Drosophila_melanogaster Locus dom
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster dom
Drosophila_melanogaster
dom
2R
snoRNA:Me28S-A2589a, snoRNA:Psi28S-3316a, snoRNA:Psi28S-3316b, snoRNA:Psi18S-841a, snoRNA:Me28S-A2589b, snoRNA:Psi28S-3378, snoRNA:Psi28S-3316c, snoRNA:Psi18S-841b, snoRNA:Psi28S-3316d, snoRNA:Psi18S-841c, snoRNA:Psi28S-3316e, snoRNA:Psi18S-841d, snoRNA:Me28S-A2589c, snoRNA:Psi18S-1389a, snoRNA:Psi18S-1389b, snoRNA:Me28S-G2596
2775..2880, 4296..4427, 4439..4579, 4613..4756, 5820..5928, 7255..7404, 7684..7816, 7833..7970, 7991..8122, 8140..8272, 8293..8424, 8463..8600, 9130..9236, 11491..11649, 11702..11856, 12940..13013
15505
CTACGACCATGACCTGGTAGATAAGAGTTAGTTTCTCTTCTTGGATAGAATAGCACTTT
CTTACCAGACTCCGCAGATGCAGGTGATCTGCCACGTCCAGCGCGAAAATCTTGGCGATT
ATCTGCGGACCCAGATCGCCCACGACCACAAAATACGTGATGCACGTTCCAATCAGGTAG
CCAATGATGCACAGCTCCACCAGCAGCTTGCCGGAAGTACCGAAAGCATGGAGACCGAGC
ATCTCGAAGCTCCTCCTACGTGTCAGCAGCGAGGTTTTAATAAGATAGTGGCAGCAAACC
CGGGTTATTCCATTGCTTAGCACAAGAAGAACGATGGATAACAGGATGCCGCACTTCTGG
AAGCAGAACGGCATGGCCAAGATGCCGACGCCTATGATGCTGTTGGCCAACGTCATTACA
TGCGCGGAGTGGGCCAACATCTTGCCGGGAATTCAGCCTACTTTCTCTTTTATCCCGAGT
TTCGAGAACTGCGATCCGTTTTCACGTGGGCGTTTCGCCGCGTATGCAATACCGTCACAA
GCTGCGTCGAACTGATACCAACCTTCTGTCTGATACGGCGAACAGCAGTACGGCGCAAAA
TACTACTTGTTACTCCAAAATGAAGCGCTATCGACGATTGCACTTGTGTAAGCAAAATTG
TAAACAAAATAATCCGGCGACGACGACGACGGCGGCGGCGGTGAAAAAGACGTTGGCGCT
TACATTTAGTGGGCGGTTGTGGTTCAGCAAACATTTGTTCCAATTACGTGTACGTGCGTT
GCGCTGCCAGGCTGCTTGCGCATTTTTACGGCCGCAAGAAAGTTTTTAAGCAAATTGTTT
GTGTCGTCACCATTCCGTCACCGATGTTTGACAGCGTGACCAGCTTGCGTTATTTGGATT
TGGTGAACCGCGAAAGTCATGAGCCTGTGGGGACTTCGAAATGGTCACACCGATTTTTGG
CATTTCAATGCAATCCAACAGTCGCACTAATTTTGTACTCGAAATTCAACACGAGCAAAC
GTGCTCGCGGACAGTTGAAAAATTTATTAAATCTAATAAATGTGCAATTTTGCAGACCAT
CGAGTGCAGCAGATTCTCCACGACGCATTGGCACCATTTTCAAGCACGGATGCCCTGCAG
AGATGGTGAAATCTTGTGATTAAAATTCTCCCCGTCTGAGGTAGGAAATAGTGAAAAAAA
ATGTCTGCCGCGCCGAAAATTGACAAAGCGACGCCGCCATGTCGCAACCTATAGTCATCT
CCCTCTCGCAGCGTGCTCCCAGCACCACCAGTGTTCATCTATGTGTGTAGTGCATATTTC
GAGCGTTAAAATCTGTTGAAAATTTAAAACCATTCAAACAGTGGAAAATATTGTGCACAC
ATTATAGGTTTTTCACATTTCCCTTGCGGAAATCGGAAAAGCAAGCGTATGTGTGCCGAA
TGGAAAAAACCAAGACGCAGGGTTGCATTTTTCTTGATTTCGAGGGGTGCATTCTGTGTG
ATAAGCGTTTTTTTATTCTGTCTTTAAAATGATTGTAGACTTTTGTCCCGTCATGTTTGA
TAATGGATATTACGCAGCGGTAAAATTATTATTTAATGTCTGTTATTGAGTCAATGAGTT
CTGCGGTTTGGCCAGGGCTGCAGCATCGGCACATGTTCGAGGCTGGCCACGTTTTCTTTT
TCCCGCCATCCGCTGTCATTTCAAAATAACACTGTGAACTCACACCCCTTCTATTTTTTT
TTGCAGATGTCTCAAACATGAATGAAGGTAATTCAGCAGGAGGGGGGCATGAAGGGCTCA
GCCCGGCCCCTCCTGCTGTGCCAGACCGCGTAACTCCACATTCAACGGAAATTTCAGTTG
CCCCCGCCAATTCTACAAGCACAACAGTACGAGCAGCAGGATCAGTAGGAGCAGCCTTGC
CGGCCACCCGCCATCACCAACATATAGCGACCCAAGTGAAGGGAATCGCCAGCAGCAGCA
GCAAACAACAGAAGCAACTGGCCAGTGCGCAGCTGCCTGTGCCGCTGTCGCCCTTGCCGC
AACAACAACAGCAAACGGCAGAGGCAACGGCAGCAGCAGCAGCACCCGCCCACTCCAACG
TATCCGTTTCCTCCAGCACAATAGAAGCCTCTGTTTTGCCGCCGCAGGCCAAGCGTCAGC
GTTTGGACGACAACGAGGACAGGACGAGTGCCGCCAGCATTGTTGGACCAGCCGAGAGCA
GCAACATTGTAAGCTCCCTGCTACCAGCGTCGGTGGCCTCCAGCAGCGAGGTCGGCGGGC
TTTCTTCTACGGCCCTGCAGGACTTGAATGCCCTCAAGAAGCGCATACTCCAGCAGAAAT
TGCAGATCTTGCGTAATCTTAAAGAAAGGTGAGTTACTACTTTTTTATTACCAAATACCG
CTGAATAACAAATTTTCTTTTAAAAAGGCATCTTGAAAATGTGTCCGAATACTTTTACCT
ACAAAACGGCGGCAGTATGATGGACTACCCCGCGTGGCGCAAGAAGACACCAACCCCGCA
GTTCATCAGCTACAGCAATGCGAATCGTATAGATCAGCTGATACACGAAGATAAGCCAAG
CACATCAGCAGCAGCAGCTGCGGCACAGAATCAGAAATATACCACCCAACAGACAGACTC
TGTGGAGTCCTCACTAGTCAGTGGCATCGGTACTGGAGCGACAAAAGGAGCGCCATTGGA
TGGCAATATCAGCAATAGTACTGTGAAAACGGTAAGAACATAGTTTTAAAAAAGTAACAC
AAAATATAGCCATATATATATATGATGTTAACATCATACTGAGTGCCTAAATCGATCTAT
TTTTGATTGATTCTGGCTTTTAAAAGGGATGTTCGCAGCTGCGAGGCATTTGTCTGATAA
CACTTTTCTATTAATTTACTATTGAGGTTCTTTGGTATCGTACTAATTAAGATTTCTTTT
TCCCTTTAGAATACGCAATCTCAAGTTCCAAGCAAGATTGGCAGCTTCACAGAATCAACG
CCCGCAGCAACAGAAAGCAACTCAAGTACCACAGTTCCAGGAACAGCTACAAGTGGCGCC
GCAACCAGCACATCAGCTACTTCGGCCGAGGCTAGTGGTAATGTCCTGGCAGTGGAAGCA
GAAATCAAAATCCCAGCTGTTGGAGCCACACCAGTGGCCATTTCCACCAAGCTTCCCGCT
GCCGTCGTCCAGCTAACGCAACAAGGTAAACTCATCTTGTTCCCAGTCGACCCCTTTGAC
CTCTCATTGTTACGAAGACTTTTGTGTTTCTGTTGTGTTCGTTTCGATCAAACAAAATTG
TATTTTTTGTTGTTTAAAACTGTTATGTTCGTCCTCCCATATTTACGCCAAATTTAAATT
GTAAAATCGATGCAAAATCTTGACCACTGCATACCATCTCCTGTAATTCCGAAAGTGATA
CTAAAACAACGCCAACTTGCCAACGCACGTTCTGCACTAAAGATACCGATATTATATTGT
GGCCGCCAACTATTGTGCATTACTAATACATAATACAACAAAAGCAAACTAAACTCGCAA
AAAGCCAAGATTATTTTGTTAGTTTACCACAAACATACACACACCTACTAAAACACAAGC
ATAACTACATAACCAACTCTATCACGTACTGCTATTTATTATTTACACTTTATTTATTTT
TCCGATTTCTGTTCCCACATTAATGCTGCCTACATTCTCCTATAACGCACACACTCAACT
CACCATAATTGTATCGTTATAATATAGGTCACATACCCGGTAGACCTTTAGGAGGTCGTC
ACGGTATGGTCTTCGGTCAAATACCCGCTCCTCCTGCTGCCGTAGGAAATCCTTCTGTAC
CTTTGGTGCCAGGTGCTTATCGTTCGCAAACAACAAACAAAAAAATATCAAAAATCTTTC
ACAGCTAAAATTCTTTTTGTTTTTATTTAAATTCTTACTTAAACCAGATTGTGTCTTAAC
CATTAAAGCATTTTATCATTTCTCAAGCAAAGTAGTGCATTGATTGATGTGCATAAAGAT
TATATTTTCAATTTGTAAATTGTTTTCTAGAATTGGTGTTTTGCCCTTAGTTTGGATTGG
TAAATCTGCTTAATAATTTCAGTTTGAATTGATAAATAATTGATGAATGTATCGTTTAAT
TGATTGCGTTGATTTGTAAGCAAGTTAGCAAACTTAAGCATACTTAGTAAAATAGAGAAC
GCGCCGAACTATAGGACTTACCACACCGATTGGGCTCTCATTATCATCCCCTCTTTCATC
CACTTGAAATATCATTAGTACTAGACTAGTTTTATGTCGCACCTAAAAGCGTTTTCTCGT
CGGCTCGTTAAATGCTCTTGAAAATCGTAGATGTGTGCCAGAGCGAAGCTCAGTTGCAAG
TGATACGGCCATTTTTTGTGGCAGATATCCATAACGCTGACTACAAGTGATCTCGGCGGA
CGCACCTAAAAGCGTTTTCTTGCCAGCCCGTTAAGTGCTCTCGAAAATCGTAGATGTGTG
CCAGAGCAATCGTCGCAGTTGCAAGTGATCTAGATCCGTGACAGAATCAGATCCAATTAA
AGCTGGGCTCATTTATATATTAGTATCTAAACTTACAAATCGGCCGGTACACGGGCAAGC
GCACTCTGTGTCACATCGATATATCCAGCCTCATGTGATGACAATTTGTAAGCTTGCTAG
AATAAGGGGGAGCTTCGCTTATCCATGCGGCAACTATCTTCAGCCCAGATGCCGCATTGA
ATTCGGGCCTCACATTAAGACTAAGTTTGCATGCATTTCCCACCTCTTTCGTTTAGCAAC
CGATTCGCAAATGATTCTTATTCTAACTCTTCTATTTCATTCATTCACTATTGCTTTCCT
CGTAGCTCTTTTGTACTTGATGCACTTTCCAGCATGCCAAGAGTTGACCTTTTTCCGCTG
TCCCTTGAGTAAATGATATCTTTTCTAATCTATCCCTTTTTGACTTATTTTCTAAGGTGG
CACCCCTTTATTGCCCTGCAATACATCCGCCGGGTCCACGGCGCTTCGTCGTCCCCAAGG
TCAGAACAATGCCTCAAGCGGATCCGCCGCGGCATCTGGAGGCGGAGGAAGCCTCACACC
CACACCGCTCTACACTGGCAATGGCCCGGCCGCTCTGGGCGGTAGCGGAGGACTCACGCC
TGGCACTCCAACTTCTGGCAGTCTGCTCAGCCCTGCCTTGGGCGGTGGCTCCGGAACGCC
CAACAGTGCGGCGCAGGAGTTCTCTTTTAAGGCCAAGCAAGAGGTGTATGTGATGCAGCG
TATATCGGAACTACAGAGAGAGGGATTATGGACTGAGCGGCGCCTGCCCAAGCTGCAGGA
GCCCAGCCGCCCCAAGGCGCATTGGGACTATCTTCTCGAGGAGATGGTCTGGCTGGCGGC
AGATTTTGCACAGGAACGCAAGTGGAAGAAAAACGCGGCCAAGAAGTGTGCCAAGATGGT
GCAGAAGTATTTCCAGGACAAGGCCACCGCTGCCCAGCGGGCGGAAAAGGCCCAAGAGCT
GCAGCTAAAGCGTGTCGCTTCCTTTATTGCACGCGAGGTGAAGAGCTTTTGGTCGAATGT
TGAGAAGCTGGTCGAGTACAAGCACCAAACTAAGATCGAGGAAAAACGCAAGCAGGCTTT
AGACCAACACCTCAGCTTTATTGTAGACCAGACAGAAAAGTTCTCACAGCAATTGGTAGA
GGGAATGAACAAGAGTGTGGCGGATACGCCCAGTCTTAATTCTAGCCGTCTAACATCGCC
GAAACGGGAGTCCGATGGTGAGTTATACCTTAACTTATTATATCAGTCGATTACCAGAAC
TGAGCACTTGATGATAAACTACAAACTGAAACGTTGTTGTGGTCTATTTTTGAACACTTC
GATGTTACCTTGGGATGGTCGCACTTGCGAGGCATTTGCCTGATGCTTATGCGCATAAGT
TCCATGTGTACTTCTAGCTTTAAATAATTGCTAATGAAAACATCATCCACTTTACAGATG
ACTTTCGCCCTGAGTCTGGTTCAGAAGATGATGAGGAGACTATCGCCAAGGCCGAAGAAG
ATGCAGCCGATGTGAAAGAGGAGGTGACGGCGCTAGCTAAGGAATCTGAAATGGACTTTG
ATGACTTCCTTAATGATCTACCACCTGGCTATCTGGAAAATCGTGATAAGCTTATGAAAG
AGGAGCAGAGCTCGGCGATAAAGACCGAAACGCCTGATGACAGCGATGATAGTGAGTTCG
AGGCGAAGGAAGCCAGCGACGATGACGAAAATACCATCAGCAAGCAGGAAGAAGCCGAGC
AGGAGATAGACCACAAAAAGGAGATCGATGAACTGGAGGCAGACAATGATCTCTCAGTGG
AGCAGTTGTTGGCGAAATACAAGTCTGAACAACCTCCTAGTCCCAAGCGACGAAAGTTAG
CGCCGCGTGATCCTGAGCTGGACTCTGATGATGATTCGACGGCAGTTGATTCCACCGAAG
AAAGCGAAGATGCGGCCACCGAGGATGAAGAAGATCTCTCTACTGTTAAAACTGATACGG
ATATGGAGGAACAGGATGAACAGGAGGACGGTCTTAAGAGTCTAATGGCGGACGCTGATG
CAACAAGTGGTGCTGCTGGCAGCGGAAGCACGGCTGGGGCAAGCGGCAACAAGGATGATA
TGCTGAACGACGCTGCCGCCCTGGCCGAGAGCCTCCAGCCCAAGGGTAATACCTTGTCCT
CAACCAATGTGGTTACTCCTGTGCCCTTCCTGCTAAAGCACTCCTTGCGTGAGTACCAGC
ACATCGGGCTCGATTGGCTGGTCACAATGAATGAGCGCAAGTTAAACGGCATCTTGGCCG
ACGAGATGGGTCTGGGCAAGACCATCCAGACCATTGCGCTATTGGCCCACCTTGCCTGCG
CAAAGGGCAACTGGGGACCTCATCTCATTGTGGTGCCTTCGTCTGTGATGCTCAATTGGG
AAATGGAGTTCAAGAAGTGGTGCCCCGGCTTTAAAATACTCACCTACTACGGCTCCCAGA
AGGAGCGCAAGCTAAAACGCGTAGGTTGGACCAAGCCAAATGCGTTCCATGTGTGTATCA
CGTCCTACAAGCTGGTGGTGCAAGATCAACAAAGCTTCCGCCGCAAAAAGTGGAAGTATC
TCATCCTGGATGAAGCGCAGAACATTAAGAACTTTAAGTCCCAGCGCTGGCAGTTGCTAC
TTAACTTTTCCACAGAGAGGTGAGTAATGATTGCATATGCTGCTAAGCTTGCCAGTCAGC
ACCAAAAATCAGTAATCATGCGATTGCTAAACTAGCATGGCGACTACGCTTGGGTGCTAA
AAGTAAATTCGCTATAATGCCGCATACTAAACCAGAGCATGCTAATCTAGCCCTAGAATG
CTTGTGGCCTTGTTTCGAGACAAATAACAAATACGCCTTTTACACGAATGAATTTATAAA
GTACTCTTAACTTTCTACAGGCGTCTGTTATTAACTGGAACCCCACTACAGAACGATCTG
ATGGAGCTGTGGTCCCTGATGCACTTCCTTATGCCATATGTGTTCTCATCGCACCGCGAG
TTTAAGGAATGGTTCTCGAACCCAATGACTGGCATGATTGAGGGCAACATGGAGTACAAC
GAGACTTTAATTACTCGTCTGCACAAGGTAAGCATATCATTAAGATATAAATGTTTATTT
TTTTCAGCACCTAAAAGCGTTTTCTTATCAGCTTGATAAATGCTCTTGAAAATCGTAGAT
GTGTGCAATAGCAATATCTACAATAGCTTGGGATTCAGTTTCTATATAACTTCAATCCGT
TCAGATTGTAAACATCCATTATAAGTCTTACAATGCAAATGCACTCTGTGTCACATTGAA
TTTACCTACATGTGAAGACAATTTGTTAGTTTGCTATATGAAAGAGATGTGACTTATCCA
TGCAATTAGTGCCGTAAAAGGTTGATTGCATTGAAATCGCATTTTACACTATCGAAAATT
AATTATGACAGGTGCACCTAAAAGCGTTTCCTTGCAAGCCCGTTAACTGCTCTTGGAAAT
CGTAGATGTGTGCAAAATCAATCCTCACAATAGCAAGTGATTTTAGTTCCTCTAACTCAA
ATCCATTTACATTGTGAACATACGTCCTCAGGAATTCTTAGGCAAATGCACTCTGTGTCA
CATTGAATTGAATGTGAAGACAATTTGTTAGTTTGCAATATTAAAGAGTTGCGTATTATC
CATGTATTTAAAGCCGTATCAGGGTGATTACATTGAAATCGCATTTTACACTATTATTAA
TCAATTATTTTCATTGCACCTAAAAGCGTTTTCTTGTCAGCCTGATAAATGCTCTTGAAA
ATCGTAGATGTGTGCAAAATCAATCCTCACAATAGCAAGTGATTTTAGTTCCCTTAACTC
TAATCCGTTTACATTGTGAACAGTCGATCCATAAGTAAAATGTTCATGTTTTGTTCCTAC
TTTTGCAAATGCACTCTGTGTCACATTAAAACTAGCTTCGTGTGATGACAATTTGTTAGT
TTGCCAGATCAAGGAGATGCGTCTTATCCATGTGGCTGAGTTCTTACCAATTTATTCACA
TTGAAAACGCCCCTAACATGACCCTCTTATTTAAGTTATCCTTATTTTCAAAATAAATGC
GCAGTAATTAGAATTTGGCTTTTGTTTCTCCGTACAGGTGATTCGTCCGTTCCTACTTCG
ACGCCTCAAAAAGGAGGTGGAAAAACAGATGCCCAAGAAGTACGAGCATGTTATAACGTG
TCGTCTGTCGAATCGCCAGCGCTATTTATATGAGGACTTCATGAGCCGCGCCAAGTAAGT
TTGGATTTGCTGACTACCGACGAATGTATTACTGATCATTTAAGTTTTTTTTTTTTTTTT
TTTTTTAACAGAACTCGTGAGACTCTGCAAACGGGAAACTTGTTGAGCGTGATAAATGTA
CTGATGCAGTTGCGAAAAGTGTGCAATCATCCGAACATGTTTGAAGCGCGTCCTACGATC
TCGCCATTTCAAATGGACGGAATTACATTCCACACTCCGCGACTCGTCTGCGATATAATG
GAATATGATCCGTTCACGGTGAGTCTTATTTCTACCTTCTTTATTGCCAATTTTTTTTCT
TGATTGTGGTTTGAAAATGATGTTAAACTGTCACTGATAGTTGGACTTAATCTATTTTGG
AGAGAGTCGTAAACTTTTCCTAGGATGTTCGCATTTGCGAGGCATTTGTCTGATTCGCTT
AGGCAATAAAATACGTATTAGGTTATAGCCAATTAAAATTTGTACTAATTTATGTATATT
CTTACAGCAAATAAATCTAGAGACGTTAAACCTCTTGCTGTTGCATTTGGAGCAAACTAT
GACCGCCTACGTCTCGCACAAATCCCGCCTGCTCGCCCCGCCTCGCAAGCTGATCGAGGA
TATCGATACGGCTCCATTGCCAGCTCCCCGTTGTCCAAATGGCAAATACCGCTTTCATAT
CCGAGTTCGTAGCGCTGAACTGGCGCAGCGCATCAAATTGAATGCTGTGAAGGTAGGAGC
AAGTCCAGCCATGCGGTTGGAGGGTTCAAAGATTATGCCAATGCGCAATTTGCTACCAAG
TGGAAGAGTGCTGAAAAGGGTCAGTGCTTCGATCAACCCTGTGAATATGGCTTTGAAACC
AGTGGTGATCAATAGTGTGGTGACAACAACATCATCATCGACCACAGCATCTTCTCCTAC
TGGAGCTTTAAGCGTGCTGAGCAACTCCAAGTTGCTGGGTGCACGTTCACAAATTAATGC
TCCAACGCCCGCTAAAGTAGCGAAAACGATGCAAGACGGAAAACCATTTTTCTACCTCAC
ACCGGCGACGAATTCAGGAGCAGCAGGAGCGCGTCTTACCCTGACAAGCAAAACCACAGC
CTCGGCGTCCACGACGACCTCCAGAACAACAGTTACAGCATCAACTACTTCTGGTCAGCA
ACTAATAAGGGATCCCATTGTCAAAGATTTGGCCACTCATGTAAAAAGCACAGTACAAAA
GCAAAGCATTGCCAATGGGAAGACGGAGCCCGAGGAAGAAACTGAAGCAGAGGATCCCTA
CAAAGTACAGGAGCTGATTCAGATGCGCAAGGAGCAGCGATTGGCAGCGCTTAAACGTAT
GGCAATGATAAATCGTCGCCGAACGGATGCCACTCCCATATACGGCGAAGATTGTCGCGA
GGCTATACAGCGCTGCATGCAGGCGACCCGATCCCTAAAGCGATCAACCTGGCAGACGCG
TGGATACGCCAACTGCTGCACTGCCATGGCGCATCGGAACGGTTGGTCCCTAAACCACTT
GCTGAAGAGCTTCGAGGAAAGGTGCGCTGATCTAAAGCCAGTGTTTGCCAACTTTGTGAT
CTACGTTCCTTCTGTTTGTGCGCCCCGGATCCGTCGTTATGTACAAAATCTCTCATCGAC
GCACTGGCAGCACGAACAAAGGATTGAAAACATTGTGGATCAGGCCCTGCGGCCTAAGCT
GGCGTTGCTGCATCCAATCATTTCGGAAATGACCACTAAGTTCCCAGATCCGCGTCTCAT
CCAATACGACTGTGGCAAGTTGCAGACCATGGATCGTTTGCTACGCCAGCTAAAGGTTAA
CGGGCATCGTGTACTGATATTCACTCAGATGACCAAGATGTTGGATGTTTTGGAAGCTTT
TCTCAACTACCACGGTCATATTTATCTGCGTTTAGATGGCTCTACTCGGGTGGAACAGCG
GCAGATCCTGATGGAGCGGTTTAATGGAGATAAACGAATCTTCTGCTTCATCCTCTCCAC
GCGGTCTGGTGGAGTGGGCATCAATTTGACGGGTGCCGATACTGTGATCTTTTACGACTC
CGACTGGAACCCCACAATGGATGCGCAGGCCCAAGATCGTTGCCATCGTATTGGTCAAAC
GCGAGATGTACATATCTACCGTCTTGTCTCCGAAAGAACCATAGAGGTTAACATTCTTAA
GAAGGCAAACCAAAAGCGAATGCTGAGCGACATGGCCATCGAGGGTGGCAACTTTACAAC
TACGTACTTTAAGAGTTCCACCATAAAGGATCTCTTTACAATGGAGCAGAGCGAGCAGGA
CGAGTCGAGCCAAGAGAAGTCGGAAAACAAGGATAGAATTGTTGCTACAACAACGCTTTC
AGATACGCCTTCGACGGTTGTGGAGACGGAGAAGCAGTCACTGCGTGCATTTGAGCACGC
GTTGGCTGCCGCCGAGGACGAGCAGGATGTGCAGGCCACGAAAACGGCTAAAGCCGAAGT
GGCAGCTGATCTGGCCGAGTTCGACGAGAACATTCCTATTGCAACAGAAGATCCAAATGC
GGAAGGAGGTCCTCAAGTGGAACTCAGCAAGGCCGATCTGGAGATGCAGAACTTGGTTAA
ACAGGTGAGCTAGTTTTCAATAAGAGAATCAGATAATTAGATGGTTTAGTATTATAATTG
TTACCAACAATTTAATACCAGTTTAGAAATAGTTGCCGTTCTTGCACTTTATACTGAAAC
CCTGCATTTAAAGAGATTCCGGCTAAGCGAGTGTGGCACAGAGAAAATCTTCCTTTGGAA
AGTAGACTTTCAGACATAGTTGAGGCGACATAACCCACGCCACGATTGTATCACTCAAAG
TCTAATATCTGAAAAATCTTCGATCATACTATTTTTTTTACAACGCCAAACTAGTTTTTA
TTGCGGCATCGCTTGCAACTCATTGAATTCGTTTTTCTAATCGAATAAAATGAAGTGAGT
GTTGCCAAGAGCAATACACCTTTTCGTATGAGGCTTTCAGACATAGTTGAGGCGACATAA
TCCACGCCACGATTGTATCACTCAAAGTCTTACAATTTTTAACTTAGTGCAGTGCTGTAG
AATTTCTTCAAATTGAACATATAAATATTTCCCGATCTTATTTCTATTCAGCTCTCACCG
ATAGAGCGATATGCCATGCGCTTTGTGGAAGAAACTGGAGCAGCATGGACGGCGGAACAA
TTGCGAGCCGCGGAAGCGGAGCTGGAGGCCCAGAAACGCGAGTGGGAGGCCAATCGCTTG
GCGGCCATGCACAAGGAGGAGGAGCTGTTGAAGCAAGAAACGGAAGCGGAGGAGATGCTT
ACCTACAGTCGCAAGGATTCGAGTAATCAGGTTAATACCAAAACAGATTCCAATTCCAAT
AAGCGACGACTGGTGAGGGAAAATCGCAGAAACTCAGCTCAGAAGCTGAGCAGGAGTGTT
AGCAGCCATAGCACCGGTAGCAACAACAAGAACAGTAAATCGGCAACGACCCGTGGAAAT
AGCCAGAACAGCCTCAATCAGACTGTACCAGTGGGGTCAGGAATAAGCAGGGTGAATAGA
ACGGGGGCGGGGGTCAGTAGCAGTAGCCGAGGCAAAAGTAACAGCACGAAGTCAACGGGG
AAGGGAACAGACGCCGCACCGCAAGTTCGGCGGCAGACCCGTCTCCACTCTCTGGGCGCA
GTCAATATGGCCAGCGCCCGAACACCGCCCACTAGAAAGACAACACGTACAGCTCTGGCT
GCATCTGCAGCTGCATCTACTTTAGAGGATGCCTCTTTGATCGTCGAGGAGCGTCCCAAA
AGACAGTCGGCCAACATAGCTATGAGCAAGATGATGAAGACGCCCTTCAAACAGAATGTT
CCATCCAACATCAGTATAAAGACAACTCCTCCTAAAAGGGGGCGAAGAGACAGTGTTGCA
GCTGCCGCCACACGCAGTAAACTGCTGGAAAGAAGAGCTACAATTGCTGCTCCTTTAAAA
CATATGGATGATGAAAGTGACCAGGATGAAGAGGAGCAGGAAGAGCAGGAGTCTGAAGAA
GATACCGAGGGCGAGGAAGCAAATGCCACAGTAGACGACGACGAGGAGGGGGAGGAGGAG
TTGGCGTCACTTGACGAAGAGACCATACAAACCGGATCGCAAACAAATGATGAAGAAGAC
GATGACGAGGAAGAAGTTGGTGAAGAGGGAATGGTTGATATTGATACTGAAGATTCAGAG
GCAGATGTCAAATCCAGCTCCACCTATGGTACAGCGGCAGATGGTAAGCCCGAAGAAGCC
GAAAGCTTGGATGGCTGGGATGCACACGACCAGGTGCAGGACACCACAATGACTAGCTCC
ACCTACTACAATGTCAGCGAGGAATCAGACACGGATGAGCATCACGATAGCAAGGCGGAG
GCTAAAGAGCCGCCGCAAAATTCCGATAAGAGCGACGAGAGCGAGGCTGTTGGACACACA
CCACGTACAAGGTCGCGCGGCACAGTAAAGATCAATCTGTGGACCCTGGACGTGAGTCCC
GTAGCAAACGCATTGAATAAAAGCAGCGCCAATAGGAGCCTCAAAAAAGCACCAAGGACT
GAGTCCACGCCAAAGGAGTCTCAGAGCGAGCCAAGGCGAAAGATTACTCAGCCAAAGCTG
CCGAAGAAAGAAGAAACTAACAACAAATCTAACAGCAATATCGGCACCTTACACCGCTGG
ATATCGAAGTCCCCCCGAGTAATGCTTCGATCCACACCTGTTACGGCAGCGAGCGCTAGC
TCATCAGCAGCAGTCAGTGGTGTTTCGGGAGGAAATGCCTCCTCGAGCGGAACAGCCAGG
TGATGATGTTCACTATCATACCTCAGTCAGTATTATCAGCTGTGTGTGTTGTGTGCGTTT
TAGTGGGCGACTAATTATCTGTGGGGAGACGGGTCCTTCCCCGGCTGTTACTGCTGCCAG
GCGACTGATGCATAATGAGTATTTATAGACTGTAACAAGTTTCCTTCTATCGTATGAGAT
AAGTTAGTTAGGCGCCGGAACCCACGCTAGAATCTAGAATAACAAATTAAACTTCATTTG
GTCAAACATCTTGACCTATAACATCTTGACAAAATGCGTTATTTGCCATTCGTCTGTGCA
ACCAATGGCTTCCTTTGTAGCCTCTTATGTTTTGAAAAACAAAGGGATCAGATGTCCTAA
TTTTTCATAGAATTAAAATAACCCAGAAAAGTGGTAGGAAAGAAATCCATTCCTAAGGCG
TATCCATTCCTGTCGCTTCGGGAAAGATTAGGATGAACTCAACATTCAGGGAACAAAAAC
GGACGACTTGTCATAAGTTAAAAAGTGAAATGAAGCGGGAAGGTAAACGGGAAGTCAAAT
AATATTGCACGATTGTATAATGCGTATAGCAAATTTTACTCTAAATTACCACATCCTCGA
TTGTTGTTGTTAAATAATGTTTGTCAAAAAACCAATCGAGACCACAGATCAAACTCCTTT
CCCAAAAACTGCATTAGATCTTAAGAATAGGTATACTATGATAATTGTTAAACATTTTTG
CATTCTATAATTTATTTTGTACTCTAACCTAAATGGAACATTAACAATCTAAAGACTATG
AGCATAGATTGACTAACCAATAAGACACAGAACTCATTTCGTATGCTTTAAAAAGTATCA
AAATCCATTTATTGTGTAACATAACAAGATAAAACGAAACGTATAAAAACAGAAACAAAG
CTAAAAATTAAACAAAACTAAATGACGTTGTGGTTTTTATTTACGGACTAATTTCGTGCG
TTGCCTCAAAGAAAAGAAAAAAATCTTCCGTCCTCATGAAACCAAGTTGGAAAAGAATAT
TTGGATATCGTCCATAGATTGTTAAATATTATTTTCTATAAACAAATGTAGAATTCTGTT
TTGGTGTCGCAATTAGTATCCAATTATCACTATTAATCCCCTCCCATGTCTATAAACTTA
TTGTTTAAACCCCTAAGCGCCGTACGAAAGTATAAAAATGGTTCGGAATGAAAGCTACAA
CGCCATCAGTATGATAATTTTAAAGTCAGCTAATATCGATAGCAATACGTTGAATCGCAA
AATAGTTTCTAAGCAAACACCAAAACAGAGTTGCTATATCATGAAAATAATGTGGAACCG
TCTATTCTTTTCTTTAACTTTCTTGGCTACCATCATCTGGTCCAGGTCTGGATATCGCGC
AACACCATGGAACAGATGCCGGTAAGTTCAAGTGGTAGTGCTTGGTTCATAGTGCTAATT
ATTTGTGATCCCCCTTGATTAGATGTGGTGTCCTCCCACGCCGCCGCAAGACAACGATAA
CGATATCTATATTGACTATTCGCTATCGTTCATGTATGAGCTGGAACCGATTGCGGAGAC
GGATCTGCCGCCAGTTTACGTACGCAAGGAGCACAAGCGCTCGCGCACGGATGCTGGGTA
CGATGGTAGCAGACGGCCCAATAAGATGCGCCGGGAGGATAACTACGTACCACCCAGATC
GCTTTTCGATCGCCCAACGCCACAGCTGGCGCGACTGCGTCGGGAGCTGAAGAGCCAGCG
ATTCCGCGGAAGCTTTAAGCCTAATATGCCGATTCCAGGCCTTAAACCACAACTTCCCAC
CAAACCTCTTACCGAACCTGAGGCCATGGCTGAGTGGTGTGTCTTCGAGGATATGGCCAT
TTTGCACGTCCTGGTAAATCTGCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1179, 1746..2367, 2427..2730, 2949..3204, 4976..5776, 5997..7218, 7460..7646, 8677..8813, 8891..9077, 9307..11403, 11931..14505
1757..2367, 2427..2730, 2949..3204, 4976..5776, 5997..7218, 7460..7646, 8677..8813, 8891..9077, 9307..11403, 11931..13619
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved