Drosophila_melanogaster Locus Nop60B
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Nop60B
Drosophila_melanogaster
Nop60B
2R
snoRNA:Psi18S-1820
2504..2643
4406
TTCGTCGGCCTAACCATTTTATAAGAAAACCGAGAAACATATGTACGTCATATTAATGC
ACTTTACTATTAAACAAAGGGGAAACTTAACAGATAAACGACCGGCAGAGCTCTAAACGG
CGAACGGCTGATCCTTGCCATCCTCGTGGTACTTGATGTATGTTTCCCCGTGGGTGAAGT
CCTTGGTTCCCTCCAGGCGACCGCGGGGCGGTGCCTTCTCGTAGTCGAAGGCCTTCTCTG
ACTTGCCGAACAGCTGGTTGGCCATCTCGATGTCCTCGCGGTAATTGCCCACGACCACCT
TCTTGCCAGTGAGCGGGTCCGTTATGTCACCCAGCGGATAGACCACTTTTTCCACGTTGT
GCGTGATGAGGCGGGTGAGGCGCTCTGGCAGTTCCCGTATCAGGACCACGTCCCCGGTCT
TGCACACCTTCTGCGGATCGTGGGCGAAGTAGAACTCGTCCTTCTTAAAGTACTGCGAGC
AGAAGGGAAATTGTGTGAAATCTCCTGAGGCGAGATCTAATGTATATTATGCACACCATA
TTCAGGTTCTTGTCCAGCTCCATTCGGCGAATGCGGATCTTGGAGGCGTTCTGCTTGATG
CAGGGCATGCACTGGCCCATTAGTAGGAGTCCTCGCCTCGACATTACTTTAATTTAATTT
AAGAGTTTAGAAAAATAAACAACCGGTTGGGAAACACAGCTGGTAGATCACTGGCGATAG
TATCGATTGGGCCTGGAACTATCAATATTTCGATATTTTTTACTCAGCAGTTTCTGATTT
TCAAAATCCCGCCAAATGCAATCAGCTTGCACGCGTCAGTTAAAAAGTAGGGTAGTATGA
CTTTTCATCGCAAAAACAAGTGGATTCTAAGGACATAACATTTTCACCGTACTATAAACA
GTGTATCAGTTTTACATAACATATCTTTTCAATTAAATAATGCTTTAATGGATTAAAAAT
GTTTACGTCAAAGTAAATACCTTTAAATTCATTTTGTTTATGAATAATACATATTTTTAA
TTCAAAATTGTAATAAGGAATTCGGCTCACGATGACATATCGCAAGATTTCCATTTATGT
ATCGATGTCTTCATGAAATACATTTCTGTGTAGTCACACTTATCGATAGACCGCGCACTC
CACGTGTTTTTCGTCCATTTTCTCGCAGCGCGCAACACGTGCGGAGGTTTCTCTCCGTCT
ATTAGTTGATTTAGCAGAAAACGTAGATAAAATGGCCGACGTGGGTAAGTCTGGCAAGTG
ATGAATTAAAAGAGTGCCCAAATAAACGGACTATGCGCCCGCAGAAGTACGCAAGGAGAA
GAAAAAGAAGAAGATCAAGGAGGAGCCCTTGGACGGCGATGACATTGGCACGCTGCAGAA
GCAGGGCAACTTCCAAATCAAGCCCTCCTCCAAGATCGCCGAGCTGGACACCTCGCAATG
GCCGCTGCTCCTGAAGAACTTCGACAAGTTGAACATCCGTTCCAACCACTACACTCCGCT
GGCGCACGGATCGTCGCCCCTGAACCGCGACATCAAAGAGTACATGAAGACTGGCTTCAT
CAACCTGGACAAGCCGTCGAACCCCAGCTCCCACGAGGTGGTGGCCTGGATCAAGAAAAT
CCTCAAGGTGGAGAAGACAGGCCACTCCGGCACGCTGGATCCCAAAGTCACGGGTAAGTG
AAGCGCGTGCTCGCCTACCGCCATACAAACCTAACCTCATTGTGTGCCGCGTGTTTTTTT
TTCCTACAGGTTGCCTGATTGTTTGTATTGACAGGGCCACCCGTCTGGTGAAGTCCCAGC
AGAGCGCCGGCAAGGAGTACGTGGCCATCTTCAAGCTGCACGGAGCCGTGGAGTCGGTGG
CCAAGGTGCGTCAGGGCCTGGAGAAGCTGCGTGGTGCCCTCTTCCAGAGACCTCCACTCA
TCTCCGCCGTAAAGCGTCAGTTGCGCGTTCGTACTGTCTACGACAGCAAGCTGTTGGACT
ACGATGAAACCCGAAATATGGGTAAGTCAGAAGTTTTGTTTATCCATTCTCGCTCAGAGT
TGGTGCGTCGCTGCTGGATTAGTTTATCCTGCAGAGGTGCAGCCTGCTTCAGCCAGTGAA
ACACCAGTATTTGCCTAACACAGCAAATGCACAATGTAATTGTTAAAACCTCGTCTTTTT
CTCTCCTCCAATTCTGCCCACTCACGTGCTCAGGTGTTTTTTGGGTTAGTTGCGAGGCCG
GCTCCTACATCCGTACCATGTGCGTCCATCTTGGTCTCGTACTGGGTGTCGGTGGCCAGA
TGCTGGAGCTCCGCCGTGTCCGCTCGGGCATTCAGTCTGAGCGCGATGGTATGGTGACCA
TGCACGATGTTTTGGACGCCATGTGGCTGTACGAAAACCACAAGGACGAGTCTATGCTGC
GACGTGTGATCAAGCCGCTAGAAGGTCTGCTGGTCAACCACAAGCGCATTATTATGAAGG
ACAGTTCGGTAAGTTTGACATCCAGTTGCCGTTTGCGAAGTAGTACCCCATGATATTAAG
CCGGCAGGTGCCTGCAATCCCCACGGGCACCTGTGACTATGATTGGGAACAGCAAAGCTG
CTGATGTGTGTATGTTGGGCAGCGCTCTTATCCTGCGCGCTCGACAAAGAATATTCGGTC
GACATTTCCTCTAGCAAAGGACCCCCTTATGATATCAACTAACAACCATCAATCTTTCTC
CAGGTCAACGCCGTTTGCTATGGTGCCAAGATTACATTGCCCGGTGTCCTGCGCTACGAG
GATGGCATTGAAATCGATCAGGAGATCGTCATTTGCACCACCAAGGGTGAGGCCATTTGC
CTGGCCATCGCCCTCATGACCACAGCCACTATGGCCTCTTGTGACCATGGTGTGGTGGCC
AAGATCAAGCGAGTGATCATGGAGCGAGACACATACCCGCGCAAGTGGGGATTGGGACCA
AAGGCGTCGGCCAAGAAGGCGCTCATTGCCGCCGGCAAGCTAGACAAGTTCGGAAGGCCC
AATGAAAACACACCTAAGGAGTGGCTGACCGGTTATGTCGACTACAATGCCAAGAAGCCA
GCAGCTCAAGAAGTCTCCCCCACAAATGGCTCCAGTGAACCCAGCAAAGTATGTTATTGA
AAATGAGTTTAACATGGTATTCACTTGCTAAATAATTGTGTTCCTTTAGCGCAAGTTAAG
CACCTCCAGCGTTGAGGAAACTGCTGCGGCGGCGGTATCCGAGGAGACTCCTTCCAAGGA
CAAAAAGAAGAAGAAAAAGAAGCACAAGGGCGACGAGGAAGCCCCAGAAGCCGCTGAGGA
GGAGGCAGAGCCAGTAGAAAAGGAGAAGAAAAAGAAGAAGAAGAAGGACAAGGATAGGGA
CAGAGACGAAGCTCAGGAATAGGAATCAGAAGTTTCTATAGGATTAGGTTTTAAAGAGAA
TTCTACGCTTTTTTGTAGAGGCACCTACCGATTGCTAGCTGTTAGGTTTAAGGAGTGTTT
TTATGTGTAGAAGTGCATACAAATTACAAATGCATTTAAGTGACATTCGCAATGCAATAA
ATTGAACATTTTATTGTGGAACTCTATTGTAATGATGAACTCCAATTAAGAACACAAGTC
CGTTTTAAGTTGAAGGCAGCCGTCGGGCTGACATATATTTATTCAATTTCTTCTTTTGAT
TTTAGAGTAGGCAGAAATGGTTCTGTCAGCTCAACGTCTACTGAGTCTCTCTGATTTTAC
AGTTTTTTATATATTTGGACTTAGGCTAATCCGCGTAGCTGCGCTGCCGGGTACGCCAGC
AGCGGAGCGGCGTTCTTATGTATATCTTATATATCTAGGCTTATCGGGAGAGCGAGATAT
GTATGTACGTATGTAATATGTATTTGGTCGGCGTGTGAATGCTGACCATGCACTTATACT
TTTTGCCTTCGAGTGGGTGATCATGTTACATCCGCCCTGGCCTAACTGCGTGCATAAACA
TAAACATAAACATAGCAACAAAGTGCTGCCATAAGTTAATATGCTATTTTATTTAATTGT
TCTTAATATTGCATAGGCACATACTACATCTCCCTCCTTTTGAAAAATAACGTAACCTAG
TGAAGTTATTTTGATTATTAAATGCAAATTATTTTATTTTTATTTTTATTTTGTTTGTGT
TTTTGTTTGAACAACAATAGTTGATTTTATAATGCAAAGATAAAAATATACGTAGTGTAT
GGAAAATTTGTATAAATGATTAAGGAAAATATAAGTTTAAATTCAATCATGAATGAAATT
TCTTTAATCTATCTTTATGAACTATTTGTTTTTTGTTTTTATTAGTAAGTAGCGTAATAT
TGTTATTATCTCCTATGCTTTCTATCTTATAGGGCCCCGTATATTTAAAGTCTAATTTAT
GACCTACCTCATTTCTTAGTAAAACTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1243, 1304..1672, 1749..2000, 2193..2467, 2703..3107, 3169..3406
1231..1243, 1304..1672, 1749..2000, 2193..2467, 2703..3107, 3169..3378
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved