Drosophila_melanogaster Locus RpS16
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpS16
Drosophila_melanogaster
RpS16
2R
snoRNA:Me28S-G2173, snoRNA:Psi28S-1175a, snoRNA:Psi28S-1175b, snoRNA:Psi28S-1175c, snoRNA:Or-aca1
1675..1741, 1965..2100, 2112..2252, 2265..2400, 2424..2558
3881
ATGTAAACGGGAGACTTTTGCTGCTGAGGCGGTAACCGCGGTACAGGCTTCGGGTAATC
TGCAATGGCAATATGCATAAGTTCAACAGACCCATTAGTGAACCCCCTTTATCTAAATGC
GTAGAACCCAACGTATTGCTTACTGTATTGATGTGCCAAATTGGCGGATAGCATGTCCAT
GCGCTCCACATCCTTGTTGTTCTCCTCCAGCTGGTGGATCCGAGCGCGCAACTTGAACTC
GTCATCCTCGGACGAAATGATCAGCTCGAATTCGTCTACAATCTCGCCCTCCTCACGATC
CTCCTCGACGACTCCCTCCTCAGCAGTTTCGTCGGGATCACAAGGTTTAGAGTTCGCAGG
GTTTTCCAGCAGCTCCGAGTGCTCTTTTTTTATCGCGGGCACTTGCAATATTTCCGGGGG
CATTGTGGCTGTGCCAACAACCATTTTTGTCTCACGGAATTAAGCACTTTATGCTCTTTT
TCTGATATTTTCTGACACTAATGAACTACAATTACTCTTTTTTTCATTACTTTATACTTG
AGATAGTAGTCTATCGATAGATTGCGATAACCTAAAAAAAATACCACATTGCAGTATTTT
GAAGCTTAGACAAGGAAAATGTTTCGCTTTCTTCTAACAAATTACTACAATTGTGAGGTC
AAATTCACGCAGATCCCAGTTCTGCACTTCAAATCGCGAAGTATAGTTTTTTATATTTAT
TTTTTTTTGCCAGTAACGGGAAACACTTCAGACTCTATTATTTTGCTTCTTTTTTTTTGT
AATTTAAGTAAACGCTTACTTTTATATGTATATATATTCGTCGATTTAAACTACTATGCT
TGTTTCTATTCTTTGTTGCAAGTTAATTAATACTTAAAACTTAAACAGACTTTTCCGATA
GTCCTTCGTTTTGCAGCACTGTCCGGCAGGTGTCCCTTTCTGGTATTTTCCCACTGACAG
CTGCGCGAATGCCGAAATGCGGTCACCCTAACTGTCAACGCGACTTCCGCTCTTTTCCTA
CCCAACTCGCGGAGCAAAATGCAGCAGAAGGTATTTGTGCCCGTGAAAAAACAGAGAATT
CGTGTCTAACTAATGCCTAAAATGTTGCGAATATTTGTATTTTGCAGCGCAGAGAACCCG
TGCAGGCTGTCCAGGTCTTCGGACGCAAGGTGTGTGTAAATTGAACCGCTGAAATCCACT
AAAATAATCGTGCGACACGTGCAGGCGAAAAACTCGCGTCAATCGGCGGCGGCAAAAAAT
TCGTAGCTGCCGCCGCCTCAACGCAGAGGTTATGTTTGTGTGTGTGCGCTAGGATTTTAG
CCTGGAATTTGGATTTTAACTCAATCCAGTGTCTTACTAAGCGATTAATAACCGGTGTTT
TTATTGTAGAAAACCGCCACCGCCGTCGCTTACTGCAAGCGTGGCAACGGCCTCCTGAAG
GTGAACGGTCGTCCTCTGGAGCAGATTGAACCCAAGGTCCTGCAATACAAACTGCAGGAG
CCCCTTCTGTTGCTCGGCAAGGTGAGTACGACGAACGGAGCAGCTTAGAAAGCCAAAGCT
TCCGTTTCAAAATCTGTTTTGGATGCACAAAATAGGGCATATTTTAAATATGCTACATGC
AATCAAAGCCGCCGTTTTGTGCAGTGAAAATTGAAACGAAAGTCTGGCTTGTAGTACCAA
TATGATGATAACCTTTATCCCGAATTTGAAGCCAAATGAGACTAATTTTTTATACTGATC
GACCTAAACACAAATGTTTATGCACAACCTCTTGTAAGCCTCTATTAATCCAAATACAAT
TCTGTATCTTGCAGGAGAAATTCGCCGGCGTCGACATCCGCGTGCGCGTTAGCGGTGGTG
GTCATGTAGCCCAGATCTACGCCATCCGCCAGGCCATTTCCAAGGCTCTCGTTGCCTTCT
ACCAGAAATGTAAGTAAAGCTTCGGATCGAAAGCAGTAGCACAACGCCTTTTTCCAGATT
TTTGTTGGAATTGTTGTCCCTTTTCCTTCGAATCATTATTGAAAGGCAGATTAAATGATG
AGCATATACCAACCAAGCTACGCTATAGATGTGTAGATTGGGTGATGCTTCAGAAACACC
TTGAATTTAAGACCCTTTTTTCAGATGTTTGTTGGAATTGTTAACCCTTTTCCTTCGAAT
CATTATTAAAAGGCAGACTAAACTTTATTATGAGCATATACCAACCAAGTTGTAAGTTTA
TTGTGCAAATTGGGTGATGCTTCAGGAACACTAGGAAACGCAGTCCCCTTTTTCCAGATT
TTTGTTGGAATTGTTATCCCTTTTCCTCCGAATCATTATTGAAAGGCAGATTAATTTATG
AGCATATACCAACCAAGTTGTAATGTTATTGTGCAAATTGGGTGATGCTTCAGGCACATT
TATACGATTATTAGAACTCCTAGCACCTTCTCCCAGATTTTTGTTGGAACTTATAGCCGT
TTCCAGGAAAAGACTCGAGCAGGGAGATTAAGTGCATGTCGCAATCGAAGAGAACGTTGG
CAGATTTGACCATTGTTATTTGAGGCTTCATCGACACTTTGATTAACTTTAGTTATTTTC
TATGAACTGTATCTGTGTTGTGGGTTGCTAATTGTTTGAAACTTCTTTCTTGCAGACGTC
GATGAGGCCTCCAAGAAGGAGATCAAGGACATTCTGGTGCAGTACGACAGAACCCTGCTG
GTCGGCGATCCGCGTCGCTGCGAGCCCAAGAAGTTCGGCGGTCCAGGTGCCCGTGCTCGC
TACCAGAAGTCGTACCGTTAAACTACTCTGTCTGGTTTTCAATTTGGATTAGAGCTATTT
TTTACAATTTGAAAATGGTTTGCACGCACGTGCGAATAAAACGGAATAATTAACTGTACA
AACGAGTAGTTTTGTTCTATAAAGTGGGTGAAATATGTATAACAAAACCTTTTTTGGAAC
TAAGTGACGGTTTCCAGAAGAATTGAGTTTTCGAAAAATTAATTTTTGAAGCAGATGATA
TTCAGTTTGAGAACATAATTTTATAAAGAGGTGTTTATATCTTGGAAGGAGTAATATTTG
AAAATTCTTGAACAATGTTCGGTAGGTTTGCGCCTCTGCTAAGAACAATCACTGAGTATG
GTATCTTTTTGGTATTTAATTAGATGGACTTATTTCTGAACTCCGCCAACGGCCACTCTA
TAATGCAGCCATCGTTTGTTTTTCAAAACGTATAGCTAAATTTCGGGTTAATAATATCTA
TCAAATGTTTATTTGAAAATTTAAAATTCTACAAGTAATTTTTTCCCCTATAAGCACTTA
TATATATATTTATTTTTATATTCATATTTTATTCCTTTGCAAATTTTTTCGACTTAAGAT
TTCCTCGAATTTCCCACTGCAGCTACAAAGTAGCTAAGTTGCCTACACAGCCACGTAGTT
AGTCATGGGAGCTTTGTTTGGAAAAACCAGCAAAAAGACGGCTCCTAGTCGGATCACCGA
CCAGGACAAGGCGGTTCTGGTAAGTTGGTGGTAACTGAGTAGCCAGAAAGTTTGCCCAAA
CACTTAGCCACTTCCCCATTGCAGCAATTGAAGCAACAGAGGGATCGTCTGAAGCAGTAC
CAAAAACGCATCGAGACGCAGTTGGAGAATGATCGCCTCCTGGCAAGGAAGTGCCTACAG
CAAGGTCGCAAGGAGTATGTGTCATACCCATATGTGATCTAAACATGTTCAACTAAACCG
ATTGCTTTCATTTTAGCCGGGCCAAGCTGCTGCTGCGCAAGAAGAAGTACCAGGAGAGTC
TGCTGACCAATGCCGACAAACAGCTGGAAAACCTGGAGAAGCTGGCTGCGGACATTGAGT
TCGCCCAGGTGGAGATGAAGGTGCTGGACGGCCTCAAAGCGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1049, 1127..1168, 1389..1520, 1814..1928, 2635..2881
1038..1049, 1127..1168, 1389..1520, 1814..1928, 2635..2777
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved