Drosophila_melanogaster Locus Nop60B
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Nop60B
Drosophila_melanogaster
Nop60B
2R
snoRNA:Me28S-G1083a, snoRNA:Me28S-G1083b, snoRNA:Me28S-G1083c
11116..11199, 11363..11445, 11599..11681
12796
TTCGTCGGCCTAACCATTTTATAAGAAAACCGAGAAACATATGTACGTCATATTAATGC
ACTTTACTATTAAACAAAGGGGAAACTTAACAGATAAACGACCGGCAGAGCTCTAAACGG
CGAACGGCTGATCCTTGCCATCCTCGTGGTACTTGATGTATGTTTCCCCGTGGGTGAAGT
CCTTGGTTCCCTCCAGGCGACCGCGGGGCGGTGCCTTCTCGTAGTCGAAGGCCTTCTCTG
ACTTGCCGAACAGCTGGTTGGCCATCTCGATGTCCTCGCGGTAATTGCCCACGACCACCT
TCTTGCCAGTGAGCGGGTCCGTTATGTCACCCAGCGGATAGACCACTTTTTCCACGTTGT
GCGTGATGAGGCGGGTGAGGCGCTCTGGCAGTTCCCGTATCAGGACCACGTCCCCGGTCT
TGCACACCTTCTGCGGATCGTGGGCGAAGTAGAACTCGTCCTTCTTAAAGTACTGCGAGC
AGAAGGGAAATTGTGTGAAATCTCCTGAGGCGAGATCTAATGTATATTATGCACACCATA
TTCAGGTTCTTGTCCAGCTCCATTCGGCGAATGCGGATCTTGGAGGCGTTCTGCTTGATG
CAGGGCATGCACTGGCCCATTAGTAGGAGTCCTCGCCTCGACATTACTTTAATTTAATTT
AAGAGTTTAGAAAAATAAACAACCGGTTGGGAAACACAGCTGGTAGATCACTGGCGATAG
TATCGATTGGGCCTGGAACTATCAATATTTCGATATTTTTTACTCAGCAGTTTCTGATTT
TCAAAATCCCGCCAAATGCAATCAGCTTGCACGCGTCAGTTAAAAAGTAGGGTAGTATGA
CTTTTCATCGCAAAAACAAGTGGATTCTAAGGACATAACATTTTCACCGTACTATAAACA
GTGTATCAGTTTTACATAACATATCTTTTCAATTAAATAATGCTTTAATGGATTAAAAAT
GTTTACGTCAAAGTAAATACCTTTAAATTCATTTTGTTTATGAATAATACATATTTTTAA
TTCAAAATTGTAATAAGGAATTCGGCTCACGATGACATATCGCAAGATTTCCATTTATGT
ATCGATGTCTTCATGAAATACATTTCTGTGTAGTCACACTTATCGATAGACCGCGCACTC
CACGTGTTTTTCGTCCATTTTCTCGCAGCGCGCAACACGTGCGGAGGTTTCTCTCCGTCT
ATTAGTTGATTTAGCAGAAAACGTAGATAAAATGGCCGACGTGGGTAAGTCTGGCAAGTG
ATGAATTAAAAGAGTGCCCAAATAAACGGACTATGCGCCCGCAGAAGTACGCAAGGAGAA
GAAAAAGAAGAAGATCAAGGAGGAGCCCTTGGACGGCGATGACATTGGCACGCTGCAGAA
GCAGGGCAACTTCCAAATCAAGCCCTCCTCCAAGATCGCCGAGCTGGACACCTCGCAATG
GCCGCTGCTCCTGAAGAACTTCGACAAGTTGAACATCCGTTCCAACCACTACACTCCGCT
GGCGCACGGATCGTCGCCCCTGAACCGCGACATCAAAGAGTACATGAAGACTGGCTTCAT
CAACCTGGACAAGCCGTCGAACCCCAGCTCCCACGAGGTGGTGGCCTGGATCAAGAAAAT
CCTCAAGGTGGAGAAGACAGGCCACTCCGGCACGCTGGATCCCAAAGTCACGGGTAAGTG
AAGCGCGTGCTCGCCTACCGCCATACAAACCTAACCTCATTGTGTGCCGCGTGTTTTTTT
TTCCTACAGGTTGCCTGATTGTTTGTATTGACAGGGCCACCCGTCTGGTGAAGTCCCAGC
AGAGCGCCGGCAAGGAGTACGTGGCCATCTTCAAGCTGCACGGAGCCGTGGAGTCGGTGG
CCAAGGTGCGTCAGGGCCTGGAGAAGCTGCGTGGTGCCCTCTTCCAGAGACCTCCACTCA
TCTCCGCCGTAAAGCGTCAGTTGCGCGTTCGTACTGTCTACGACAGCAAGCTGTTGGACT
ACGATGAAACCCGAAATATGGGTAAGTCAGAAGTTTTGTTTATCCATTCTCGCTCAGAGT
TGGTGCGTCGCTGCTGGATTAGTTTATCCTGCAGAGGTGCAGCCTGCTTCAGCCAGTGAA
ACACCAGTATTTGCCTAACACAGCAAATGCACAATGTAATTGTTAAAACCTCGTCTTTTT
CTCTCCTCCAATTCTGCCCACTCACGTGCTCAGGTGTTTTTTGGGTTAGTTGCGAGGCCG
GCTCCTACATCCGTACCATGTGCGTCCATCTTGGTCTCGTACTGGGTGTCGGTGGCCAGA
TGCTGGAGCTCCGCCGTGTCCGCTCGGGCATTCAGTCTGAGCGCGATGGTATGGTGACCA
TGCACGATGTTTTGGACGCCATGTGGCTGTACGAAAACCACAAGGACGAGTCTATGCTGC
GACGTGTGATCAAGCCGCTAGAAGGTCTGCTGGTCAACCACAAGCGCATTATTATGAAGG
ACAGTTCGGTAAGTTTGACATCCAGTTGCCGTTTGCGAAGTAGTACCCCATGATATTAAG
CCGGCAGGTGCCTGCAATCCCCACGGGCACCTGTGACTATGATTGGGAACAGCAAAGCTG
CTGATGTGTGTATGTTGGGCAGCGCTCTTATCCTGCGCGCTCGACAAAGAATATTCGGTC
GACATTTCCTCTAGCAAAGGACCCCCTTATGATATCAACTAACAACCATCAATCTTTCTC
CAGGTCAACGCCGTTTGCTATGGTGCCAAGATTACATTGCCCGGTGTCCTGCGCTACGAG
GATGGCATTGAAATCGATCAGGAGATCGTCATTTGCACCACCAAGGGTGAGGCCATTTGC
CTGGCCATCGCCCTCATGACCACAGCCACTATGGCCTCTTGTGACCATGGTGTGGTGGCC
AAGATCAAGCGAGTGATCATGGAGCGAGACACATACCCGCGCAAGTGGGGATTGGGACCA
AAGGCGTCGGCCAAGAAGGCGCTCATTGCCGCCGGCAAGCTAGACAAGTTCGGAAGGCCC
AATGAAAACACACCTAAGGAGTGGCTGACCGGTTATGTCGACTACAATGCCAAGAAGCCA
GCAGCTCAAGAAGTCTCCCCCACAAATGGCTCCAGTGAACCCAGCAAAGTATGTTATTGA
AAATGAGTTTAACATGGTATTCACTTGCTAAATAATTGTGTTCCTTTAGCGCAAGTTAAG
CACCTCCAGCGTTGAGGAAACTGCTGCGGCGGCGGTATCCGAGGAGACTCCTTCCAAGGA
CAAAAAGAAGAAGAAAAAGAAGCACAAGGGCGACGAGGAAGCCCCAGAAGCCGCTGAGGA
GGAGGCAGAGCCAGTAGAAAAGGAGAAGAAAAAGAAGAAGAAGAAGGACAAGGATAGGGA
CAGAGACGAAGCTCAGGAATAGGAATCAGAAGTTTCTATAGGATTAGGTTTTAAAGAGAA
TTCTACGCTTTTTTGTAGAGGCACCTACCGATTGCTAGCTGTTAGGTTTAAGGAGTGTTT
TTATGTGTAGAAGTGCATACAAATTACAAATGCATTTAAGTGACATTCGCAATGCAATAA
ATTGAACATTTTATTGTGGAACTCTATTGTAATGATGAACTCCAATTAAGAACACAAGTC
CGTTTTAAGTTGAAGGCAGCCGTCGGGCTGACATATATTTATTCAATTTCTTCTTTTGAT
TTTAGAGTAGGCAGAAATGGTTCTGTCAGCTCAACGTCTACTGAGTCTCTCTGATTTTAC
AGTTTTTTATATATTTGGACTTAGGCTAATCCGCGTAGCTGCGCTGCCGGGTACGCCAGC
AGCGGAGCGGCGTTCTTATGTATATCTTATATATCTAGGCTTATCGGGAGAGCGAGATAT
GTATGTACGTATGTAATATGTATTTGGTCGGCGTGTGAATGCTGACCATGCACTTATACT
TTTTGCCTTCGAGTGGGTGATCATGTTACATCCGCCCTGGCCTAACTGCGTGCATAAACA
TAAACATAAACATAGCAACAAAGTGCTGCCATAAGTTAATATGCTATTTTATTTAATTGT
TCTTAATATTGCATAGGCACATACTACATCTCCCTCCTTTTGAAAAATAACGTAACCTAG
TGAAGTTATTTTGATTATTAAATGCAAATTATTTTATTTTTATTTTTATTTTGTTTGTGT
TTTTGTTTGAACAACAATAGTTGATTTTATAATGCAAAGATAAAAATATACGTAGTGTAT
GGAAAATTTGTATAAATGATTAAGGAAAATATAAGTTTAAATTCAATCATGAATGAAATT
TCTTTAATCTATCTTTATGAACTATTTGTTTTTTGTTTTTATTAGTAAGTAGCGTAATAT
TGTTATTATCTCCTATGCTTTCTATCTTATAGGGCCCCGTATATTTAAAGTCTAATTTAT
GACCTACCTCATTTCTTAGTAAAACTTTATCTCCTACTTCTAATTCTATGTCTTTTACTT
TTAAGTCATAATTTTCTTTATTTTTTTCTTTGTGTGCTTCAAGAAGTTTTCTTGCTCGAG
CATATGCTACCTCTAACCTATATTTACTCTCCTTAGCGTAATCATCTATGTTATATATTG
GTTCTATGCTATGTAGTTTATTAAAATGTTTTGGTAAATTACTTGTTCTACCGAAAACTA
ATTCATATGGACAATAATTATGTACCATAGATTGGGTCGTGTTGAAGCAGTATACGAAAT
ATTGAAGCCATACGTCCCAATCGGTTTTGTCCGTCGATATGTAGGATCGTATATACTCGT
TTAAAGTTCTATGACTTCTTTCTACTACTCCAACTGTCTGGTGGTGATGAGCTGTTGATG
TTATATTTTTTATTTTCAAATATTTACACAGGTCAGTAATTATTGAATTCTTATACTCTG
TTCCCATGTCCGTTATGAACGTCTTCATTGGACCGTACTTTAGAATAAAAGATTCAAATA
TAGCTTTTGCGACTGTTTTTGCGCTTTTATTTGCTATTGGTATGGCAACTAAGTACTTGG
TTAAATCACATATGAGAGTGACTGCGTACTCGTTACCATTTTCTGACTTGGGTAGTGGAC
CAATTGTGTCCACAACAACTCTATCGAAAGCATGTTCTGGTGTTTCAGTTATCGTCATTG
GAGTCTTTGTGTGCTTTGTTGTTTTTGCTTTTTGGCATTTTTGACATTTCCTTACGTACT
CTTTTATGTATTTACTCATATTTTTCCAGTAATAATGTCTTTTGACCTTGGCCAAGGTTT
TTGTAATGCCTGTATGCCCTCCTTGTATTGGATCATCATGTAATGTAGACAATATAGCTT
CTTTTTCTTTTTCATTATTTATTTGGGTCACCGGGTTAAGTAGCGCTACTTTTAAATTCT
TTAATATTTTATTGCCCATATTTTTAAATTTATCTATTGAAACGTGTTCAAAGATTTTTT
TCCACGGTGCCATTTTGATTTGGCTGATATCATATATACCGGCCTGCAATTCAAGCCTTT
GGAGAAATTGATCTAAATCAAGAATTCCATTAGTATAAAGATCACCAACATCATATCTTG
CAATAATTTTCTTTCCATGTTTAAATAAACATATCGAGTCATTCAATTGCAATGTCACTA
CTTTTCGTACCTCGTCATTTGTTATGACTTCGTATACGTTGGGCTCTGAAGCTATTTCTT
TGGTTTGCTTTTGCAAATCCAATTGTTCTTTTCCTGCGCAGGATTTTTGTCTACTTTGAA
ATCTTGTAGTGACTTTTAATATATTTCCAGTTATATCTTTTAGCTCTTTGATGGTTATTC
TTGATAACGCATCTGCTACATGATTGTCCTTGCCCTTTAGATACTCTACTGTAAAATTAT
ATTCCTCTAGTTCAAGCCTTATTCTAGTTAATTTAGAGCTGGGGTTCACCATCGAGAATA
AATATGTCAATGGTCTATGGTCTGTTTTCACAGTGAAATGTTTTCCGTAAATGTATGGTC
TGAAATGTATTATTGCCCAATGAATTGCTGCTAACTCTTGTTCTGTTGTACTCTTATTGC
TTTCACCTTTCGTAAAAGCTCTGGATGCATAAGCAACTGGGAGTTGGTGGCCATTATGGT
TTTGAGTTAAAACTGCGCCACACGCTTGCTTGCTTGCATCTGTTGTTATGCAAAATTCTT
TGCTGAAGTCTGGGTACTGCAAGAGTGTTGGGTTAATTAGCTGAGATTTTAAATATATGA
ATGCTTTTTGACATTCATCTGTCCACTCGAATGGAACATTCTTTTTACATAATCTTGTTA
TGTGCCGCGAATAGTCGGCGAAATTTTTGATAAAACGTCTGTAGTAATTGCAAAATGCTA
CAAAACGTCTAGCGCTGTCCGCATCATGTGGAACTGGGTAGTTCTGAATGACATCATATT
TTTTGTCATCCGGCAAAATTCCTTTGTCTGTGCATTTGTGTCCCAAAAATGTGACTTCAT
GCATGAAAAATGAACATTTTTCAGGATGTAACTTTAGGTTGTATTCCCTGCATTTACCAA
AAACTTCAGTGAGGTTTTTAAGCATATGTTTTTCGGAACAACCTATGACTATTAAGTCAT
CCATATAAAGGAATGCTTGAGACGGTTCTATTCCGGAGAATGCTATAGTCATCATTCTTT
GGAATGAATTAGGCGCTATTTTTAAGCCAAATGGCAATCGCGTGAAACGATATGAGCCAT
TGCTGGTTGAGAAAGATGTTATATCTCTCGAGCCTTCATCCAGTTCGATTTGATGAAAAC
CTGACATTAAATCAAGGCAGGAGAAATATTTTGCTCGACCAAGTTGGTCCAAAATATCAT
CTATTCTCGGTAGTGGAAATTTGTCAGCTAAAAGTTTCTTATTAATTTGGCGATAGTCTA
TTACTAATCTCCATTTCTTTTTATCAGAATTCGGGCTTGACTTTTTGGGTACTAATAGCA
AAGGGCTATTGTACTGTGAAACTGATGGTTCAACTATTTTATCTTTTATTAATTTCTGAA
CTTGGGCTTGTATTTCTTCCACTTGACTATGAGGACTTCTATAATTTTTCGTGTATACTG
GCTCATCATCTTTTAATCTCAACTGTTGTTTATACAAATTATTAACTGTTATAGGTTCTG
ATTCTAATGCAAATATATCTATATATTCGCTGCATATATTTTCTAATTGTGATTTAAACA
ATTCGGGGAAATTTTTCTTTAATTGAGATAAGACAGTTTTATTTCTGTGTTCACTATTTG
CCTGAACTACATTGTAGTTCGAAAGTGGCTCATATTTTAGAGTGTCCATATTGACTAATT
GGTCGGAATCGGTTGTATTTAAAATTCGGACAAATGTATTACTTGATGTTGCGATTGTAT
TTGCAACATAAATACCAGTTTGAATTTCCTGGTTTGGAATTAAAATGTTATCATCTTTTG
ATGATACTATTAATCTTCGGACAACTTGGGATCTTGCTGGTAATAACGTTGTGTTAATAC
CAGAGCTGTATGCTATGGGAATATATATTGGAAATTTCAAATTGTTTGGTCTAATTATAA
ACCAATCTTCTTCTTGGTTTAAATCGATTTGGCAATTATATTTTTTTATGAAATCTATTC
CGATTATTCCATCACACGGTATTGGAAAGTTTTTATCTACTAAATGAAAATCGTGTGGGA
TAACGTATTTACCTGTCTGTATCTCAATAAAAGTCTGTCCTCGAGACTGAATTTTCTGTT
GGCCTATGCCTTGAATGTTTATTTTATTGGTTATTTGAATATTAGAAAATTTGTCAGAGT
TCTCTTTGAGAATAGAGATATCTGCACCTGTATCAAGTAGAAAAACTAGTTTTACGCCTG
TTTTGGCATGAATGAATGTAGAAAATATGTTGAGATTATAATTGATGGTGTATACTCTAC
GATCTTCTTCTACTGAGTACCTAAAGGCTGTTGCGAGTTTCCCTGTTCTTGGATTACTCG
TACATTGGCATTGTTTCTGTTGTAGTTGTTCTGACTGTTGTTACGGCCTCTGTTTCCATT
ATAACGGCCTCTGTTATAGCCATTATAACGGTTATTATTTCCATTATAGCGGTTTTGATA
ACCGTTATTCTGGTAACCGTTATTTTGGTAACCGTTATGGTAGTTGCCTCTAATACTATT
GTTATTAAAGCCTCTACCGCGGTTACTACCTCTATTGGCATTTCCGTATCCTCTATTGGG
TCTGTTACCTCTAAAGTACATCACTTTATTGATGTCACCGGTAACTCTTGTACTCGTTCT
TATGTATGCGCTTATCGCTGCATCCATAGTGGTGCAAGTCCCTGCTTCCAGTACTGTTTT
GATACTTTCGTGCTCAGCACGATGTATCATGGTTTCAATTGCCTCTTTGGTGCTTAGACC
AGTGGCATGTTCTAGAGGTATACCCTCATCGATATAGGAAGCTTCTAAAAGTTTTCTCAG
GCTATCAACTTCAGCGGTAAATCGCGTTGCAGTTTTACCTCTCTGCTGAACTGTTGCTAG
CTTTGCTTTGACATTACTGGATGTCTCACCGACAACTACTTTCTGCAATTTGTTTATAAT
TGCTGGAATTGTCGTTTCATTGTCAACTGAGTTCAAAATTGTGCCAACTATTTTTGACTT
AATGACCTCAACTGCAATGTCTTCAAATGGTCCCTTAGCTAGGTCTACCAATTTGATTGC
CTTAATGAATCTTTGTAAATGGATCTTTTGCCCATCAAATTCTGGCACTGTGCAGGCGAC
TTCCCTAATGTAAGACCTAATGGCAGCTGCTTCTTCTGCCATGGTTAAGTTATTTTCGGA
GTCGGCTGCGTTATTTGTTTTATCGTCGTTCTTCAGCATTAATTTTGCTGGTATAGTTAG
ATCGTGAAGATCTTCCTCTTTAATGTCTTCCTTGACTATAGTCCTATCTTCCTCGTCAGA
GTTAGTGCTGTCTTCATTCAAATTTATTCTTAGTGGGGTGTTTACTATGGTTGGAATTTC
TATCTGGAGACTGAATTTATTTTTTATAAATATTAATTTTTCTCTTAATGTCACCAGTAG
GTTCAAAGCCTTAGCACACTGTTTGCGTTCCAAATTCTTTCTATTTTGTTGGATCAACTC
TCTGATTTCATTATAACTATTTACCAAGACTTGGGCATTCCTATTGATTGTTACAGCTTG
TGTTGATCTGTTTTGCGTTAAGCACTTATAGGATTTTCTGAAATTTTCATTTTGATCTTT
TATCTGATCAACAAGCTTTTCCCAGTCCATGCTGTGGTATACTCATAACTTCAAATTTAT
TCATTTGTATATATTTTTTTTTTTTAATGTAGATAAATTCAATATTACGTTTTATATTTT
TTTTTTATTTATTATTTTTTTTTTTTCATATAATTTTTCTCATATTTTCATTCATAATTG
ACTTTATTAAAGATCTTCCTTAAATATTATCTATACCGTTAGCAGTGCTACGGTATCGTT
TCTTAAGACACTTGTTATGCAGTTTGTATATTTTTATTAATGCATTGGATACCATAATTA
ATGCAATTACAATTAGTATTATGGTTATCCAGAACAAGTCTGCATTTTGGACTTCTACTT
TATTTATTACATTGGCTGTAGAGTCCACAGTTTTAGTGTCTATTAGACCCATTTTGGGTA
TACTAATTTTATATTTTGGAGAATAGAATAGAAAATTTCCTTTGTATATACTTTTATTTT
CAGTTTTACTTATTTCATTTGTCTCTATAGACATTTATGTTTGGAATTATCTATTTATAA
AATCTTTCAATGTTCGCAAGAGTAAAAAAAAATTGTATTTTACATTGTTGCCTGCCTGAT
TCTAGCTATGGCTTCACGGGCCATATTGGGTTAACAGGGCATAATAGTATATGCTCCGTT
TTACAATATTTCTTACAATTTTTCTTATCTATATATATTTTATATTTACTTTATATTTAT
ATATATTTATTATTATATTCTGCTGTTGATGATGCTCATCAGGTGTCAGCTGGGCGTCGC
CGGGGGTGGCACGCTGACACTCCCTCGCTGCTGTCTATTTCTTCGCCGCTGAAGACGTCG
ATGGTCGCTCACAAGTCCCCAGGCAGTGGGGACTCCAGATTCCTTCGCAGCCAGGGGGGC
AGGACTTCTTTGGTTTTGTTAATGCTGGTGCTGGTGCTGGACATGCCTGGTATTTTGGAA
CTTCATTAATTGTGGGTATATTTTTAATATTATCTGAGTGAGTTTTCTCGAGCTTATGGG
TCTTTAATTCTTGCTGATATTGCAACAAGTGGTCTAGCTCTGCATGTAGCTTTAGAGCTT
TCGACCAAACCGGTGGCGTTTGCTGACCGTATATTAGCCACCTTACGTGGGCTATACGTT
TATTCAGCTTAGTTTTCAAACCGCCACGGTGTTTGCCCATACTCAATAGAACTCTACTCA
CTCAGATTTTTCCTTGGTTTTTGCAGTTCCATTTAATTAGTCCAGTCTTCTTCCAGTCCA
GTGTTCCTTTGTTCCTTTGTTTTCACCAGCTTTGGTCAATTCGTCCAGCGTTGGACGACT
GTCACGGTCGCCATGTAATGATGAACTCCAATTAAGAACACAAGTCCGTTTTAAGTTGAA
GGCAGCCGTCGGGCTGACATATATTTATTCAATTTCTTCTTTTGATTTTAGAGTAGGCAG
AAATGGTTCTGTCAGCTCAACGTCTACTGAGTCTCTCTGATTTTACAGTTTTTTAATATA
TTTGGACTTAGGCTAATCCGCGTAGCTGCGCTGCCGGGTACGCCAGCAGCGGAGCGGCGT
TCTTATGTATATCTTATATATCTAGGCTTATCGGGAGAGCGAGATATGTATGTACGTATG
TAATATGTATTTGGTCGGCGTGTGAATGCTGACCATGCACTTATACTTTTTGCCTTCGAG
TGGGTGATCATGTTACATCCGCCCTGGCCTAACTGCGTGCATAAACATAAACATAAACAT
AGCAACAAAGTGCTGCCATAAGTTAATATGCTATTTTATTTAATTGTTCTTAATATTGCA
TAGGCACATACTACACTATCGCTAGTTTCTTAGGTCTTAGCTTTTCCTTAGGTTTTTCAG
ATAGAAAGGCAGGGAATACAGACAGCAAAGGTGAGTTAACATATTACTACGTTCCTTCAA
GAGTGGCTTTCGTTTGCGTTATCTGATGAGCAATAACTTTCGCCCCTAGCTGAAAAATGA
TACTTCTCATGTTGAATGCGAGATTGGTCTTACTGAAAATAACGGAAAATAGAAAAGCTC
ATTTGAGTTTCTAAAAACGTTGACCTGGCCTCTTATTAACTTAATTTATATTTCTATTGT
AGCTTGGAATACTGCTCAGAGGACAAAGCGGGAGTGACGGAAGATACGGTTAGTATCTAT
TTGATGACCATCTTTACGTTATATTAGTTCTGATGAGCATTAACTTTCGCCCCTATCTGA
AATTGAAACTTCTCTTGTTGAATGCGAGATTGGTCTTACTGAAAAACTAAAAAACTATAA
GCACATGTGGGCTATCTATATCCAATATATTTTAAAACCCAATATATATTTACAGATCGG
CGGAACGAAAACTAAAAACGTGCTTCGAATAAACATAGGAATTAAGGTAAGAATGCCTTA
ATTTATAGTTGAATTTCTTATTATCATGATGAGCATTAACTTTCGCCCCTATCTGAAATT
GAAACTTCTCATGTTGAATGCGAGATTGGTCTTACTGAAAAGAATTTCGATTTAAAAACA
CGAAAACAATTTTCTAAGCACTTTCTAACCAAATTTTGCCCATTCTCTTTACAGATTTGT
TGATTAGGTTATGCAATATATGGACTATAACTTTAATAAAATAGGTAAATATTGAATAAC
TAAAAGTTATTAAAATGTTTTTAAGTGATGAGCTTTAACTTTCGCCCCTATCTGAAATTG
AAACTTCTCCTGTTGAATGCGAGATTGGTCTTACTGAAATGACTCACAATTAAAAACAAG
CCTCAATCTTTTCGATTGCCTTTCTAATAAAATGCTACTTTTTCTTTACAGATAAGTTCA
AAAATTTTTTTGAAAATCATTGAATGCCACAGGAATCTTAAAAGGTAAATGTATTCAAAA
TGAATTATTTCTTTGCGAGAATAACTAACTTCTTTGAAAATTAACTGATGTAAAAAAAAA
ACTGAATTATGTGGCATGATTTTCACATTAACCGCAACAAATCCTACTCCAATAGGTCCT
ACTGACAATTCTCACAAAAATAATGCATTTAGGCCAATACAATAACAACGATGCCTAACA
ATTGACTCTCCTTTGCCTTTTCAGTTCGCATGACACTTTATTGCGTTGAGTAAACAAGGT
AAAAATAAATTTAAAAAAACTCGTTTGCCCAGTTTCTAGTGAAAATGTTGAAATAAAAAT
ACTGATTTATGTGGCATGATTTTCACATTAACCGCAACAAATCCTACTCCAATAGGTCCT
ACTGAATATATTCACAAGAAACTTAAGGTGTGTTTTAACCAGATGTGGTTCTAAGTGAAT
TTTTTCTTATATTTGCAGATGTGCTTTTGGCGACTTTCCACTGACTGTTCCAATTGAGTT
CCATTTTATGCCCTTTTTTAGGTACAACACTGCCCAAGACATCATATAATACTTTATAAG
CAAATAAAAGAAACATACACAAAAAGCACAACTTCTTTTTAATTAGACAAGGCCATGTGT
GCTCTTAACCTAAAACACAGCTGAAATCTATAGACCGCTTGTTTTGGGCGGGCAATCGTG
GGTCAGGGGTGCAAAAAAGCGCGAAAGAAGAGTGCCGACCTTCGGATGGATAACTTGTGC
GTGTGCAAAATGAAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1243, 1304..1672, 1749..2000, 2193..2467, 2703..3107, 3169..3567, 10999..11069, 11282..11327, 11515..11565, 11754..11796
1231..1243, 1304..1672, 1749..2000, 2193..2467, 2703..3107, 3169..3378
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved