Drosophila_melanogaster Locus Fib
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Fib
Drosophila_melanogaster
Fib
2R
snoRNA:229
1753..1892
3830
GTAGGTGATCTCCGATCCGAGGCGACCGTCCCTTATGGTCAGGCACTCGGCTATCACGG
AAATCGGACCTGCCAACGCCTCCAGCTCCCGTTCCGTGGCATTCTTCTCCTCCTGCAGCA
TGAATATCTCGCGCTCGATCTTCTCGAAGGACTTGGAAATGATATCCCGCCAGCGATTCA
ACTCGGAGATGCTGATGTATAAATTACAGATTATTAATCGTGCTGTTAATCTTAATATAA
GATATGGACACTCACCGATCGGTCAGAGCCTCATTTGTCTCGTAGTTGGCCCAGTCGCCC
TCGATCCGCGTCTCGTTCCTCAAGGATCGGGATGAGTGGCGGATGGCGAAGGCGTCCGAC
CTCCGGGCATCCGCCACATTCCGCATCTGGTTCACACGGGCATACCAGTCCGTCAGCGAA
ATGTGCTGGAGCGGCTTCTCCATCGTAACCACCGAGCGGAAGGCCATTATGTTTGCAAAA
GTTTAGGTAAAACAGCAGGATTTATGCGTTAACAATTTCAGAAAGTGTGTGCTCCCAACT
AGAACTCTCAAAGCGGAATGGAACGTTTTTCTCAAACATCGATTTCAAGTGGCTGTTTGT
TTGGTCAACGAACACTAGATCTCCAAGGCACTGGGGTCATTGTCAAGGACTACGGGATTG
TAATTATTAATCATATACTTCCATAGTTACATGCATCAAATAAGTAAAATATAATAATGT
AGTGGCTCATAAAAATTAAATTAATTTAATAAATCAATCAATAATTTAATTGATCAATCA
ATTTTTGAATTGAATACAAAAAAAAAAGAATTACATTATTTGCAAGATATCCAAGAATAA
AATGTACAGTTTTTCAACCTTTGTACCACTATGCACAATTGCCTCTCCGCCTGGTGTTGA
ACTTAGCTACAGTCCCAGCCAAGTTTCCCACCTAACACACACACTAACATCATTCTCTTG
GTATTTTCGCCTTTGTACTTCTGTATATTATCACTAAAATCACTGCTGCGGCCACACTCC
GGCACACACGTGTTTTTCTTTTCAAGCGTTTTGGTTGCCGCGTGTTGACGGACTCAATCA
CATTTCGTCGAAAGTTGTATTAAAAAGTGCAAGTACAGCAACATAAAATGGGCAAACCAG
GTGCGTAAAATCACGCTCTAACGATACAAATCGAAGCAGGCGTCGCCTTTGCTTTTGATA
GTCTCCAACTTAACCTCTGAGTCAACCGAAATTCAAATGCGGATCTTTTCTATTGCAGGA
TTCAGTCCACGCGGTGGTGGCGGCGGCGGCGGAGGAGGAGGAGGTGGATTCCGTGGGCGT
GGTGGCGGCGGCGGCGGAGGAGGCGGTGGATTTGGAGGCGGCCGTGGACGCGGTGGCGGC
GGCGATCGCGGTGGCCGTGGAGGATTCGGTGGTGGCCGTGGAGGAGGTGGTCGCGGTGGT
GGTGGCGGCGGCGGCCGTGGTGCCTTCGGAGGACGTGGCGGCGGCGGTGGTCGCGGTGGC
GGCGGCCGTGGAGGCGGTGGTCGCGGCGGAGGAGGACGTGGTGGTGGTGCTGGCGGCTTC
AAGGGCGGCAAGACCGTCACCATCGAGCCGCATCGTCACGAGGGAGTGTTCATTGCGCGC
GGCAAGGAGGACGCTCTGGTCACCAGGAACTTTGTACCTGGATCCGAAGTCTACGGCGAG
AAGCGCATCTCCGTTGAGGTTTGTTGTTCTCATCTTTATTCACTTACCTTCCCTATTCCT
AGCTTATGATGAGGTTGTGCAGGGGTACAGAACATGGCATCATGTGGCCATGAGCATCCT
TGGCGGTCACCTGTGGCTGTGTGCACTTCAGGTGCACGTGAAGCAGTCGCGGAGCTCCAA
GGGCTGCTTAGAATAATGCACAACTGAGGCGAATTCCTATCTATCTACCCTTCTATCCCA
AAACAAACAGAACCCAAACAAGTCCACCATCTTGAAAAGTGATTTGAAGCTACCTGAACA
ATCCAAACAACTCTGTATTTCACTCAACTTACTTACTTCTTGCTTTCTGCTATAATTTTT
AAGAAAGAGCAATGGATTTAAATCTGTTCTTCTTTGCAGACCAATGGCGAGAAGATTGAG
TACCGCGTGTGGAATCCCTTCCGCTCCAAGCTGGCTGCCGCCGTTCTGGGTGGCGTCGAG
CAGATTCACATGCCGCCGGGCTCGAAGGTTCTCTACCTGGGCGCCGCCTCCGGAACGACA
GTCTCGCATGTGTCCGATGTGGTGGGACCCGAGGGCCTGGTCTACGCCGTGGAGTTCTCA
CACCGATCCGGTCGCGATCTGATCAACGTGGCCAAGAAGCGCACCAACATCATACCCATC
ATCGAGGACGCTCGCCATCCACACAAGTACCGCATGCTGGTGGGCATGGTGGACACCATC
TTCGCCGACGTTGCCCAGCCGGATCAGGGCCGCATTGTGGCGCTGAATGCCCAGCACTTC
CTGAAGAACGGCGGACACTTTGTCATCTCGATCAAGGCCTCCTGCATCGACTCGACGGCG
CAGCCCGAAGCGGTATTCGCTGCCGAGGTGAAGAAGATGCAGGCGGACAAGCTGAAGCCC
CAAGAGCAGCTCACGCTGGAGCCCTACGAGCGAGACCACGCCGTTGTCGTTGGCGTCTAC
CGACCACCGCCCAAGCAGTAAGAAGTCGTTTTCTGCTGGGTTTAGTTTTAAGGCTATTGT
ACTAATACAGACGAGTTGTATTAAGTTTCTTTTAAATATAAAACCGTAGTTATAAAGATA
AATCAAAATGCACATTATTTTTGTAGCAGACGTACAAAATATACACAAAAACCAAATGCC
AGTGTAACAATATGGAGTTCCTATGAAAGATGAAGATCTTTAAAGTCAATCTTTGTACAA
ACGTGGTTTTTCTGAGGGGTATTGCGGAAAATGGTTGGGCAAGGCTGGTATACACTAGTT
TGTTTTCATCTTCATCACAGAAAGTATAATGCTTAACAATGAAATGTCAAAGAAATATTA
AGGTCAGCTATTAGTACCCTCTGCAAATTCACAATAAATAAAAAATAAAAAAAGTTCTGC
GCTGCGGACAGGATTCGAACCTGCGCGGGTAGAACCCAATGGATTTCAAGTCCATCTCCT
TAACCACTCGGACACCGCAACTGTGTCGCCCCGGTGGCAAAGTTCCTATTTGGTATGAAG
CATAGATTTCAGCACCCCCCTCACCTATCTTCGCCAGGTATGACGCACCATTTATACAGA
CACGAACCAAGAACTATTCACGGGGTGGTGTCTCGGCTTAAGCCATTCTTAATGAAAATT
GGAGTTTCGTTCACGTGGGGCTAATGAATCCATAAAGATTATTAGCTTAATACATAAATA
AATAAAATAATGTAGCAATACATTATTTTTTAGTTCGCTCTCACTTAAGCTAATAGTTTA
CATATAGAAGTATGAGCACATGTCATGAAGAGCAGCTATCAATTAAACTAAAACTTGTGG
TATTGAAGAAATTGAACTGCATATTTCTGCATTCAAATATCTAGTGATTTACTGTCATCG
CTTTGCAGAAATTCAGATGCTTATCAGCATAGAATTATGCAGGGAGAGATATCAGTGACA
AATGGAGCGGACTTCAATAAGGCTGCGGTGTCCGAGTGGTTAAGGAGATGGACTTGAAAT
CCATTGGGTTCTACCCGCACAGGTTCAAGTCCTGTCCGCAGCGATAGTGTAGTTGTAACA
CGTTTTTTTTTTGTCGAACCAATTTTAACCCGAGATATTTTTTCAGACCTTTTAAGAATC
TTTCATCGCATATATCTTGTGAAAATACTTGTTTAACCAGCACATACTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1139, 1258..1697, 2079..2830
1127..1139, 1258..1697, 2079..2657
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved