Drosophila_melanogaster Locus CG3074
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG3074
Drosophila_melanogaster
CG3074
2R
snoRNA:Or-CD1
6300..6405
14853
TGATTCTGGGGGAGCACTTTGCAGAAATCAATAATCAAATTGGCCCGACTCCCGTAATT
TATTGCACGAGTCTGCCGAATTGACTTCAATTTAAAACGCATCAGCGAAAAGACAGACAC
TCGCAGATGCAGATACAGATACAAACAAAGATTTAGATAGATTGAGCGATCGCATCGATT
TGTTGCCAGTCGATGGCTGTCACTTGTGGGGGGTAAGGAATAAATATGAATTCGCTGAAT
GTCAGGTTCAAGCATTGGCATTGCCGACACTTGGGGATACGCAGATACACAGATATGCCG
TAGATATATAGATGCACAGATGTAGATATATTGACTCCCACACGCATCTGGAGCAGCTCC
TTCACTCGCTCTGACTTTGACTTGTAATTGTTTGCTTGTTTATGGGTTTGCGCATTCAAC
AGAATTTATTTAAATGCGCTTGACATGAAGTGAGTCGAGATGAAGGCGCAGCTCCAGACA
ATTAAGCTTAATGTTTTCTCGTTTCTTACGCAATTAAGGATCGCTCTGGCCAAGGCGGTG
TCCTCGATCCCCAACGACTTCAATAACTCAATTATTCGTCTGCACACACAGAAAATATTC
CGATTCGTACATTGAAATATTTAAATTGCCAAAAGAGGAACATATTAAAATGTTTATTGT
AGCATTTGTTTAAAGTACTAAAGTAGTGATCTTGTTAGTGAAACTTATATTTTAAAGTAA
GTTCATTCCAGCTCATTTTCGCTCGTGCCTTGTCCTTGTTTCGGATTACTTTGAGTCTTT
ATTTTGGGAATTTTTGTTGTTTAAAAGTTCTGAAAAATTCGCTTGTTCAACGATTGCTGG
CTCAGCGAAAAGTGGAAGCCAGGGGTTCGTTTACTTAGTGTTGTGGTCGTAAAACGCAAA
TCGCTTGTCGGCAGCAGCTTGTCGGCTTTTAAAGTCGCGTCGTTTCCCCATTCGCAGTCC
TCAGATCGCAGTTCAGTTTGCAGCTCAGCTTGGTCTGCTAACTTGGCTCAGTCTCAGTTT
GGGTTCCAAATCTGTCGCGTGCGGATCAGATCAGTCTTTACAGTTTATGCCCGATTTGAC
GCTAATTTCAGCTGACTTTTCGTCTGGCTGGCTAATAGTGCGCGAGTTTATCTTTAACGT
TTGAATCTCAGTTTCGGCGATTACCAACTGAATTGTGTGTGACAGGTGAGAATTTGTGGT
AGATAAACTTACAGATAAACCGAGTCCAGTTCGAATTGCAACGCAGAGCAAGTGTTGAAA
TTGTAATTGAATGCGTGGCTCGGCGGGAAATCAATATCAGATGGATTGTCTCCGGATTTG
CGGTTAACGAACAGACATTCGAGTCGGAAAACAACAACAGGAGGATCTCGTTCTGTGAGC
TATATCAGTTGGCACTTGCTAATTTGCTAATTAATCAGACTAAGCAAACAGCCCTATACC
GAGATATGACCTTAAATATTTGCTCTACTTTGGCCATTTAAGCCGCGCAATCCGTTTAGA
TAAAGAGCTAACCCATTTAGCCCAACTATTTCCCCTTTCGCCAGCGCCAGCTGGAAATTT
GGACGGCAAACACAAACATTTATCAGAAATCTGAGCAAACTTGCATTTTCCACGGGACGC
ACCGCTAGAAAGTCTGGAAGATGCTTGTGCCACTTTGGGCCAAGATCGGGTCTGGCCAAA
AGCGCTGATGGCGGTTCGTGGGTGCACAGCAGATGGAGATGCATTCACCAGATACGGATG
CTAAATCCGCCTGAGTCACGCTATTTATAACAGCAAAAAAAAAAAACAACAAAATAATGA
AATCTCCACCGACACGACTGCAATCGATCATCGCAGAGGAAAGCGGTGGGCTTTTGGCAC
CGAATTTTTACCTAAAAACCAAATAGACAACCTGGGGATTGCGTCTTATTTTCGATGTGC
AGCTGGAATTCCTCCGGCGATGTTTACTTTGGGCATTAGCTTTTGCTGCCGTCAGGCGAA
CATGTTATTCTAGTTCTGTGTATTTTGCTCTACTGACCGTGAACTTGAACAAATGGAAAT
GCAAATGCAACCCATACAAACAGGCGAATGCACTATCCTTTGGATTTGAAGTTAAGTGCC
TGATTCGGTGAGACTGAAGCTAGCGTAACCCCTGAGAAGTGTCAGGTATCAGTGGGCAAA
ATGTGACGATTCAGCTTTATAATCATGGATATATGTATCTCTATGTAAATATGGCTGGTC
TCTAAGGTTAACCAGAATTCGGGCAGGAAGCGAATTGCTCGAGCAATCTGTAACGAAACA
CCATCAACAATACAAACCAGAGCAGCCAAATATTCAATATTATATAGTATCGCAACTAAT
CCCATAAATTTGTTAGTTTTCATCTTTGAGCGGACAAAGCAAACACGCAATCCGGTCCAG
TTCCGGCACCTCCCCCCACCGAAGCCCCTACAAAAACAAATAACAAAAACAAACCGAAAG
CAAGCACACCTGACAAAGGTGAGTGAGCAAAAACCCAGAAACATGGCTACTGGTCTTGTC
CAGGTGATGTCATATTTATCTCTGTTCGCGGGATGGCTGGCGCTTCTGGGGCTGGGGATC
TTGAACTGTGTAGCATAATGGCAGCTCCGAAATGAATTCCTCCTCCCTGCCATAGTTACG
ATCCTAACGTCGCCGATCCAATTTGCATTTACATAATTCTCAGAGACTTTACGACTCGTT
AAGTATGTGCCACAACCCTCAGGCCTATTTGATTACCTTTGTGGGATTTGCATAATCAAT
GATTCGAATAGCTCAGATTTGAGAGCGACGAAAATGGGGGAAGTGCTAGTGGGGGCCCAC
TGTAGACAGGGGGGAACGTGACGATGTCATTAGGCAAAGCGCCATTTAAATGGATTGGCC
TGGGCAACAGAACACAGCTCAGCTAGAAAATCGGCAATTAAAATGTAAATTGCATCACAT
GCAGTTTACAATTGCTCCATCATCGTTTTGATATATGGCTCATACGCACCGTTGGCCGAC
TGCAGCTCGGCGGTTAAGGTTATTTGTGAATAGTGAGTAAATATGTTAAATGCACACATT
TATTTATTCAATCGCAATTGACACGCTTTGGGTGTTTTGGGTCCGATCGTAGCATATTTT
CGTAATTGATTCGAATCGTTATTATGGCTATTACGATTACTACAATGTGGTTATGAGTCG
CCGAGGGGCTTGCATGCGATTAATGGACACCCACACCTCTCGACACTGAACTTTAACCTT
TCCCAGGTGATGGAATGTACATATCGGTATTTTTATTTATTTTACCTCCTATTTTTATTC
GCCATTTGACGAGAAGTACGATCTGCTGTTGTCACAGTGCTTGCCACCGCCGTCGAATTT
GATTTACGGCACGTATCGACTCCCATTCAATCAGTGATTCAATGGCGCTAAATGGAAAAT
GCATTTAGCTATCACTTGGCTGTCAGCAGGTTGACAAATGACGTCACCGATGATTATCGT
ACGCTCCATTGCCAATTGCAAATACGGATCTACGTGACGTCACGGCCCACCTGCACTGCA
GCGCTAGGCATTTCGGCCCGGTTGTTATTTGGCCAAGAAACATGGCCTATTTGCTTTTCC
CAGTCGATATTTGTGGCCCATTAGCAGTTCACACCTTGGCAAGCGCTAAAGTGGCGCCCT
GCGATCGAAAACAGGGGACCTGTTGGCACTTTCAATTATGCACGCCGTGCTAATTGAACT
TGGCCAAAGTGAAACCCCAGTCCAGAAAGTGACAGCCAGTCAGATCGAAAGATAGAGCGA
ATAAAGCCATAATAGTTCATGAATGAGTAGTGGACGTCGCCTAAAGTGGGAATTGTTTCT
CCATCAGATAGTTAATTCAAACGCCTCTAACGACAAGAAATGTTAAATACTGTCAAATTA
TTTATTCATATTTTTAAGCTTAGGAAGAAATATTATTATATTTTCAGTCAATTTCATTCA
ATTTTCTCTACTGTATTTGTTGATAAAAATGCGGCAGCTCTTTTAAGCAGAAAGGTCTTC
TATTCTTTGGGTGTTTTTTTTTTTTTGGCGACAATTAATTTATGTGATATTTTGTTTAGG
TACTCTTTTTTTCATCCGTTGCTTTTATTATTCCGAGGGCAATTAATTTATGATGACATA
TCGCCCATTACCATCACACAAAGTTCTTGGGCAAACTGCGCAAAATAATGGAATGATATG
TAACTAAACAACAATTGGGGCGACATTGTTGGACAGTTGACGGGCGTGAAAGAGGTAGGC
AAATATTATTTTTTGGGGGTTCGGTTGGAGGCGCGTCACATTCACAAATAGCGGAACACG
TATTCAAAGAGCTTTGCAATGATTCAACTTAATAGCATTTTTTGGTCAACACAAAATACA
TTAAACACGATGAGCGAATGCGTTGTCATCTTCGTGCAGACATTGACACTGACTTCTGAG
CTGAGTGTCACTGACATTGGTTGGGGCCGCAATAAAATACACACAGCTCGTACATGAGTC
CGCAAACATATTCAGATACAGATACAGATACACAGATAGAGCTGTATCTATCGCACGCCA
AATGATTCGCACTTGGCATTGACAATGACTTTCTGGCCGCAACAATGGCACAAACATCCG
CGAAAGCGACAATAGTCGCCAACTCGCACGTCAAGCGATCACTTTGGGTTTGGCGGTTTG
GTGATTTCGGTTAGCTCATTAACCCATTTAACCCGTTCAGGATTATGGGGCATGTTACGC
AGCGATCTAAAAATAGACACTCCAATTGAATTTTAGCTCTAAAGTGTTTACTTACCTATA
AGTAATAACTAGATCTAGAAGACATGGAATACAAAAGATTAAGTATAGGTATATTGAAGT
CAAGAATGTTAAAATTAAATCACTCTTCATTGCAATATTTAAATACGTTTATTATCCCCG
TGTTTTTCTTCGAATGCAGGCACTTAAATTGTCATTCCCTGTCGAAAAGTAAAAGTAATT
GCTTGGCCACTCAAATTCAACCATCTGTTTGAAATTAAAATTTTTGGCAGACCCCAAAAC
ATTCGCTTGTTAGTTCACGTTTCGCCCAATATTCGGCATAGCATCGCAAATAGGTAGAAA
TAAATTTCGAGAGGGTAATTTTCAAATGAATTTGCTTTAGGCCGTAATTCGCTACCTTTG
CGATTGATTGGCGTACAGAAGAAAGTGCTCAGAAAAGATTCGTCATGCGAATCACAGGCA
AAATCGCAATCAAGTCGGCTATGAATAGAACACCGAGTGACACCAACGCTCCAGACAGAC
AAACCGCTTGTATAACATTCGGATTTGGATTCGGGTTCAGATAGGGGCTCAGATATATAT
GTAAGCTATGCAAATCGGAGGGCGGGGCCGCTGCCGAGATCGCAGATACCAGACTTGTCC
CACTGGCCTGCTCCAAGTGGAGACCCCTGAGACCGTAGGCGTTGGAATATGGGACAAGCC
GTATCGAAAGCACTGCTCTCAATATAATTAAAACATTTGTCGCGATCGCATATGCTGGGC
AATTAATAATAAGTACGATTGAGCCACTGCAAATACCGAATAATTGAGGGGAGTCGAAGT
CTGGAACTCCCTGATAGCACACTTTATCGACTTATTTTAGTAGAAGGAGTACAAAATTCC
AACTACAATCTAGTTTATAATCAATGATTGACGGGTTACATAAAATAAGAAATCAAAGTT
CTATAGAACCAACGAAATTCTGAGTATTCCACTTCCTTTGCTTGACGAAAATATCAAAGA
AAGAAATCGAGCTATTATAAAAGTACATATTAGTTTGTTTAACACTAAGTAATTGCACAT
TCAGCACATACTAGCCCAAATTGACGTCACTAACTTGTGGGGGAGTAAACCGCTTAGTTT
CGATAATATAAGCCCCAAAACTATAACGAGCCCCGGACTTGTAAACACATCTATTTTGGC
CGCCGTTTTATGAGCCCCACAGTTTATTTTGGTTCCCTTGGCTGCAGCAATTTAGAAACT
TGATGGCAAGGCATTTAGCTTGAGTGCTTGCTAGCACCACCGCAAATTAAACGGCTGACA
AAGCGACCGCGATAAACACAAAACTCAAGAAATCCACACACTTTCATAATAAAAGCGACA
AGCGAAGCGCTCATTAAAATTCGTCCAGTGGAGCTCAACAGCGCTGTTAGCGTAACAGAG
CCCCATAACATTGCTGTTGTGCTATCAACCAAACATTCCACCACCACGCGGTGTTTATAA
TTCCCAACCAATTTTGGCCCTTTATGAGCGGAACGAGGCATATTTCTCGTGCAATTCTTG
CGAGAGGTGACGATTGGGTTCGATCTCGCTATATAATGCTTGAGGGCCTTGTTCTCCCAA
CCAATATGTTACGACTTACGGGACAGCCTTGAAAACATCTGATCTCGCCTTTGTTTCTGA
ATGCATATGAAATATTATACAACCTGGGTATGGATTTTAGGAGATATGATGTCGGATCTC
GGTTATGATGATTGACAAACTGCCCAATTTGGGGAGTAGCAACTGAGTGGCTGACACATA
CGATAATTACTAATCAACTGCAAACATACCAAAAAGAAAAAAATTAGCAACCGTTTTTCA
AGTTGTGTGGGGGCAGTTGAGTGCAATTTCCGAGAGTTCTACACCTGCCCAGCTACTAGA
TCTATGGGTTTAGCTCTAAATATAGAAGCTTACACAAACATTCAACACCTCTTGAATTGT
TTCCGATGAGCGAATTATTAATTATCAACAACAACATTTGAGAAAAACAAAAATCAATTC
CAGTGCTCGTGTTTGGAGAACAGCAGAAGTATTCAGCTTTGCTTTAATTATTTTTATTAG
AAAATGTAAACAGGAAAATGATTTTGCGCGATTAATAAAAAAGGGGATTCCCTACTAAAT
TCAACGACAAAATGTAATAATCTGCAATACTGCCCCAAACTTAATTCAATACCAAGGATT
CTGACGCAGCCATAAAGAAATCAAGTGGAAGGCCGAAATGTTCTATTTTGAAATTTCCAC
CTAATGGTTTAGTCTGCGATTAGCCAAAATATACATATGTAAATATTTTCCAGCCAGCCG
TAAATAATCCAAACTCATTTAACAATGACGTCGGTCTGAAGTGTTTGCAAATGTTTTAAA
ATTAGCCGCTTGGCTGCTTCGATTGCTTTCCAATCTTGTGTGAAATAACTCTTAAAAATA
GCCAAAAAGTTTGGTATTTGGCGATTAGATTTTGCGATAAGGCTTAGATCGCAAAATGTA
ACTCCAAGCAATGGAAATGCAAAATAAACTGGCCATCTGAGGTGGGGTGTGTAGTGTAAA
GGTGTGGGGTTTTGCACCCGGAAACACTATTGAAACCGTAGCCGATCAATAAATTGGCTA
TCAAGCAGCTGGCCGATAGAAATAATAAACCAATTGTCAAACTGTCAAATTCGCAGCACT
TTTTCTGCACTCGCATAAATAAAATACTTTGGCGCAACAACAATTCGCGTATTAAATATG
CCTGACACCTCTGTCTTCGCATTGTTGTATCTTTTATTATGTTTGCTTAATTGTTAATAT
AATAATTCTCGTTCAATGTCAGACAGGCGAGCAGAAAGCATGGAAATTGCATAAAAGCTA
GTAGAGTGGCATGCACTCGATGCCCCACAAGTGGAGTGTAATTGAAACGAATCGACAATT
TGAGACATTAAACACAAATATGCCAAAAAAAAGTGACCTCCATTGGGTCGGGTTCTCTTC
TCGTTTGTGGCTGCCGACCGAGAAATGGTCCCAATTGACAAATGAAATTAATTCAATTCG
GTGGTATTTCGTCACTACTTGACCAACATTCCACCGAAATGGAACTGATGCGAATATTGC
GTGCCAAACTGGGTGACCTCGACCTTGAAGACACATATCTCACTTCGATTTATTCGTACA
AATTCCTGCCATACCTAGACGAAAGTTCTCGGAAATTGTAATTGTAATTAAAATTGTGAA
AGATCCAATCAAAACAAATATACCAATACACACTGCAATCATGCCGAAATTCTCACCCAA
TCGATCCGCCCAAGGTTGCAGTTTCGGTTCCAGCTGGTGACCCCGAATGCCAAGGAGAAA
GCTGAAATTCCTGCTGGTTTATACTTCATTAATTGCTTGATCAACAAGTTCAAAATTCTC
TTACGGAATTGCACATAAACAAAGACAGACCGTTAAAGAATTGAGCAAATAAATACTCTT
TTTAATGATCAGTAAATTGATAATGGATGCTTGAAAATGCCTTGCCAACTCTCAATGAAT
TCTGGCAAATATTTATGCATTCTTTGTTGAATTTGCCTTGCCTTGCAAGCCATTCGACTC
GGAAACGATTAACCACAGTTATTAATTTCTGAAAATAGCCTCCTTCGCAGTCCGATAGAA
ATTTCTTCAAACAAATATTGTTCGAATTTCGGAAAAATTCCTTTCGAATTTCGAGAGTTG
GGCAGAGCTGATTAAAATTCCGTCCACAACTTCTTAGACAATAAAGAGGCATTCATTCAG
GGGGAATCTCTCGATTTATGGCCAAAGTTTCCCCACTTTTATGTCGCCTAGCCAAGCGAA
CTTATCAGTTGGCGCTATGACGAAATACCATGAATCTGTCCACAAAATTGAACAATGTAA
ATCGTGCCGATAACATCCGCGATAAGGAAGTTACATGTCAGGTGGGATTGCCAATGGATT
GGCTTGTTCTTGAACTAGTTTTGGGTATCGAAAATACGTCTCTTCCGCCTATTCCCGCTC
CAGGTACTTGTGTCCAACAATTTAGCACAGCCATATGACTTCAGTGCCATGGAATGTCAC
CAATCTATACGGCCGGAATACCAATAAAATGCCATACCACCATAGCATACCCACTCAAAA
TAATGCTAATCAGGGGGCCAATTAAATAATGGCATAATTATGTTTGTATAAATACCCGCT
AATTGATTGCCCAGTTTTAGTCAGCAATTCGCGATGATAAGGCAGTCAGTCAGTCGACGA
CACATTAATGACTTCATTTAACCGCCAGATTGTCATCAATCCGTCACGTTGATGCATAGC
ATAGTTCGCTTTAATTGCATTCCGAATTCTACGACGTTGTCGTGTTGTCAGCGATTAGCT
TTCGGCACTACTGAAACTGAGATATGTACGTACATATAGCTTCAGGAATTACTCATCGTT
TACGTGAAGGTCAGGAGAAGCAAAAGAGGCATTGCAAACAGTAAGACCAAGATAATTTTA
TTAAGTTTTTTAAACTTATTTGCTCTTGGTCTAAACTCATCCGTGTGGTGAATGCATGGG
GAGAAAGGAACATTACCCCGCCGGTTTTTTAACTTGACCATTAGACGAATCATTCGCTTC
GGTCTCCATTAATCTCTTCGAGGTTTCATGTCCGCTTTCAGCCACAGATCGTAATTTGGT
CGGCAGTTTTCGGACAGATATCGCTCATAAAACCGAAGTTAATGTCATGCAAATCGCGTC
GGGCGACAGAGCGACTTAATGTCGTCTGATGGCTTTATTTCACACATTGAGGTCTGATTT
GTGTTGCCCATTCGGCGGTGGAGACATGCTTTTAATTAGCTTTCCTATTTTTTCCAGCTT
TCTTAGTTTATTAAGAGGAAATTTATGATTCACTCTATCGTTCCCAATCGAAAGGGAAAT
ATTTACATTACTATTGGTGATTCAATTCATTTTACTTCCGGCTAAGAGGGATTCATCGAA
AAGTAAATAAAGGTTGACGGCATAGTTTGTTTTGCTGTCGGCGTAAGTCGTAATTGGATT
ATCCTCTAGATGACGAAGCCCAGTTAACTGAGATGATGCGGTCTATATGGCACTGCAAGT
GCTCTTAATGATAATTACTCGTATGCAAAGAGCAGAAGCTCCAGATCGAAGTTAAGTGAA
ATGGCAGACACATTGTCGATGATCGCAAACCCAAAAGACAGAAAGTGAGATATGAAATCT
ATAAGACACAAAATGTAGATGGTATGCAAATTTCGCACTGAATTGGCAAAAAAATTAAAT
TTATTTGATTACTGTCCAAAGGCCTTGAACTCAAATTGGGTTAAATTATCACACATTTAT
ATATCTTATCAATTGCGGAACCAGATAAGTGCAAACAAAAACAAGCTAATATTAACTGCG
CACAAAAATCCGGCGAGGAATTTGTACATAAAAGTGGGTTATACCAAACATACCAATTAT
CCGCCCATTCCCGTGCCAATTGCGTTTGCCAAAAACGGCCAAACATTTTGCCCACCGAGA
AACCTTGGGATGCGCTCTGTTAACCCATCAGATACAAATAACGTATACGCAGTAACAGCA
GGACGGCTGCCTCACTCTCACTCTCTCTTTTCTCTCCCTTTCGCTCTGCCAAGCAGACCA
CCTACGCCACCATAAGCTATAAGCTATATAGCCTATAGGTCCCGAGATCGGGCGGCAGAG
CAGCGCTGCCAGCAGCAATATTAACAGAAGCAGCAGCAGCAGCAGCAACCTTATGTGGTG
GCCCATAATTCTAACTGAATTCAGTCAGCAAGCAGCCGCGATCGGAGCAAGAACACCGCG
CGACAAGGAAATCGAAATCGAGTATATTAAATCGGCCACAAAGTGCGGGCATTTGACTTG
AATTGTGCAAACTTACGAAATGTTAGTATTCCGCACGGTAACTGGAAGAGTAAACGGTGC
CCGAAACCCATTTTGTTTACCAGACTGCTGTGTCAGCAAACGAAAAGATTGTTTGGAGTT
CAATTTATTGGCTGGTATTCAGAATATCTGTGGCTCCATCGGGCATAAACATTGTCGAAA
TGTGTCAACAATCTTGGCCCATCTGCAAAGGAGTTGATTATTCCCGCTGTTTACTGGGCT
TCTAATTATAGAACCCTCGTCACGGCTCAAACTACAATTCAATTTGATTCTTTTCGGCGC
GTCGTATTCGTGCCAAAACTTTATTGCCAATTGACTGGGTCATTAATTATCAACACGAAC
TTTCAAATTAATTATCACTAAATTAAAAACGGGTTCAGCATTAGCGAACAATCGATTAAA
AAAAAAAAAATATGTATATTCGTATATTAAACCGTGGGGTGGGGTGTATGTTTGAACACC
TTCGAAACTTTTGTTTGGCAAGCAGCACTCGTGAATCAGAAGATTTCCAGATATATTAGA
CGGTGGGACGCTCGACAAAAATGCTTAGCCAGCAGGCGAAACAGGAAAAATCTATTTGCA
ATTTGCATTTATTTATGAAACTTTGGGTTCGCGTCGTATTCTCATTCTTAAAGATAAACG
AGTTTAATCTTCGTCTTTACCTCCAGAATTATCAGCGGAAAAGAAATATTTGAAAGCGCG
AAAACAACAAAATGAAATAAAGGGGCGCTTCGAGGAGTGACTTTGTTGGATTTTTCGATT
GGTGTGCGCAAATTTGAATTCGCTGCCGAATCAAAGAGACCAAAACGGAGCCAGCAAAAA
GTGGGGAAAAAGAAACGTTTTTGTTTAGACCGCGGATCGCCAAACCAGCTGGCGTCATCA
GAATATATTTGGTGGAGCTAACTGTTAACTGCTTGGCTGTGCGCGGCCAGCGAATTTCTG
ATGAGGAACTGCCCGTATCCAAGAGATACACCAATTAATTATCCCACCCAGACCGGACGG
GTTTCTCAGTGCCTGACTAATTTTTCGACTGCGTTCCACGGGTCGTATGCGCGATATGCG
AAGTAGTCGTGTATTCGCCACGCTAATTGTTGACAAATTGCAAGATGTTTATCTGGCTGT
TGATCTAAGCGATAAGCGATATATGCAAAATTATAAATTCCGCACATATTCCGATTCAGT
TGCAGATTAGAGGTCGTCCAAAGAGCCATGTCCATCAAGTGCGTCCACCTGGTGGGCCTT
CTGGTCCTGCTAATGGGCGGGGCCAACGCCCTTTTCGATCACACACTGAAAAGGGACTTC
CCAGGTCCTTACTGCGCACGGGAGAACACCTGCTGCAAGGATCGGCACGACGGCTGCTCG
GTGCCCATCTCCAGTATGTATACAATATTACACTTAAAATCAATAATCAAATTGGTTATT
TGTCATGTATATTGAATGATGACCTGAACTCGAACTTTATCTTACAGACACTCTATGCTA
CTGCGATGAGTTCTGCGATCGGGACGACTCCAGCGACTGCTGTCCCGACTACCGCTCCTT
CTGCATCGGCGAGGTGGACCCAATCATCTCCTGCGAGCACAACGGCGTCTACTTCAGCAA
GTACAATACCACGTGGGACAACTGCAACGAGTGCCGCTGCCTGGAGGGCGGCAGCGTGCA
GTGCGACGAGGATCTGTGCCTCACCGACGACGCGATTGTGCACAGCGTGAACTCGATTCA
CAGACTGGGCTGGTCTGCCCGCAAGTATGACCAGTGGTGGGGTCGCAAGTACTCCGAGGG
ACTAAAGCTGCGTCTGGGCACCAAGGAGCCCACGTACCGCGTGAAGGCGATGACGCGTCT
AAAGAATCCCACCGATGGCCTGCCCAGCTCCTTCAACGCACTGGACAAGTGGTCCAGCTA
CATCTCCGAGGTGCCCGACCAGGGCTGGTGCGGTGCCTCATGGGTGCTGTCCACCACCTC
GGTGGCCAGCGATCGCTTCGCCATCCAGAGCAAGGGCAAGGAGAATGTCCAGCTGTCCGC
CCAGAACATCCTCTCCTGCACACGCCGCCAGCAGGGCTGCGAGGGTGGCCACTTGGACGC
CGCCTGGCGCTACTTGCACAAGAAGGGCGTGGTCGACGAGAACTGCTATCCGTACACACA
GCACCGCGACACCTGCAAGATCCGCCACAACAGTCGCTCTCTGAGGGCCAATGGATGCCA
AAAGCCGGTCAATGTGGACAGGGACTCCCTCTACACGGTGGGTCCGGCCTACAGCTTGAA
CCGGGAAGCCGACATTATGGCCGAGATCTTCCACTCCGGTCCCGTACAGGCCACCATGCG
GGTTAACAGGGACTTCTTCGCCTACTCAGGCGGTGTGTACCGCGAGACAGCAGCCAACCG
AAAGGCGCCAACTGGGTTCCACTCGGTGAAGTTGGTGGGCTGGGGAGAGGAGCACAATGG
TGAAAAGTATTGGGTGAGTGTCGCTATCACTTCACTACTGCGCTTGCCACAGCCCTTTAT
TTCATTGATCTTGTCTCATCTTTCCAAACAGATCGCAGCGAACTCGTGGGGATCTTGGTG
GGGCGAGCATGGCTACTTCCGCATCCTACGAGGCTCCAACGAGTGCGGCATCGAGGAGTA
CGTGCTGGCCTCCTGGCCCTACGTCTACAGCTACTACAATGTGAAGTCGGCTTAAGGGGA
ATCAGAGGGCCTACGCCTCGCACCGAGCAATCTCGAGCTATGCAGAAATTAAAACAAATT
TATCTCATGCTTTAAAATTTTCCATTTGCTGCTATATGGCACTCAAAGTGAATTAGGCGC
TTCTATCTGTAATGTTTATGCTTAGAACCTAGTGACTAAAAATATTAGCTTTAAGTTGCG
CATACGCACCAAGTTAACTGCCCGCAGTACCAGGCCTGTCCCTAACCACTCTCACCCACT
AACTGGTCTCGAAGCAACACGAAACTGCCACCCAACACCGCTCCATCCCCCGAATACTGC
CACACCAATCAGAGGAACCGGAAGGACACGAACATCCAGCACCCTTGTAGCGCATGTGAT
TGATGGAAGGACGAATAAGGACGCGGAGCTAGATTCGATCGGCGAGAGTCTGTAGGATAT
GTACGAGTGCGAACTCATCGTGTATTGTAAATGGAAGCTAAGTTAACTGATTGATTGATA
GACCGATGGAAATTAGTCGGCTTATATATTTTTAATAAACGAATTACTTTACATGTTTAT
CGCTGACGAGTTTTGATTCACTGTAGTCCAGGCCACACATACAGGCGCATTGTTTTGCGA
AAACAATTTGGTCTTAACTTTATTTGTAATACATATTTATACGTAGCGCGTGGCGATTCG
TGAACCAATTCGATAATGGTATGTAAGATTTTGTTTAACAATATTTTCACATTATTTTTT
AGGGAAGGTTTGGAGATTAAATATGGTAAATTAAAAATCCTCTGGGGTAAATATACGCAT
AGCTATCATACTAAATAAATTGGGGAAATAATCAAGAATGTTTTTACTTTGCACTTACGA
TTACGATCGAAATCAAATTGACAAATCAAAAGTTGGTCGAAGGCCCACAACTTTCCTAAC
CATGGAATTTAGTTTCACACACAAGCAATTTGAATACTCTCGCAGAGCTTTGAATAAGTC
TAAACGGTCTACGAGCAAGTTGATAACTAGCTGTATAAAAACGGGCCTGGCTGATCCTCC
TGCAGGGCTTTAGTAGCGCTTGGATGCTTCCCAGGGTTATCCAAAGTGGGTGCGCTGGGC
TAATTGAGAGTTATGCCCGCAAAGGAGACCTCCAGCGACGAGTCATTGGATTCCATGCGA
CTGCGGATGTGTGCCAGCGTGTTCTTGTAATGGCTCTCGATCTGTTTGGTCTCCTCGCTG
GGCTCCAGGTTGGGCAGCTCCTCATTCACCTTGGCAATTAGCTGTAATATTGAAATTCTA
TTTAGTTAAATGGACTTTTCAATTTTCAATGAGCTATAGTAACCTGGTTGAGCATAGCCA
CAGTGATAAGCGAGTTGCCGCGTTCGAAGTAAAACAGATAGTGATTCAGCAGCTCCACAT
ACAATTGAACTTGCACTCCGGTATCCAAGCACTGCGAAGCGATGCGAGCACCCTTCTTTA
AGCAGTCCAAAGTTCGCTTCTCGTCACGCATCTCCTCGCCGTTTTGCCTGGTAGCGAATT
AAGTTATATCAGTAAAATTTCAATCAAGATTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1184, 11819..12012, 12107..13092, 13171..13853
11847..12012, 12107..13092, 13171..13311
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved