCAA
CATTCATGACGCACACCTTACTTTGTGAACAGCGCTTGTAAGTATGCAGCATCTTTGGCG
CCAAGACCGCGTAACGGGTATCCAGAAGTCGGTGCCCAAGTGTACCGTTCCGTCTTGCCG
TTTTTCGGCCTTTGTAAGCGTGTGTGTGTGCGTGGGGGCGACTTCGGGCCGTCTTCGGGA
CTTCGTTGGGGCCTTCTTCGTTCCTTGGGAGCTGCCGCTGCCTCTGCCGCTGCTGGCGTC
ACCGCCGCCTCAGTCGCTGCCTCGGTCGGCGCTGGCGTCGCAGTCGCTTCCTGCTCTCGA
CGCTCGGGCTTTTTGGCTTTCTTTGCGCACGACTCTCGGGCATTTTGCGTTTGCACGTCA
AGGCAAGCGGACGACGAGGACGAGCGGCGAGATACTGCGGAAACAAGTGGCAGCAAGTGG
CAAGAGCTGAACTTCCGCACCCGGGAAACGGTCGCGTGTGCTCCGAGTGGAAATACGGAA
ATACGGAAAATTCGGAAAATTTGAACGCGTGTTCGCCGAGTCGGGGGAAGCGCCGGCAAG
TGCCCGCTGAAGAATCGCAACTATGCGTGCGACCACAAATCAAAATACGAATTTATGAAA
AGTGCTCGCTCGCCAGGCAAAAGTAAGAGTGCTCGTGCGTGGGCCATCGGCTAATTGCTC
GTGACTCGGCAGCCACAGGTGGTGCTCCTGCCCCGCCACGCCCCCAGCCAAGCCGCCCAC
CGGCCAATTGTTGCGGCACACGCAGATTCGCAGAAGCGTAATTAAAGAGGGACCCCGGGC
GAAAGGTCAGCGGCAGCCGCAATTAGCAAATCTAACAGTTCCGAGAATCGACTCGCTGCA
GCCCCATTAATTGGGACCCGAATCTCCAAAGAGCAGAACCGACGCACAGCGAAACTCCCC
GTCCCCCAAAAAAAAAAAGTCGCAAGGAAATTCATTTTTATTCTCTGGCCGAAGGAGAAA
AGTGGGTGGCTGCTGGGGGATTCTTGGGGGATTTTTGGGGGACAGCAGGCGACGTGTGTC
AAAGGTTTGACAGGCCTTAATTGAGCGGAGGACAGAGAATCAGGAGACGAGTCGGGCGGG
GGTGGATGCGACTGGGGGGTTGGGGGCGACTCCGGGCGAGGGCCTCGCATCTCGGGATTT
TCGGATTTACGGACTTACGGATTAGAAGCGAAACGCAATTTATTTCCCTTCGGGGGAGAC
GGAGAATTAAAAGTCGAGCAGAAACACAATATTTTGTATCTCAGCGCATTTGCGATGCTT
TCATTGAAAGGAAAATTGCGAGGGAAAATCAAACTACAGACTTTAAACTTTTCAACGTAA
TTAGGAGTGGTAGAGATGTTGGGAGTATTATTCGTATAGTTCTACAAAGCAAGTGGATTA
ACATTAGCAAAGTTTAAAACTGCGAAACTTACTAAGAATAAGGAATGTTTGCTTTTTTAA
ACAGGAACTCGAGTTGATAAATTATCAAGCAGAAAAAGCAGAATTGCGTGAAAAGTTTTC
GATTCAATTTAATCATATTAAGTCAACTATTCTGTACATTTTGGCCACCAATTAAAATTT
GCCTCTAGTTCAATTAATAAAAATGCGACAACAAGAAATTAATCCAATTTGCCGACCATT
GAAAACATAGTTATAGAGTGTTCCAATCAAAAAGCAATTAATTTAACAAAATTTGCAAAT
CAATTTAGCCGCAGAACACGCACTCAGAGGTTGTTTCACCTAGTCAAAACCCAAACTTCA
ATAAAAGAACCAAACAAGTGAAAAATAAATATACAAAGTGAACTAATGCAAAGGAGCACC
ATGTTGCCAGGAGTGGAGCTGCTGCTGCTGTTCCTGCTGAGCACGTCGCTGCACGCGGAG
ATCTCCCACTTGCCGATGGCCAGCAACCGCATCATTCTGGACTCCACGGAGCTGCTCCAG
AACCCGCTGATCCAGGACGCCGGTGTGCCAGCGGCCAGGGCGACGCCACTTCCACCGCAA
AAGTGTCCTTCGCTGCAGCGGTACCGCAAGATGCTAAAGGACTTCGACGACCTGGAGGAC
CTCTACGTGGACGTGCCCGTGCATATAGCTCTGGCGGAGCGGCAGAGGAAGCGGTGAGTG
CGGTATTTGGCTTGTGCTTTCTGGGTTTCCGATGATGGGTAGCAATACGGCTAAGTGCGC
TGGCGACGCCGCCTGCCACACAAATCAAATTACGGCCAAACAAATGCGAAAGATGGCCAG
AGGAGCCAAACTCAGGGGCGCCTCTCCAAGACGAAGCAAAGCCAGCAAAGGCTGGAGCAG
GAGCAAAAAATAATTTATAACCACGACGTGTGGCTGGCCAAACAAAAAACATCCACAGCC
AGATTTTCTACGCTCCTGCTTAAGTGTGTGTGCATGTGTGTGTGTTCTCCTCTTATTTGT
CTAGTGTGCGAGTTTTGTTGTCCTTCCAGCTGCCGCCACAAATCGCACTGTGGGGTCAGG
CGGGGATTCTAGTGAAACCTCTTGATTAAGTGTGCCACTTTAATCAATGATGGGATCCTA
TCATCTATAACTCCATCTTAATAATATTATTTAAGCGAGAGGCTACTTCTAAGAACATCC
GGATTTCCAGTAAAAGTTCCCTTAGTTCGTTAAATTGCTTTCAAAAATTTATAAATTCGA
TTATCCGGTGTTTCTGTGGCACTCCATGTATAGATTTTCGCCAGCCACTTTAAAGTTTCT
GCCAACACACCAAAGTTCGCACACTTCCCTCTGCCCCACTGTTCGCACTGCGTTACACGT
GGCGTATGAGTAACGTTCTTTTTTGCGATTTTCATTGGTTTCCGATGGGCCGCAGCTTGG
GCCTGGGTCAAAAGAGGCCCGTCACGTTTTCGCTTAGGCTCTGGCTGGACTCCGGGATTT
CAGTTTTCATCTTCTCCAGTGAACGTGCACCCAGTGCGCTTGGCTTTTTCCCGTTTTTGC
GAAGCGGGGAAACTGGAAGCCCTCGGCTCGTATAACACTCGATCATTTGCCACAGAATGC
CAGCAAACATTCAAATTAATGTCGTGGCTTGTCGTCAACTTCTTTTCGGTTCGCTTCTAG
AGTTTTTTTCTCCGCATTTCCCCCCTCATGTATGGAGTGTGTACTGGGCATCGGTGTCGC
GCGACCCGGCGAGAGTGCTCCAATTGCCCAAGTGCAGCTCGAGTGACCAGGCAGCGGGAA
TCTGGAGATTCGAGATCGGAGATGCGGCACTCGAGATCCGAGATCCGAGAGCCCAGATCC
ATCGCTAGAATCAGAGTACGTGACGTTCGGCTCGAGTTGCCCGGTTTGCTGAGCGTGTGA
AAGGAACTAGTTGGCACTGTTGCTAAAGAGTCGAAGCTTTGGCAAGAATCGCGTTTATGG
CGCGTGCAACCATTAAGCGTTTTGCTAGAATCAGCAGGCCATGCCTATACCCATTTCCAT
ACCCATACCCATACCAATTCCCATTCCCACTTCCATTCCCGATTCCCATTCCCAGTGGCC
CCGTGCGTATCCTTCCACGCCATGCCGCCAATCAAGGGGAGGACGCATTATACTTTTGCG
CAAACAAATCATAAATATTAATTTTACGACTTAATTCGACGGCGCAATATGCGCTCCCGT
TCGCATTGCGTTCTCATTCCCATTCTCAATACCCAGTACCCAGTTCCCAGTTCCCGATTC
GCATTCGCAAGTCGATCATTCAGGACGCGGATGCCACTGGCGGCCACCTGTGGCATTCGC
TAGTTGGGGCAGCCAGTCAGTGGCCTGAAATCAAAACAAACCCCAAAACTGCCGGAAAGG
TGATTGTGTGGTTACCTGCGGAGAAGTTGCCTCGACAGGCGGATACCTCTTAGAACTATG
TGTCGTAAAATAGGATTAAGATTTTATGTGCTTACCTCTTTAGTTTAACATAGTTAATAA
TGTTGATTATTTTTTGCCGTTTTTTTAATTGAGGGTAGCTTTGATTAAAAGTACTAAAGA
ACTCTCACCTTTACAATTTCCCTATTATTCATAATGAAATGCTTTTAATTCACTGATCAA
ACTTTTCACCCCGTTACGAACCCGATCCACTAACTTATCCCCCCTTTCGGCCAATTTGTG
CAGGGAATGGTGGCAGAATGTTGTTAATATGTTGATGCTGTTGTTTGATTGTTGTTGGCG
TTGCATTTTTATGTGCGCCTCAGGCTCGGGCGTGTAAACAACTTTTATTGCCGGCCGGCA
CTCGGCAAACCCGCCCGCATCTCCAGTTTTATGGCGTGAAACTATTTATTTGTAAGCGCA
TCAAAGGAGCCACAGCCCCAGCAACAAATTGCCATAAAATGCGAAGCATAATTTAGTTTT
GGACTTTTTGTTTTCGGGCCTTAACTCAAAACTACGCAGACCTTGCCGGCCAGCAAAAGC
AAAACAAACTGAGTTTCGCACAATGACCAATGCCCCATCATCATCATCTTAATCATCATC
AACCCCAGCAGCCACATCCACATCCACATCCACATCCACATCACATCCACATCACTTCAC
TTCACATCGTCGTCATCGTTCTGCGCCGCCAGAAAAGATCTCCGGCGAGTGTAGTGGGTA
TAGTATTTTTAGCACTTGTCAGAGTACGAAAATACTCGGCCAGACGCAGTCCGTCTGAGG
TTGGGTCTGCGGAATGGGAATGGGAATCCGAGTAGAAATCGGAATCGGAATGGGAATCAG
CATCAGCATCAGCATCAACATCAGAATCAAAATCAGAATCCGCAGAGAGACAACCAAGTC
CAAGCCAAAGCGAACCGAACAGACAGAGGGGCGTCGCTTCCAGTCGGACGACTCATCACC
ATAGTTCAATAGTCTAAAATTTCCCCAAAACTAGAGGAAAATGCATGGCAATCGGGGAAG
GGGAAGGGAAAGCCATTTTCGAATTACGGACACTAAGTGCTCACTGTGCCCATTTCGGTG
TGAGTAATTGAGTGCGTCTTTGTTTCGCATTGTTTGCGTCGTGAATCACTCACAGAATCA
GTATCGGAATAATAGAGATATCAAATAATTGTTATGTTCTTGGCCGACAACAGGATCACG
AGTGAAACGGGAGACAAATGGGCTAGTGGGCGAACTTCACTTCCACTTGGCTTTCCCGTG
CCGGCAGATGATTACTCATGCGGCACTCAATGTCGGCCACAAGATCCATTAATGAAACAG
ATGATGAATTGTCTCAACAAGTTGCCATGGGAATTTTCCAAGGCGCCATCTGATTTATGA
CTCCAAATATCTAGTATCTGGCGGATTCCTTTTGAATTCTGAAATCTATATGAATTATAG
ATTATGTAGATCCCATTAAACTGGTCATTCGTTATTGTTTTGAAATCGTACTGCGTACCT
TCTTCAATTTTATTCATTACTTTTTATTGATTTCATTCGAATGGTTTACGCTTCATCAAC
CTAGTTTACTACCTATTCAATGGGAATTGCCAAGAATCAACGAATTTATTTCCCGTAACT
CACATAATTCCGCAAAAGTTGTCCCTGCTCCGTGGCGCTACTTCCAATTCCATTTGGGAT
ATTTTCCAACTGAAACTTGCGCCATCTGATATCCGAGCGATATTTGTTTGGCTGCCCTGC
AGTAACTTCCTTTGCAATCAGCGAATGCGCCACTTATAGGGATATCTGCTTAACTCGTTC
TTTATCTCTGTTTACGCCCAGAGTTTTCCGGCAGCAGAGCAGCTGGGAAAGCTGAGGCTG
ATTGTCAATTTGCGGAAAGCGGGGCGAGGAGCTCGTCCACTGCGCACTGCCCTGCCCGCC
TCCACTTCCATTCCCGATCCCAATCCCAATGCCAATCCCAGAGGCACGGGCACAGACTCC
CCGCCGTTGTTGTTTGCAAAAATAGAATTTTGTCTCTGATTTTAAGTATTTCGCGTGAAA
AGTAACAGAAGCGACCCGAACGGCACGGGCCAGACCAACCACACTATACTATACTACACT
ATGCCATACTATATAGACTATAGACCAGACAAGCGCCCCAGACATCGCAGGAGGATGGAG
GATGGGGGATGAAGGACGGGGGGACGGGCTTGGGGATTGCCAGTCAGAGTCAGAGTCAGT
GTCTCTCAATTGCAAATTTATGTGAATTGAGTCAATTTTATCGCAGCCATCTAGGGAGTT
AGTTTGGGTTAGTTTACTTTTGACTTGTTTGTCCCTGGAAAACTTTGCGTCGTTTGACTG
GCGTAAATCGAACGACTGGAGCCACTTGAACTTGTCGCTGCCAGCGGTTATCCTTTTCTG
GCTTCCTCCTCCTCCTCCTCCTCCTCCTCTTGTCACTCCTCCTGTCCTGCTGCTCGCTCG
TGCTGACCAGCTGGGTTCGCCATCTGTGGATTATTAGCTCGCCAATGAACGTGAGGGCGG
CCCAGCAGCTGCCCACCACCAGGATGAAGAAGGGTCCCTTCAGGTGCTCCGTGGTCAGGA
CGATAGCCGTTTCCGGGAACTGGGGGCGCATCTTGTTGATCCTGTTGAGGTACGTGTTGT
TGTACCTAAAGTCCGCGTCGATCTTCTGAAAAATGCCCACGTCGCGCATGAGGCGGATGA
TGCTGTTCATCTCGAAGAGAAAGGGGAATCCCGCCTTCATGATCATCTGCACCGGACTGC
TGAAAACGTTGTTGGGAAAGGCGTATATGACGTCCGCCAGGGGACTCTGCATCGTGTACA
TCCGGTTGCTCAGGATGCACCGCTGGCCCCACTTCACCGCCTCCAGGTTCTTCGATTGCG
GAATGAACTCCGGCGAAATGTTGTATCCGTTAAAGATCCACATGTCGTCGTCATTCTCGA
ACCAGTCGCGACTCTCCTCGTGGCCGCCAAACGGAATACCCGCGGCCACCACTTCCGTCA
GCTCGTCCAGCTGGTGAAGGTAGCCGGGATCCTGGAAGGTGGCTATCATCTTGGACGTGT
ATGTAGCCACCACGTTCAGGCCATACAAAGTCAGGGCCATGAAGAACAGCCTCGTCGTCT
CGCAAATGGGTCGTTCCTGGACGGCTATCGATATGGTGACGGCCAGGGCATTAATGGCCG
TAAGACTCAACTGTTGGTAATACTTCGGCTCCGGAAGAATCATAACCAGGGTGAACCAGA
ACAGCCAGCTGATTATTAGAATCAGGATGAATCCAATCCAGGTGTAGGCTTCGAAAATAC
CCACCAACGCCTGCCAGGCGGGTCTTCTGTCGGCCATTTTTATGTACCACGTGTGCGCAT
CCTGCAGATAGGTATCGGATCCCCAAAAATGGTCCGCCACCTCGTTGTCCGGATAATAGC
CGCCGAAGACAAAGTCGCACTCGTTGTTCTGGACTTTCCCCAGTAATCCAGTCCAGTTAG
CTGGGCCATCCATTTCACCACGTGACTCCAGGCTGCAGGTTTGGTTTACCTTACCAGTGG
AAAATAGGATAGTTGTTAGCTTAGCACAATAAGCAGGACTTTTGCAAGCCAAGACGATCT
TGAAGTATGAAAGTGTTAAATACTCACATCGAATTTCAGTCGATTTTTCATGAACCCCAG
GATCCTCATCTCTAGTCCCAGGATACAGTCGGCCTCCACAAAGGGAGCAGAGATGGAGGA
ACAGGCAAAAAAGGTGCAGTTCCTGGGACTGAATCCTGATACGTAGTCCTGCATGGAGGC
CTTAACGACAGCATTATTGGGGTAAAGTTTGCCATCGTGGCACTGGCCCACGCTCTGGAC
ATTCAGAATCCTGCAGTTTACATTGCTGTAGTAATCATTGACCAGCAGATTGTAGTTCAT
GGTGGAGTTGGCATAGAGAAGAGCAACTCGGTGCACGTAAAACATTTCCATGAGGTCCTT
GAAAATATTGGAGGCTACGCCAAGCGGTCGATTCCGACAAGTCGCATTATGAAAGAGCAC
CAGAAAACGCGCTCCTGGATTCCAGGATCGCATTTCGACAATTTTTTTCTTCATTAGCTC
TTTTAATCGATCCACCGAGTCCACCACTATCACATAATTGTCCGCTAGGATCAGCTCTCC
CTTGTCTTCGGTCCCATTCGTGATGTTGTAATCACTGGCCACGCGCATTTGGAAGAGTTC
CTCCCTGTCCGGCGGCCCTGGATTCGTGACTGCTTCGTTGATCAGTTTGCTGAATCCTTC
CTGGATCTGATCCGCCGGACTGGACAGATGAAAGGCGTGCACCAGCATCAAGTTATAGGC
TCTGGTGAAGCGCTCCTTCGGGTTGCGAAAGAAGAAGATTTGGGCGAAGCTATCGAGGCA
GCCCACTCCAGCCTTCCACACATCGGGACCCAAGTCCTTTTCGGGCAGCATGAAGATGAC
CGTGTTGGCCGTCTCATTCGAAAGATTCACTATCCCCTGGCACAGGTTTAAAATCTGCCC
CAGAAAGATGATGATGATGAGACCCGGATTATTACACCACATTATTGCTTCTGTCACGTC
GGACAATTGCGAATTAACTGCGGCTGGTGTGAGTTTCCGTGGGAAGGTGATGTGACTGAT
GTCCTACATTTGATTGCTTGGGTATATCGGTTTGGGGTCTGGAACAGTATTAACACTACA
CAGTGCCTCTGACTGATCCATCGCAAATCGCTGTAATATGATAATCCGTCCATTAAACAA
CCACTGCTGGCTTGTAAAAGTGCATTAAGTCATTCTGGAGTTTCGCGTCCGGAAGCGCAT
TCAACTTTCGCCTTTGGCCGTTGTTTGCCTTGTATAATTGACTGCTGTCAGCGTGCCGAC
AACGAGGATGCCCCCAGCAACAATAATAACAACAGCAGAAAACAACAAACAATCGCCATT
GCAACATGCAAGGCTTAAATTAAAGCAAATATTTGCTCAGTCGCAGCGGCGCCACCGCCA
ACAATGGTCGAAATGCATTAAAACACTCCATCAATCCGAACCTTTTGGCAGGGCGGCCAA
AAATACGACGGACTGCATGGTATAATGGCTATATGGCTATGTGGCGCACCAACTTCTGTT
CGCTCGTCCGGATTGCGGGGGATGATGACGAGGAGGATGGCCCATGGCGTTGGCCGGAAG
TAGCCGGTCATAAAAATAAAACTCGAGATGGCCGACCATCTCGCCAAGTCAATGAGTCAT
TTGCTGCAATGGAATGGCCATCCTGTCCTGCCCCTTTGGAAACTGCATCCTTGCCAGCTC
GAAGCTCCCTGTTTCCCTGTGTCCATGTGGGTGTATCGGCGAGCTCATTTGTCTTAGCAG
TTTGTCATTAGAAAAATTGCTCGTAAATTTCGCATTTAATTACAATACAAGAGCCAGCAA
ATTCAGCAAAGGGCCAGTGCCCAGGGGACTTGAGCGCAATCTTTGGCTGCAACAAAGTTG
CAGCGGCATCAGCGAAGATGGATAAACAAAGTTGGCGAAAGGACAAGGATAGCCGAAGAG
GGTATACCCTTTCGGATGCCCCGTAATTAAGCCAACTTGTATACCAAAGGTGATTTAAAA
GTATGCAGTGAGAGATACAAAATGAGATTCTTTTTGACACCATTGTTATTTCATTAGTTA
GTTAGTTAGTTATTGTTAAGTTAAGTTATAAGTTATAAGTTACGACTTATCTAACCAAGC
TGATCCTTTAGTCAGGGAGGGTATGGCCAAAAGCCGCTGACTCATTTGGTTCAGTTCGGC
TCAGACAGGCGGCAAAACAAATTGCGTGTGATAATTTAGTGTCATCATTTTTGACAAAGG
GCGTTAACAGCTCACTTACTCCGCCCCTCGAAGAGCCGCCTTCATCTCGTTCTCCGTCTT
CCAGATTTGTGCTGAACCTGAACGACTCGACGCCGCTGACGATTCGCTTTTCGGCGCCCG
TGGGCCGCAAGATGTACTACAATCAGACAGGTAAGTCCGCCCCTTTGAGGAGCCGCATAC
CGCCACCAACCGCCACTAACCCGCCACCCAACCGCCTCTGCAGGAAACCCCCTTCGGCCG
GCGGCAGTGGCACCTGGGCCAGGTGTGGCTGTGGGCAGTCTGGTGCTGCCCTGCGCCCTG
CGTGGCCAGTACGACCTCTTCGTCCTCGCCCGCCACTCGGGAGCCCTCAAGGTGGACGCC
CTGGCAGAGCATCCCCAGCACGACTGGCCCCTCCTCAACGCCACGCACCGAATCGCCATT
CGCACCCAGAATCGCGTGCGGAAGCGCGAGATGATCGTCAAGTGGGAAAGGAGGTGAGAT
CTAGATGATTTTATTACACGGATATACTTATAACTTATGATTATTCAAAATCGTTTCAGC
AAGTTTGATTTCCATGTCATGCACTATTGCCTGGTGATTCAGAGACTCTCCATGGACACG
CCGCGGATGATCTTCACCAACTTCTGCCAGGCGGTGTCCGCCTACACGGACCAGCAGCCC
ATGACTCCCAGTTGCGCCGCAGGCGGTCCCTTGGAAGGGATTTGGGGTGCTCCACCCCAG
CGGGAAAGGAGACTTAATCCTAGGCAGAACGTTCACATCGTGTGCACGGGGAAGAGGCGC
CAACAGCTGCTGCGACGCCTTCTTCCGAGGAGCAGTTACCATCTGGACCTGTTCGGAATC
CACCAGGGTAGACAGAACCTCACCCTGCGACTGGCCAGCAGCCAGGTGAACTTTAACCGC
ACCCAACCTCTGGCCCTGAAGCAGCAGGCTCTGATGCAACTCAAGATCGGTGGACAGCAC
GGGAAGCAGGTGTACAGCTTCAAGGTTCCGCAGACGACTCGCCAGCTGGGGGAGCCGTTC
ATGAGGCACCTTTTGATCCCTTGCTCGGGCAGCGAAATCCGGGTGAAGCTGCTACGGCAA
CGCAGCGAGGTGGGGAAAACGGAGGCCTTCTATAGTCCAACGTACATTCGGCAGAAGGGA
GTCCTACCAGGGGAGCGCTATCTCATGCGGTTCGAGCCCAGCAACGATGACGAGGCGTTG
CGAGCTCAGAAGGTCATGGTAGGGAGATAATCAGTCCGCGGACTATGTGGCTTGGCCCAA
AGTAATGTATACCCCTATTTAACAGGTGGCCCTGAGCAGCGAGGCTCTGTTCCGGGATTT
GCCCGAGCTGCCGCAGAACACGACAGTCTTCAATGTGCGAACGCGGTGCAGCAGAGCCAC
CATTGCATGGAATGGCTCACCGGATGAACGGGAGCTGAGGTAAAGCGCCAATGCAGAGTT
ATGTGTGTGCGCCTTCTTTTAAACTAAATTTACTTGCAGCTACTGCATCATAGTGTTCAA
CCTGCCGCAGCGCAATCGCAGCGTGGTGGACTTTACCAACTACTGCATGGACTTTGTGCC
CAAGCGGGTGATGCAGTACAGATACTTCGAGTGGATGACCTGCAGGGAGAGGCAGCAGAG
GTGGGTCTTAGCAGAGCCTATATGTAACGATATGATAATATGATGCACTACTCCCCACAG
TCCCGACAACATCGAGACGGAGACCATACTGAACCTGATGCCGGGTTCCAGCTACCTGGT
CTACGTAACGGCCAACCTGAGCATGGGCAAGCCGCTGCCCTACCAGGCGCTGACCCTCCA
CATGGCCAGTCAGTGCCTGGACGGATCGCACGAGTCCTTCTACTAAGCGCTACCAGTGGT
GGTCGTAATCCCCCAATCCAAACCCATACCCAAAGCTTCGCTGCATTTTCGAATACAAAC
ACTGAACTATCCGTCGTTGTAAAGCTACCTTATCCACTACGATTACTACACTATCCTACA
AAAAACTATGCTGGTTAAAAGACTATACACCTAGCTCCATATACTATATATATATATACA
ATATCGAGGCATGTGTTGTGTGGGCGAGTGAGTGTGTGCGTGTGACTTCTGATTGAGTTG
CCATTTGATTCCAAGTATTTTCGAGTGCTTAGTTTTGTAATTTGTAGCTAGCCGTTAATG
TTTGTATAAACTGTTTCATTGGTTTCCCACTCCGCTTTATTCGATAAGCTCGTTTTCTAG
ATTTTAGCTTTAGCACTCTTAGTTTAATGTTTAAAGTTAGTTTCGCTGTTAAGTTTACAC
CGTAGTCGAGGCGTCTTGAGTAGTTCTTTTGTACATTAAGCTTACACTTAGCTCTACATT
AGATATACCATGTCGAACCTACGAGTCTACGAACATACGAACATATATATGTGCGTTGAA
AGCGTTGTATTTTTTGAAGCCGAACTTATGCAACCGAAAGGAGACAATAAACAAATGTGC
TATAAAGGACGAAAGTGTCGCAAATAAATGTGAGCCACTGCTAAAGAAGACCGATTTGCG
CAAGGTGTTTTACTCGGCGGCGGCGGCAAGAAGCGTTTGGGGCACAAACGACGGATGAGT
GATTGCCACTCGTACCATCATCATGACGATGGCGTGTGGAACGACGTGCGCATAGTAATG
ACAGCGGATGGCAATCTGAACGATAAGCGGCACCCGATAATGAAACATTAAACTAAACCG
TCGGTAGTCGCTGGCCATAAATCTGTCGGCAGTCTGCTCGCAGAAGCTTTTAGGTGCGGA
CCCCTTGCGCGGCATACTTTCGGGCTTCCGTTCCGTTCCGTTCGCCAATGGCCCTGCTCC
ACTACACCTTCGACCAGCTCGAGTTGTACCTAGAATGGGCGTTCGCCCAGCACGGAGAGG
CCACGCCGATTCCCTCGATCCAGCCGTATCCGGGCGTGTTCGTGGGCGATCTCAGCCAGC
TGAACCGCTTCAAGCGACATGCCTTCTCCGCCGTCGTGGGCACGCTCTTCGTCCTCGCCT
TCTGCGGCAACCTGAGCACCCTCTATGTGAACAGCCGCCGGAAGCTGCGGCCCTTCTTCC
GGGCCTGCCTCATCTCACTGGCCTGCAGTGACCTTGTCTCCAGCATATTCTGCACCGTAT
CCTACATGGCCCAGTTCCAGGCGCAGTATCTGCAGCTCTGGGTGAGGCGGCAGGGATTGA
GCAGACTCAACACAAGCTAATTACAAATCTCCTTAGACAATTGGTGGCTTCATGTGCAAG
TTTGTGCCGTTCATAACCACCACGTCGGTGTTGTCCGGCAGCCTGACCCTGGTGGCCATC
GCCTTGGACCGCTACTTGGCCGTGATGCGACCCGTGCTGGGGTTCTGGAGTCCCGACAAA
CGCTTCAGCACTCTGAGCATGCTGCTCATCTGGGCATGTTCGATAGGATCCTCTGGCCCG
CTGCTGGGCATCTACGACTACCGAAAGATCTATCTCCTGGATGTGGAGGACTCCAGCGAG
GAGAGCGAGGAGGTCGTGACCGCTGTGCCCGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1281, 2348..2752, 10384..10469, 10543..10792, 10859..11537, 11605..11738, 11799..11939, 12000..12831
2445..2752, 10384..10469, 10543..10792, 10859..11537, 11605..11738, 11799..11939, 12000..12162
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved