Drosophila_melanogaster Locus Act57B
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Act57B
Drosophila_melanogaster
Act57B
2R
snoRNA:660
2943..3038
4384
GAACCCAATTTAAATGGGTACCCTGCAAAGCCGGCATGTAACGGTTAAGCTCCCCCCTC
CCATCCCCCTTACTAACATCTTACAGCCCGATTTGTAAATAAACAATTAGTTGAATATAA
TGCTCATTGCACGAGGGGCGTAGACATGGGCGTGGGCGTGGATCTTGGGCGAGAGCGCAA
TGAGAAATATGACCAAAATTAGAAACGAAAGGCATGAAGGTGCAAAGGCTGGGAAATGAT
AGAGATGCGATTTGACTAAGGCTGTGCGTTTGTGTGTGTGTACATATCGAAAATAGAAAA
TGAATTTATTACGACATGAGAAAAACACGAAAGTTATGAAAACAACGAGCCGTACGAGAA
AATAGAAGCCAGCAACAAAGCGAATATATCCACCCACCCAATCCCCCACCGTAACGAACC
GACCCAAAAAGTATCCAAACCGAACCGAAACATATAGCAAATATAGCAGATATAGCAGAT
ATAGCCGATATGGCCGATATAGTGGGAGAACAGGAGAGAGAGAGAGAGCGACTCGCTGAG
AATGAGCAAACGAGTGTGAGTGTGCTGGAGGCGCCTCCTTGCCTTATACGGCACTTTTTG
AGACTGCAAACGATCGTGAGCAGGCAGCCGATCGTGCCCGATCCCAACCGATACGATCTC
CACGCTCGATCACGCCGAACTATACTGCGCTATATGCTATATGGTATTCCTATACGTATA
GCATGCCATACCATATTGTGCCTCTCGCTCGTTCGCCTTATGTTTTCCAAAGAGCCCCCT
ATGCTGAAGGATCTATTTTTAGGCGGATCGGCCGGTGGGCAGCATTATCGCATCCATGAG
CATATTTCCTCGCTGTGTGTATTCGTTTGAGTATTTCTTTTGCCATTGGTATGGGGGCGT
GGCGGGGGCGGTGGCGGCGGGGGGCATGGCGACGGCGCTTCTTGGACGAGATGGCATTTC
GGCGGCGGTATAAAATCCGAGTACCAACGCGGCGATACTTTAGTCAGTCAGTTGTGTTCC
AAGCCGTACACACCGTAACTCTTGATTTAATTCACCCGTGGTGCCGTAAAAAAAACAAAA
CTAAAACAAAATGTGTGACGATGAAGTTGCTGCTCTGGTCGTTGACAATGGTGCGTATTC
CCCATCGAACGGATTATCGTCTTGGCTTTTGCTAAAAGAGAAAAAAAAGAAAGAGAAATA
GACAAAGGACCCAACAGCGAAAGGATATTCCCGCATCTAGTGCTAAAGTGATCGCAAAGT
GAACGATTTTCGAGTTGTGATTAACTCACGCATCCTTCGGGACACAAGCAATTAGAAATT
TGAATATAACAAAAAAAATATTCCAATGCCTTGGATGATTTCGAGAAATATATATTTTAA
ATATTAGTTATTGAGCAATATTTTCAATTCAAGTCAAAGAATCATAAATATTCAGATAAA
GAAAAGCTAAAATATTATATTTTGCACAGAATCAAAACCGATTTGCATAAGTTTTATAAA
GATTTTTTGTGCCCGAATCACTTTCATAAGTTTTGATGCTTGAAAGCTTTTCAAGAGATC
ATGATATTAGAGAAGAGGAATATTTCAGAAATCATATATCTTCAGATATTTCTCTATACG
AGAGAAGAAGACAGATCACATATTTTCATGAGAGAATTTTTCTCTCCGCCCCAAACTTTT
CCAGTTTTTTCGACTTAGTCGCCAGACTTTTTCACGCTGTCCGTTAGAGCAAATGTTAGA
CTCCCAGTGTGGGAAACCCCACATGAAGCACTCGAGCGCCCACTAATGGACCCCTGTTCG
ATTGTGTTATCCTGCAGGCTCCGGCATGTGCAAGGCCGGTTTCGCCGGTGATGACGCTCC
CCGTGCCGTCTTCCCCTCCATCGTCGGTCGTCCACGCCACCAGGGTGTGATGGTCGGTAT
GGGCCAGAAGGACTCGTACGTCGGTGATGAGGCCCAGTCCAAGCGTGGTATCCTCACCCT
GAAATACCCCATCGAGCACGGTATCATCACCAACTGGGATGATATGGAGAAGATCTGGCA
CCACACCTTCTACAACGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTGACTGA
GGCCCCCCTGAACCCCAAGGCTAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCTT
CAACTCGCCCGCCATGTACGTCGCCATCCAGGCCGTGCTCTCCCTGTACGCCTCCGGTCG
TACCACCGGTATCGTTCTGGACTCCGGTGATGGTGTCTCCCACACCGTCCCCATCTATGA
GGGTTATGCTCTGCCCCATGCCATCCTCCGTCTGGATCTGGCTGGTCGCGATTTGACCGA
CTACCTGATGAAGATCCTGACCGAGCGCGGCTACTCTTTCACCACCACCGCTGAGCGTGA
AATTGTCCGTGACATCAAGGAGAAGTTGTGCTATGTTGCCCTGGACTTCGAGCAGGAGAT
GGCCACCGCCGCCGCCTCCACCTCCCTGGAGAAGTCGTACGAGCTTCCCGACGGACAGGT
GATCACCATCGGCAACGAGCGTTTCCGTTGCCCCGAGTCCCTGTTCCAGCCTTCCTTCCT
GGGAATGGAATCCTGCGGCATCCACGAGACCGTCTACAACTCCATCATGAAGTGCGATGT
GGATATCCGTAAGGACCTGTACGCCAACATCGTCATGTCCGGTGGCACCACCATGTACCC
CGGTATTGCCGATCGTATGCAGAAGGAGATCACCTCCCTGGCCCCATCCACCATCAAGAT
CAAGATCATTGCTCCCCCAGAGCGCAAATACTCCGTCTGGATCGGTGGCTCCATCCTGGC
CTCTCTGTCCACCTTCCAGCAGATGTGGATCTCCAAGGAGGAGTACGACGAGTCCGGCCC
TGGCATCGTCCACCGCAAGTGCTTCTAAGCAGTTGCAGTTGCCTAGCACCAACACTAGCA
CCACCCGGTCTACTCACCTGTCTCCTGCTCATCTGGTCCTGCTATTTGTGGTGGTTCTGG
GTGTGTGGGCGGCTGGTGCTCCACCGGCAAAAACAACAAACACCACCACCATCCAACCAT
TTGTTTTTGAATGTCATTATTTACCAACGTGTCATCCTTGGTTCGAGAATACTCTTTTGT
ACTGACTGAACACAACACCATCAATCAAAATGAATTGTCAATCTAATGCCACGGACCGCG
ATCCCCATCCACTTGTTAATCGCTCGCGGTTTCCTTAAATGTTGATCGCCATTTGATTGT
TTTACGAATGAACCGACACCCTCATGTATTTTGTACAGAACCTAACAACTTCCCCGATAG
AGCGGATGGGGTCTATTGACTACGAAATGTAAAATAATCTCATGATTGTAATATTAATTA
AAACAATTTATAATTATTTATAAATAAAAACGATTTTTTAGATTTAATTTTTTCTAAAAA
CATAGAGATTTTGGAAAAAATTGGGGGGGGGCATCTAGCCGGGAAAGCAAATCCTAGCCG
AAGCTTTCCATCGATCAGTAGTTCAAGATACATACAATATATATGTACATTTATGGATCT
ATGTGTGATGTGTGAGCTTTTTTCACCTCCAGACGCGACGGTGCGTTTCAAATTTCCCGA
ATACCATACCGTAAAGCTTTCTATTCCCAAAATATTTCTGGTTTCGAAACGATTTTCGAA
TATTTTTAGACGCATTCCAAAATGGGTGAGGCGGCGGACAGGCGAGCGATTTTTTGTTTG
TTTATGCCATGAGGAAATACGATCGGAGATGACGCAAGTCGGATGGATGATCAAAGGCGG
CGGCCAAAACAAATTGCCAATGTCAATTTGTTGCCGCTCTCGGCAAACTGATTACCAGAA
ATGCATTTCACTTTGAGGAATAATGGATGGAATATATACATATATAGTGTATGGTGGCAA
TGCCAGAGACAAATGTTCTCGCCGAGATTGCCAAGACAATTAGTCAAAATGGCGTTGGGC
CGTTTAATTAGAACTCGATGTGCATTATGAATGAAATTTGTATTCGCGGTCGTGTCGCCT
GTTGCAATTTCAGTTGCAGCCACATACAAATGGGTAATTAATGGGCCCAAATCGCTGGCA
CTTGGCCAAAAAGGGGCGACAGATGCCGCTAATGAGTTGCACGACGAGATGGGCAAAAAT
GGGCGCAACTTGCCCGTTCGGAATTCACTTTCTCAAGCGAATCACTTTACGCCGCGCTGC
ACAACAACAAACAGGATTGGGAATCAGAAATCGGGAAACAGAAATCCCAAATCCGAAATC
AGGAAACAAATGCCGGAATGAGAAGTTACCAACCCTCGACTTAAACGGGCTTAACCCACT
AATCAATTTGCACAAAAACAAAAATAAACACGTACACAATATCGTCGACGTCGTCGTCAT
AATGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..3384
1090..1197
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved