Drosophila_melanogaster Locus RpL11
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL11
Drosophila_melanogaster
RpL11
2R
snoRNA:Psi28S-2444
1779..1908
3171
TTGGTTACATGAACACTCCGTCGCCATCGACTTATTCACCGAATACTCCTGGTGGCATA
CCGCAGTCGCCGTACAATCCGCAGACCCCTGGAGCCAGTCTGGACTCGTCGATGGGCGAC
TGGTGTACCACAGACATTGAAGTTCGGATTCACACGCACGACGACACCGATCTCGTTGGG
CAAACGGGCATCATTCGCACCGTTTCGAACGGCGTCTGCTCCGTATTCCTGCGCCAGGAG
GATCGCAGTGTGTCCATCGTTAGTGAGCACTTGGCGCCAGTGCTACCATGCAATGGCGAC
GAATTCAAGATCATCTACGGCGATGACCGCGAGTCCGTGGGCAGAGTGCTGTCCAAGGAT
GGCGATGTGTTCGTCTGCAGGATTAACGAGGAAATCAAGCTGCTACCGATTAACTTCCTC
TGCAAGATGAAGTCCATCGACTAAGCTCTACATACGAATTGATGCTACACACTTTAAAGT
TGACGGACTTCTTCAATGGAATACACATTATTGCTAAAATTAATAATTCAAATAAACTAT
TATGGACGTTTACTTCGAGTTTTTCAATTGATATCACTGGAAGTGCCTTTTTTTATTAAT
TTTGGCGCATTACTTAAACGATGTGTTTAATGCGAAATGAAGTTAATTAAGCGGGCCGTA
TTTCAAATAAATTTTTATTCTAAAAGGATTTTTCGTTACATGCGAATAACGCCAAGTAAA
CAAATATCAAATCAAGCTACCTCAAAGTAATTTAAACATCCGTGCAATCAAATAATCACA
ATTATCGGCCATATTTGCTGTTCAGCATTTAAAATAATTGAATAAACCAATTTCAGTGGT
TAACATTTTAAGGAATACCCCATTTATTTACCGTTAGCCCTGTTAACCGTTAGTGATGGA
ACGACGTGCGCACAACAGCACGATAGTTGGATAACAGCACGACAACAGCACGTGTCGTGC
GTTTTTTAGGTCCATTTGTGCGCCTCAGCGCGGCCACACTATCCTTTCCTTCTTTTCTTA
CAAGTTTCCGGTGAGTGCTCCGCGTTTTTTTTGCCGATATTTTTATTTAACCACTTTTAA
ATCGTTTATTTGTAGCGAGGGATACCTGTGAGCAGCTTTCACTCCTACATACCACAATGG
CGGTAGGTTCAACCACAATTGCTGCACGCATCGACATATTTTCAACAATATTTTTGTCAT
GCAAAATTTGTACGCTGTGTGTTTACGATGGCAGCACAAGAAGTGACGAGTTTCCTTGGT
TGTTTTTCAGGCGGTTACCAAGAAGATTAAGCGCGATCCCGCGAAGAACCCGATGAGGGA
TCTGCACATCCGCAAACTCTGCCTGAACATCTGCGTGGGCGAGTCCGGTGACAGGCTGAC
CCGTGCCGCCAAGGTAAGATATACCTAGATGCAGCATAACCATGATCACTGGCTAACTAG
AGAATGCCAACAGGTGCTGGAGCAGCTGACTGGTCAGCAGCCAGTGTTCTCCAAGGCCCG
CTACACGGTCCGTTCGTTCGGTATTCGCCGTAACGAGAAGATCGCTGTCCACTGCACGGT
GCGCGGCGCCAAGGCTGAGGAGATTCTGGAGCGTGGCCTGAAGGTGCGCGAGTACGAGCT
GCGTCGGGAGAACTTCTCCTCCACCGGCAACTTCGGTTTCGGCATCCAGGAACACATCGA
TCTGGGCATCAAGTACGATCCCTCCATCGGTATCTATGGTCTGGACTTCTACGTCGTCCT
CGGCCGCCCTGGTAAGCATCTGTCTCCTACGTTTCGAATCGTGCACTTAATTAGGTATCT
CTGCCAATCGAGGCTCTGATGCTCAGTGAATGTGCGCATAGCAAAGAAGATGTGCTTAGT
TGGACTTGCTACATTCCATGCGTGGCCACACGGTACAATTTCGACAGCGTCTCATGGATT
GCCAAAACGTTGATTACTTATCTGCTACTCTGGTTTATCTTGCAGGCTACAATGTGAACC
ACAGGAAGCGCAAGTCCGGCACTGTCGGCTTCCAGCACCGCCTCACCAAGGAGGATGCCA
TGAAGTGGTTCCAGCAGAAATACGATGGTATCATCTTGAACACCAAGAAGTAGAGGAGCT
CTATCAGTAACCATGTTTTTTAAGAAGAATTCTACAATAAACCTTGGCTTGTGTCAACAC
GTAAAACCCGTAGTTCTGATCAACATTATTTATCGACAATAGTTTCAACTAAGTGGATCG
TGATTGAAGTTATTTGGCAAGAAATCATTGCTAGGATTTCATATCCGGTTTTAGGTTCTA
TGGAGACCAACGTCTTGTTAATGGATACAACTGCAGCATATTGTAGTGTCTGGACGAAAA
CATTTGGATATCAGCTAGAGGCATTCAAGATTTTAAAGTTTACTGTTCAATTGATCAATT
TTAAAGCAATTTCTTGTACTATTATAGAAATCAATTGTAAATATCAAAATGCCAAAATGA
AAAAACTTTTGTAACAAAAGGAACAAATTCTTGATTTTGCTACAAGTTGTAGATTTAATT
GCTAAACTGAGTTCCATGATTTATTTTATGAAATCCTAAAGCCAAATCATTCAGTTCAGT
GTAGGTGTACATATGGCCAAAACAATTCCATCTTGGGCATGATGGGTGACCTCTTCCCCT
ACTGTTGTAATCGAACCCAATACTCAAAGTCACGCCTTAGGTGAACTTGAAAATTCGTGG
GGGCGAACAAATCGGATGCGGCAGCCAAAGTTGAAGGTGGCCATAAGTTTCAATAAATCG
ATGCCAACACCAAGCGGGTTGCCATGGCAATTGAAAGTCCTTTGCAGGGCCAAACATGTC
AGGAAAATCGCCGTAAACAAAATAAAATTGATGCCCGTCCGCCAGTAAAATGGGAATGTT
GCACAATTTGGCCGATTTGATAAAGATTAAAAAGGATAAGATGACGATTCTGGTGCTGGG
ACTGAACAACAGCGGAAAGTCCTCGATAATTAATCATTTCAAAAAGTCCAGCGAACAGAC
ATCCATTGTGGTGCCCACAGTTGGCTTCATGGTGGAACAGTTTTACAGTAAGTGGCCGTG
GAATCATCAACTATGACTATATGTATCCCCTTGGAGTAGGCATGTCAGGTGTTTCCATTA
AGGCAATCGACATGTCCGGTGCGACGCGATACAGGAATCTGTGGGAGCACCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 1095..1141, 1270..1392, 1453..1750, 1965..2171
1136..1141, 1270..1392, 1453..1750, 1965..2089
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved