Drosophila_melanogaster Locus sano
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster sano
Drosophila_melanogaster
sano
2R
snoRNA:Me28S-U1130
22036..22144
82517
CTTGTTGTTTAATATGCATATATATCTACCAAATTTGGTAAATAATCCCAATGGATTAT
AATCGATATAATTGAAAATACCTACTTTAATAATTTTCTTTTAATATATTTTTATTTGTT
CAGCCAAGACAATATTTCCTAACAAACCTTTAGTGGAAAACCTCGTTCGACAAATTTCAC
TGGAAAATCAACTTTTTTGACAAATTGTAAATCGATACCCCTAAGTTGCAGGAGCCAATC
AAGCCAAGTGTATTGAGTGCCCAAACTTTGGCTAATTGTTGCAATTGCACTTAATGAAGT
CATCAATCGGGCAAAAGTATTTCAATTTATTTCCCCTTGCGGCAAATGCAATCGAGAAGA
GTGAAAATTTGACTCAATTTGGGCAAACACTTGAAACTGTTTATTTATTTATTTGCTTAT
TTATCAACACGCCATGGCAACCACCCACTAACTTGGAAAAAAGAAAACTGAGTATCAACA
CACAAACAGCCACCACGGAAGTAGAGAGTGTGCGTGTGTGTGTGTGTGTGTTGGCCAAGT
CACAGCTGTTTGGCCGGTATAACAGTATGACACGTAAAAAAGGTAAACAAACCGGCTGAT
GCAGTTTTACTTCCGCCGAAGAGAGCAATGTGTGAGTTTTCCAGCTAAGAGAGCGGGCCA
AAATGCGAAGAGCGGCTTTGAAAAATGGCCAAGTCATTTGAAGGGATTTAAAAAAGAATT
TGGTTTTCGGAGCTAATTGCCTTCATTTGTTTGGCTGTGGCCACAGATGAATTGCCTTGG
AATTTTTTTTTTGGCTCTTGGCCACTTATTATTTCTTACCAAATCTAATAATCTACTACT
ATTTTCTACTACTAAATGTGGTCGAAAAGAGCAACAGCTATAAGCCGAAGCCTTCGACTT
CGGGCCATGCCGGCGTTGCACGAAAACCAGTTCGTGGCCAACTCTTCCTCTTCATCTTGG
CCAACAGCGACTCAGTGGCGAGCATTTTTGTTTGGCATTTCAGTTGAGCTTTGCCAGCCG
AACGAAGAAGTCGAACTCGACGCTGCGTCTCTTTGCGTGTTGGTTTTCCCAATACAAATC
TCTCAGTTCGTGTCCGCGCTTTAGAAAACTGAAAACCCAAAGAAGCAGCAATATCACTCG
CAGCAGCAGCAGCAGCAACTGCTACAGCAGCAACATCACTCGCAGCAGCAGCAGCAGCGG
CAGCAGCAATAAAATCAAAACACGTTTTACTCCCGCACATTGAAAACGGTAATTTGAACC
CAATAACAAAAAGCGAAACAAAATTGTTGAATTAATTTAACACGGTAGCCTGTTTTCTAA
AGTATAAATGAAGAAATGTTCTGCCAGAGAATTTTAAGCAAATTCAAACCGCTGATTTTG
ATGACAGGAGAAATGAATGCCAGTGTGGCCGAATGCGTGTGTGAGTGTGAGTGTGGCTGC
CTTCTAAACAGCCTTGAAAGCTGGCTGGCAGCCTCTGTCAACCGAATAGTTGCTGCTGCA
ACAGCAGCATCTAGCGGCAGCGGCAGCCGAAGCAGCAGCAGCAACAACTGGCAACAAAAG
GCTGGCAGCAAGTCACAACAAAAGAAAACAGAAGCGGCAGCTGACTTTATGACGTCGCCA
GGCCTGGCGTGTTAACCTGGCCAAGAGCAGCTACCTTTACTACCTACTATATAGCTACCT
GGCTAGACATGAAAGCCTGTGCTTGTGGTGTCTATCTGTTGCAACTGCAACCTAAGCGCT
CCACAACACACACACACACACACGAGCGGCACTAAGTCCAGACTAAACACAAAACACACA
TACACACACTGCTGCACATGTGGAATGAAATTCGCTTTTGTTTTATGATTTTCATAAATT
CTTCAACAGCAAACAAACGAAAAAAGTTTATATTAAAAAGAAGAAAATAGCTAAAAACGC
GCAAAAAAAAGTTATAAGAAAAAATCCCTGTGTGTGCGAGTGGAAAAACCGGTTGCAGTT
AAGGTTCCCGAGTCGCTGGGTGTGTGTGTGTGTGTGCGTGTGTTTGGCTTTTTTCGCTTG
GCACAGGGCGAAAATAAATAAAAGCGATTAACTTGAGACAGTTTTAGTAGCCACTGTCCC
CCTTCGCACCCTCTTTCGAGCCCTAGAACCCCAGATATAGCCTTAATCCCATCGGAATCC
AGCGAAAAAGACGGAATCCGGGGGGCAGGCAGTTAGCCAAGTAGAAAGGAAAATTTGCAG
ACATTTGTTTGCCGGCAGATTTTTTCATAATTAAAATGGCTTGAGGGTTTTGTATTAGAA
GTAATTTTTATATTGCATTACTCCTTTAATATTTAATTTTTGTAATTAATTAACATTTTA
GCAGCTCATCTTTATATTTGTTTAAATTATTTTTCAATATTTAATGCTTTACTCTTAATT
TATTCATTATTTCGTATTTCTTTATTGTTTCAGCATTTCCCACATACAAAGAGGATTTAA
TTTCCAATTGAAAAACCATTTAAATTGGTTTATAATTTCCGAAAATATTTGTGTTTGTGT
TTTTTGAATGAAAGTGTGTAACCAAAAATATGGAAATTTCGCTCATAAATATTGATGTGT
AATATTGAATATTTGTGTCTTTTACTTTGAAGCCGGTTTCGTTTCTGTGTCGATATTTTG
CATTATTAATTACAATTTACGTTCATCAAGTGGAAACAGTCAAACAAATTGAGAGACAAT
TCAGAGACAAAACATGGAAAACTATGTGTGAACGATGTGAGTAAATGCAAAGCAATTTTG
TTTTCTTATCCATATATCTTTGAACTGCGATTAATTACAATCCTCATTGAAATTTTCATC
CCACTCCAATTCTCGGGGGGGCATTTAAGCAAATTTGGCAAAATTTCCATTTCAATTTAA
ATTTGCAATTAAATTGGATTGTTTTGCATCTCATTTGCTACCTCATATCCCGTGTGTAAT
GCCATCTAATCAGCATCTTTCCATTATTTAATCGTTTATATTTACACCCCCCTTACTCAC
CCACTGCTGCAGCTCAGTAAATATTACCCATACGACATGGTAGCCCAGCGAAACGTGCTC
GGCATGCTCGAGTGAGGCAAATCAATTAAAATTTCAGAGATTTTACGACCACACTGACTA
AATGATGATGCCGTTCGCTTAAAACTAACTTTAAAGGCAGCGGGACGCGCCTCCATAAAA
ACTACAAAAACAAATATCAACAAACGCGTGCAACATTTGCATAAATTCCAATACATTATT
ATTATTTCTGTTGCTGTTGCGTTTTTGTCGTTTTGTGTTTTGACCAACTCTCGAATATTC
AAAAGCCAATTGGGCAAAGTTTTTTTTTTGCCAAATATGCAAAAACACGCGTCGAATAAT
ATTTTTGTTTGACAATTTCTGCTGGCATTTAATCTGTTTTTGTCGCATTTTGTGGCAATT
AAATGGCAGCGAATTAATCATAAAAAAGGCGTAAAATTTTATTTACAACATTTATTCGCC
AGCTGTCGATGCGGCACGGAACGTTACAGTCATAAACATAGGTCGATTTGTGGATGCAGA
TGGACCAGCAAGGCGTTTATATTAAAATATAATTGGTATGTGATATTGGTTCCGATTTCG
AACTATAGCCACGAAGCGCACTGTACCAACGATTTCCTAAATGAAATTGTGTGTACAAAT
GAGGCACGTGGGCATTGGTTGGCTTAGGTCGAATCAACTTGATTTATGTAAATTGGAAAC
TGTTCGCATAGAAAAACAAAGTTATAATTGAGAGACGAGATTAAAATGCACTTTTCGATT
GGCTGTCGTGAAGAAACAACATACAATGGCTTATAAATCTCACACTTGAAAAATATTTTA
GATTTTTCCCGGAAAATTTAATCTACAGTTTGAATGAAATAGTGCTTAAACGTTTTTCAT
TGCAAAACTTTTGCTTCTATCCAAAAATATATTCCTTTGCCGCCATAATCCTGCGGTAAT
CCCCAATGAAGATTCGAGTTTCAGTTGGACCAAAAATATTTTCCACTTGAATGCCGGAAC
AGAAATGCAATTAAATTCCACTAAATGCAGCAGCTTGTGGGCGGAATGGTTTCTGAATGA
AATTTGCAGTGGGAACCGAATCACTTTTGCCTCGCCCTTCTTTTCCTCTTGCAGCTAATT
AATTTGGCATTAATTTTAATGCAATTTGCTCGCTTATCTCAAAGGCCAATAAATCAACAC
GGAAATCGGATTCCCATAATTTCAAATGCACCACATAACTCATATTTGCCTTCGGCTTTT
GGTATCGGTTAATTAAGAACCAAAAAAGCAAAAAAGAACATTGAACACCATTTAAAGCCC
AACAAACGGTAGGGCAAAAAATAATGAATAAATTGCGTAGATCAGGAACTATAGCATTTC
TGCCCTGTCGAGTGTTAAATTGAAGATAATTTTTAATTATGCCCACAGTCGGGCCAGGCG
CGCACGTTAAATTGCCTTTTAAAATTCAATTTACATTCGGTTTGGCTTTTCCGTAAAGTG
TTCACTTTGGGATCGCAGCTCCAGGCATCATTACTTTGCGAGGGCTGATCTAAGAGTTAG
CCGACTATTTCTGCCTAAACATGTGCTTAAAAGTTTAAGTTGATAATTTTTAAGTGACTT
TTCCAAATCTTATTGTTTTATTTCTAAGTCAAATTTCCCTAATATTTATTAAGATTCTCT
TTGAAACTCTATGAACTTCCTCCGCCAAAATCCGATGGTCTTGAATTCGACCTGGAAACC
GGAGACGGGCCAGAATAAAAACAATTACACGCATGTGCGTAAGACTTTGGCAACTTCGTG
GCTGGCCCAACTGGGCACCCGAAGATCTTTTGGATCTTTGAGCTCTGGGGTATAGGGTCT
CGGATCTCCCCAAGCCGCCCTCCACTCCATTGTATTTTTTTTCTCTCTACAGGAAGCTGC
GTGGCTTTGGCATTTAAAAATGTATTAATTTTGACGCGCCGGGCCGTAGTTGTTGTTTAT
GCTTGTTGCGTGAGCCGACACTGATGATGGTATCTGTATCTGAATCTTTAGCCATGTCCG
ATGCCGATGCCGGTGCCGATGCCGATGGTTCGTCGGTATTATATCGGAGGCACCACCGAT
GAGAGGAGTGATATAAATGCGAATAAGTTACGTCAATTTTCGTGTGTTGTATGTGTCTGT
CTGCCCTGGCCTTTGGAATACTTTATCATTTCGTTTTTTGTTCTTCCTACTCCTCCATCT
GCTCCAAAAAAAAAAACCCCTTCCTCGGCAATTCTGGTTCTTTTTCTGGTATTCGCTAGC
CGAAGGTCTACAACCTTGGCAGAGTTAAGTCAGCTTTACTGGAGCTGACTGTCACTTCAA
CTCCGGCGATATGGGAGATTTCCTCTTGACAGACTGTTCTGCCAAGGGTACGCCAGCAAA
GACTTGGCCTCCCACACAAAATAGTAGGAATAGAGATTGTAAGGATGAGGCAGGATTTTG
AATTATATCTACTCAGGTAAGATTCGTAATGACATATGACTTTTATGACCAGCAGACCAT
TTAAAGCCTGTTATAGCATGATGTTTCTACTATTCATAGGTAGTAATAGGGCACCTTTAA
CTTCGTCTGTCCGATTCCCTCAGATTTGCTGCTTCAGTTTAATTCTTGGCGCATAATTAG
CTGCTATAAACTGATAGGTTTCCCTATGACAAATGATGTGAACCAGCCAGCAGAAACAGA
AGTTCTCCAGAGTGCTGGATGTGCGCGTAAATATTTGCATAAATATTACATATATTAATG
CTAATGAGGCATCAAATGGCTGACGATTACGAGCGGATTGGCTGAAGCCAATGACCCACA
GAGGAATAAAATGCTGGATTGATGGAATCTTAAGACCTAAGACTCAAGAAGGCCAAGATC
AGAGACCGGCCAAAAGAGCCGACTGGTGTTTTGGTGTCTGTTTTGGTGTTATAAAACATT
TCATTACACGATACAATTGAGTGAACGCCTTGAACTTCCGCTTCAAGAAGTTCAGCGCAG
TTCAGAGCGCCGGGCCAAAACCAATGAAGTCAGAGTTGGCCAACGGACTTTGTTGTTGTT
ATAGTTATTGTAGCACTGCTCGTTGCTGTTGTTGTTGTTAATAATATTATTGTTGTTGTT
ATTGTTGGCAAGCAGGAGGTGGGGGAGTCGCTGGAATGACAAGCCATGCCAAGACGAAGA
CGAAGTCTCTTGTCCGCAGTCATTTTGTGCTGAGTTGTATCTGTGTGTCTGAATCTTCAT
TTGTGTAGATACACTGTGCGAAAAAAGCTGCCATATATATTTGAGATTTTTTTTTTACAT
GCGTTCGTTAAATTTAATTCATTTTTAAACAAACTAATATGTTATTTGTGACGTAATTTA
GTATAGAATTGTAGTAGAATACTTGTAGTACAACATTTCTCTCGGTGTACATTTGTGCGG
AGCCATGTTTCACACTTCAGAGGGCCTATCGGCGGCCTCAGCAGGCCAAACAAATTGTAA
AGTCATAGGCAAGGGACGAGACCAGCCGCAAGCCCCAAGTCGAAGAGCAAGTCCAAGTCC
ATGACCAACTCCAGGTCCTCCTCGAGTGGCCGGAGCAATGAGGGGACGGCAGAAAATAAA
GTTAAGCAGTACAAAAAGGCTTTTAATTTTAATTTGCATATGGCAGAACGCGCTGGAGCG
GAGCTGAAGAACCCAGGGCAGAACCAAACCAATCCGAACTGAACCGAGTATCTGTAAGAT
ACTCGTACATGCAATGCCAAGTGGTAGAATGAGAACAACTTTGGCCCTTCGCGGTGGCGG
GGAAAATGCAAGTTAAATTTAATTTATTTCTCCAGCAATTGCCGAGCTTGAAGAGGAGTC
TTTTTTAAAGATTTTCTTTCTTTTTTTTTGTTATTTTCATTTTTGCCATTGTTGTTGCTG
TGTGAAAAATGAGCCAAATAGGAGTTCCAGCCCGAGTCTCACTCTCTTCTTAAGTGGGTT
CAACTCTAATGACCGCGTGTGAAAATGAAAATGGAAAATGCTGCCTCTACTTGTGTCTGC
TATGTATTTGTTGTACTAAGCTTGTAGTTGGCGGCGTTGGCGGCTTCATCATCATCGCCA
CCATCATCATCATCATTATCATCTCCGCGCTCCAGTGGATTCAACACGGCCAAGGAAATC
GCGGGGAGCAACATGTGAACTTGTGAAAAATCGAAATTCCAATTCAAAGTCGCAACTTTT
GCCAGCCATTCCAGCCCAGCCAGCCAGCCAGCCAGCCAGGTCTTCTTGGCCAACGTTGAG
AAATGATTTACGCTTAAATAACATGTTGCATGTGGCAAGTATGTCGTTGTTGTTGCTGTT
GTTGCTCTTGCCGACCAGATCGTGAAGTTCTTCTTCAACTTCCCCCTTTTTTTTGAGTGG
CCCATGGCAATGATAATGAATTTCTACCTTCGCCAGGAAATAACTCCGAGAAAATCTTAA
GAACAGAATAATACAAAACGAAAAAGAAGTCAAGTCCGGGAGACAAGAGCCACAAATTAA
GGGATTCAGTGGGGGATTAGATTCAGGTCAGCGCAATCGATGCCCGCAAATTATATTCAA
TTACAATTTGGCATATCAAGATTTCAGCAAATCAATTATGGCCCAGAAATTGCCAAGCAA
GAATTAATGAAGAATTAAATTTCTTAGAAGAGTGAAAACAACAAATTACACACAAAATTA
GAGAGTGATATAAAGAGAATGCTTAGCACTTAGAAAATTAATTAGTTTCAAAGATTGTAG
TTGTAATAAATTTTTAAATTTAACATTTTATTATTGAACATCAATAGGAATTAAAAACAT
TTGAAATCAACCGGAAAACTTATTCGGTAATCATTTCCATTTTTTGACAATTATTATCAA
ATTATCACAAGTTTCGTTGAAAGTTTGCAACCAACCGAAATTGGTTTTGATGTTATGAAA
TTCAGTGTTCAAGAAAAAGACAATAATGAAGTCATGAAAACAAAAACCAATCGGTGACAG
TCTGGGCAAAAAAACAGACTGAGTGGACAAAGGCAAACAACTTGGAGGAAAAAGAAGCTG
GAATAGAGGTGGAAAACGCTGAAAGCATCATCGAGTGCAAAAACTATTTTCGAGGGGGGA
ACTTGAATGACTTGGGCACGAATTGATGATTTTTTTGTAATATTTGTTTTTCTGCACATT
TTACATAATTTTCCCTTTCCACAAACCACTCAATTTTAAATTTCTTTTGTCGAATGCTTA
AATTCACAGAGATTATTTTGTAATATTTCCCATTCATAATTTGGCTACAAATCGTGGCTC
ATTCTCGATTACTTCAGTTGGCATTAAGCAAAATCCACAGCTGACAATGTAAGCACAGAA
AATGGCTTTTAGCCAAGCTCCTGAGGGGAATTTTCCACTATCCGCTACTTTTAGTCCACA
GAAGTTTTAACAAATTCAATTATGTTCCACTGATGGCTTTTTCCACCTTACTTTTTGTTT
AATTGAACAATGTGTCGAATTTCGATGGTTTTTCCAAGCAGACATAAACCAGCTGGAAAA
ATGTGCTTATTTCACTGCGAGAATGGAAAATGACTTAATTATGCAGATTATATTTAATGC
TGCTAAAAATGGCACACTGCCCTAAGTAAATAATTTCATTAGCCGGTGCCCAAAAGCAGG
CAAAGAACTATAAAATAAATGTGCAGCATATTTCTACATAAATCCAGTTCATGCATATTT
TGGCTCGGTTTTATTTTGCTTTTAATTTTTTTTTTTTGCACCGGACATGGCTGTGCAATT
TGGGGCACGCGCCCACAGGCCGACAGAAGGGGGCTAGAAAAAAACTGAAAAGGAAAAAGA
ATATTGATATGTGTGAAAAATGGCCAACTGAATTGGCAGCGACACCAACAATGCACAGTC
AAATTGGCCCAAAAAAGTGACAAATACCTCGATACAGGACCGACAGGTAAACTTTTCCAC
TTTTCCACATATCCACAATTCCACTCCTCGCCCAGCACTTTTGTTGCGACATCTCAGTCG
CAGTTGCAACAACAATCGACAGACAGATGGCCAGACAGTTGGCAACCCAGACATATGGGG
CTCAAAAAAGGCTGCTTGGCACATGCCAAAATGGCAACCGCAGCGTAAAAATGCCAAACT
AACAAAAAATGTGTTCGCATAAAAAAATAAAAATAAGAAAAGAAAAAAAAAAAAAAACAA
AGGGAAAATGCAGGCAACGCAGCCCAGTCAAATACCAAATGATTTGTCAGCAATCGTTGC
AGTGGAGTGCGCAGGGTTAAGGGAGAGTAAGTAATGGGTTAAGGGGCAGGAAGTGCACTG
CCCCAAGGTAGAAACCAAAAAAAAAAAAAAAAGGGGAAGCCTTTGATGGCGGCGCTCATC
AAAGTCAAAAGATATGCGAATATTTGCATGCAATTCAGCAGTGGGAATGTGCAAAGTTAG
TTGAGGCAATCTATTACTTAATTGGATGAAAACCAAACAAATTAAAGATTTGTTGGTGTT
TTTAACTGGCTCTTAACTCTTTATTCAGTTAGACATAACACCAAGTCCAATGCCCTTGTC
CGAATTTTATTACTTAATGTTATTGCATTTCTCCTATTTCTCTCCAAACGATACCATACC
ACTCATTCGATTTGCATAAGTCTTTAATTGATTCGTGTCATTAGGCCGATTGGTTTCGTA
TTGAAAATAATGAATAACCAAAAGCTACGCCAGCTGGCTGACTCGGGCAATCATTAGATC
AGCCAGGTCTGAACGATTCTGCAATCCCGGAGTTATCCAATACGTTTGGATCGTGATTGC
CAGACAAATGACATTTGACATGTTGTCTCGAACAGAGAAAAGCCAACTTAATTGTTGCCT
GCATTGTGGCCTCTCCATATGGCAACTTTATGCTTATCTGGACATAAGAGGAAACCGAGA
ATAAAAGAAGTAAGTTGCTCATAAATTTGTTTGTTGCCGTTGCAATTGTTTAATTGTTGC
CCGGGTCCGGCCAAGACCAGGCCAAAACCAGCCAGCAATGTGGCTGGCTCGGACTGGGCT
TGAAAGCATTTTTGTTTCGGGCTGATAATCGGTTTAAAAGTGACTCAACTTTTCGGCTTG
CATGTGGCAATTGTCTGTTGTTTGTTGGCCGTCGCTTGTTTGTTTTTTTTTTGTGGCCGC
TACTGCTGCGGCTCCTGCTTTTAGAAATTATTGTCAATTGTGTGCAGCATAAGCTGAATT
AAATTTCAAACAATTCAACAAGTTTTAATTGCGCCACGGGCAGCGAAAGAAAGAGGATTT
TCGGTTGCGGTGCGAGATTTCCAGAAAATGTTGCGGTTACCCACCAAAGCCGGTGACCTT
AGGATTTTCGGAGTTGTCGAAGGGGAAGGCGGAGGCGCAATCAAAAATCTGATTTTTCCC
TTCATAAACTGGCCGCGGGTGATGTCAGCCAGTCAGTTAGTCTGTCAGTCTGTCAGATCG
TGATCGATGCTCACAATTTTCATTCAGTTTGTTATTGTTCTCCAAGGACCGCCGCTTGGG
GCTAGAAATCGGTTTCGATTTGACCGGGCCAACTGTCAACGAGCCTCAATCCGCAATCCG
CAAATCCAGCAACTGTTAACTGTTGGCAAGCAATTGCAGCTGCAGCCGCAAAATATGGCC
CATAATTCCTGAGCTTGGCCCTTTTGCTGTCACTAAATCGTGCTGTCAGGTTTCTCATTG
CTCATAGCTGATAGCTCTTAGCTTCGAGTTCCCAAGTTCTTAGCCCTATAAGATCGTGTC
TTCAGTATCCCCGGGTTCTAATTGCTAATCGAATGAACTTATTTAATTTCTTGCTATTTC
ATCCTCGGACCATTTCTAGGGCATCAATATTTCCCTCGTTTCAGGGCAACGAACATACTA
CTGTTGAGATCTAGGATTTCCGTGAATTAATTAACAATTCGAATATTCAAGAAAAGTGTT
GAAAATATCCAAAACCATTTTGGTAAACTTTTCTTTAAAGGTATACAAACATAATTGGTT
TTTAAAGAACTTCTTACAAAGAGGGGACGTTTCATTAACTTTTATTTAAATTGCGATGCT
AATCGTGCAAAGCTTTTCCATCTTGTGGCCATTTCCTGGTCATTAGCATTTCCATTTTCG
GTAGGACACTACGAGTAGTAGATTATGATTTTCTTAAATTAATTTTAAATTCGACAGGGT
TTTAATTGAATCTCAGCACTCTGTACGGCGCCACTTCAATGCTGGCCAAATCCAAAATTG
GAGCAAAATGCGACTGGAAACTTTAGCAGCTGAAAGAGCCCCAGAGCCAAAAGTCCGAAA
TGAAGATAAACACCCAAACATTTGCACACATGTTTGGGGGCGGTGGTCCGGAGGGGGCGT
GGTCTGTTGCCAGAACTTGTGACAAACTTGGCTAACCGCCATGGCAGAGTTTTGCATGCT
GTACGCTGTTCCATGCCATTCCATGTTCTGCTGGCGCACATGTCGTATACGCAATATGCA
CAAATAAATGTCAACTTAGAACCGACTGCAGCTATCCCTTTTACCCCCTCTCACCATTCA
ACTTTTTTTATTTTACCAAAGAGCTGAGCCCGCATTTAATAAAACCGAAATGAAATTAAA
TATACCACAACTGCTGACAAAATGTCAAGTGTAGCAATAAAGATGGGATAAACCAGAAAA
GGGATAGCCAACGGCAGCCATCCTAATGAATTCCACCAAAAATGCGGGAGAGCGCAACAA
ATAAAAAATTATTTAAAGTTGAAAACTGGTAGGAAAAAAAAACCAACGGCGCAGAAGGAG
GAGAAAAAATTAATTTAGCAAATTTTTAATTGCTCATGTCGTTTGGCGAGGCAGCCAACG
ATCGCATCAAGCTTCGCTGGAGCTGGCGGCTATTTGCTTTTGGCCCGGCTTGCGTGCTTT
CGGCCGTGTTGTCTTCGCGTTGCCTTTTCTCTGTTTTACTTTGTTTTTTTTTCGCTTTTC
TCGCCTTTTTCCCCCGGCACGTGAAGTTGAAGTTTAAGGTCAAAAAGAGAGGATTTTGCG
AATCGCGAAGCGAGATATTCGCGCTGTCATCAGGGCTAAAAATTCGCATATGGCTCGCTT
CTTTGCAAGTTCAAGAGCAGCAGCCACGTATGTATACGAGTACAAGTATAAACTTATTCG
CTCCGAGCAAATCAGCTTAACCCCAGAAGAGCAGCTGTCATCATCTGGCGCTGATGAAAA
TTTCATGTTCGCCTGCTGGTCCCGAATACTTTTTACATTTACTGTCACGTGTGCGACAGT
TCAATTGAAAAAGCATTCCTATGGCGAAATTCCTCATGCGAAATTGATTCCCCTCAAAAA
GAAAAAAAAAAGGGTGCTGGTTGTAAGCGGATGTATTCGAGCAGCTTGACAGTTTTGATT
TCGTGAAAGTATATTTGGAATTTTATGAAAACAAACAGCAGCTGGACTGGACACACAATC
ATTTGATTTCTGGTGGAAAGTAATAGTAAATAAAGCGGCAGTGAGAGTTCAATTCAAACA
GAACATCTGATACAATTATTTGGAAATTATCAAAAAGTATCTCGTTTGCTATCTTATAAG
CTACAAATGAGTTGTGGGATCATTCAAAGTCGAACTTTTATTATTAACATACAATTTAAA
TGCCTATCTCTGCATGCCAATTGAGCCAGTAATCCGTTCTATTATAAACACATTTAAACA
TATTTTAATTAAATTAGCTAAGCCGACTTCACCAAATGCCAAAAAGCATTTTGCCAAATT
TGTCCAACCGTAAAAACGTTTGATTGCATATATCGGAAATATTAGCCAAATCCGAGCACT
CAACGTAAATGAGATTTAATCACAGTTTGGCATTTGTGTTGTTGTTAGATCGGCTCCCAA
GTGGCTTAATTTGCAAATATTTTTCTGTCGCCACAACAAATTGCTCCCCATTGAACCAAT
CGAGTACCCCCCTTCCCACCAACGAACTCGGAAAACTCCTCATCTCCATGGGAGCCCAGC
CAAATGATACGGAATGAAACGAAACGCATCCCATGGGGATCGATCGGCGGCATGGTGGTG
CTGCTCTTAGTGCTCCTGGCCCGTTTGTCAGTTTGGCAGCTGGCTCATAATTTGTAAGCC
ATATGACTGCGGGCAGGAAGTTGGCAATTGGCCAGGAAGAGATAGAAAGGAAGAGAGAGC
GCGGGAGAGAGAGAGAGGGAAGCAAAGACGATCCATTTAATTACCTATGTATGTGGCAGG
ATACGGTGGCAGCCACCGATGCACCGGCCACTGCTGCCTCATAATCGAGTGGCCAGATGG
ACCTAATCAGCCATGGATATGGCCATTTATAAAAGCCAACAGAGACAGAGCTTCTCATTC
TGCACTCCACTCCACTCAACTTCAATCCCGTCGCAGTTGCAGTCGCATAAAATGCAAATT
TGCATTTGCCAAAGCGATTAGTTCGTGTCGAGCAGCAAGAGCATTCGAGAGCAATAAAAA
TATTTGCCATTGCAGCAATGCAGCTGAAACAAAACTTAATTAATCAAGGGCGAGGGGGAT
GGGTAAGGGGGAATGGTGATGCGAGAAGGGAGGGGCCAAAGTGGCAAGTGACATCCGTTG
CTCGTCAGCTTCCGCAGGCTAACAGCTACACTCGAAGAAAAAAAAGGTAACCGAAAATTC
TTCTGTTAAGTTCGACAATTTGAACATTTATACATTTGGAGGAGCACAGCACTTAAAGTT
TAATTTGCATATGCTTACATACATATGTATGTGTGATACCGCACAACGAAGTGCTCGCCT
TTTGTTGCAGTGCAGCTCTTCATCGACCATGTTCTGTTCGTTTTGCTTGGTGCCTCCCCA
AAGACCGAACAACGGAAATGTTAAATGCCGCCAAGAGGCAGCCGCACCGCCGCCGCCGGC
AGCGCCACCCCCCTCCCTTTGGGCCACCAGTCAGGTCCTTTCATTGATCATTGATTGAGT
TTCGATTCGTTTCGATTCGATTCGATTCGTTGGGTTGTGTTAGGACTCCACAGTCCAGGT
TTGTCCGCATTTCCATTTGCCCAGTGTCGTCTCCCGATGGCGACTCCCTTTGGAGGTATG
TCCTCATTTTTTTTAGCATTCTGCTGAATAGACATGTTGGCCATGTTTGTTGACCAGCCA
GGAGCCAACTGCCCTCATCAGCTACTTATCGCAGCTGTGCGAGCTTGTGTGCGTTCCCTG
TATCCGTATCTGTATCTGTATCTGTGGACATCTGCATTTGTGTCTGTAAGTGACTTGCGA
CATAAAGTGCTTTTATTGATGTTCATTTGGTAAGGCAATTTGTAGCATTTTGTGACATTT
ATGCGTCTGGGCCATTTAAATGCCATTATGCAATTTGTTGTCCATCTGCTTGGGTGGCGC
AGGAAGGGCTATAGATATATGTAGATATAGAGATACATGTAGAAAAGGCGCATTGGGATT
AGAAGTTTGGGGGGGGAGAAGTGTCAACAGCCATCGACTTCTTCGATTAAGTGGAAATTC
CAGTTGAATATTCAATGATATTTACAGAGTTCTCTTAACGAGCTGGGATGAGTATAAAAT
CTGAAATCTGGCTAATTATAATGTCATTTAAGTCAGGAGGAAAACAGTTGAGAACGCTTG
TGCAAATGCATATATACCAACGAATACATTTGAATCAACTTTATTGACGCCTACAGCATA
TAAATTATAAAATGTATTTTTGTCATTATCCTAATTATTATCAACCTAAAAAAGTAATAG
TAATGCCAAATATGAACTTTATTTCAGCTCAAATAACTCACACATTGACAGATCAGTTAA
CAACCTTTTACCACTCATTTCGAATCGATTAGACCCACATTCAATTCGCACAAGCTTATG
CATAAATTACACATCTCATTTTATTTTATTTATTTGTCAACAGTATTCAGTTGGCATTTC
CAACAGAGTTCGGCTTTCAGCACTCGCAGCAAACCAAATTAACTGACCTGCCGCAACTTG
ATTTTATTTTCAAATTTTTACGAATAAGCTCGAACGTCACTTGGCTTAAATATTCCGTTT
TAAATTACTGAAATATTTTTTGTTTCGATTCGGCTTGATTGCTCTTGTTGTTTTTGTTTT
GCATCTATGCGCTACACATTTAGGAGTAGAAACGAGTTTTCATAACCAGCAGTTATGTGG
CAATTTCGGTTCTCTCCCACTCGGCTGCAGTTCATATTCATTAATTTATCACCGTTGCTG
CGGGTTGGGTAACTTGGTCTATAAGCATATATACACATATATACATATATACTTTTGGGA
GCGTGAATGTTTGTACTTTTCAGTGCTACCAATTAAGTGTGAAAAACCTTTTTCACTTCT
CCACTTCTTTTTCGGCTGACTTGCGGCCTTGCCGCGATGCCAGCAACATTTACTGTCACA
AAAAGCGACGTGGTTACCGCAGCATCGAGTTCGGATTCGGTTTTGGATTACAATGAAAAA
TGGCTTGAAGGCGTCTGCGGAAATGCCGAGCGAGTGGGGCTAACCGATTCCTGAAGAGGG
TTTCCAGTTAAAAGGATTGGCAAGGGGGATAGGCGGTGGTACGGTAATTCAAGCCTTAAT
GAAGGTTGCTTTCGCCTGAGATTAATTAAAACAATTTATTGCCGCAAATTCCTTGCGGGC
TCATCAACAATTTTCATATAAATAGCTTGACTTCAACACCCCATTTAATATGGGGTGTAA
GAGAATCTTATTGCTTATTATCGTTATATTTACATGTACAAGCATTTGGCTTTCACCTTT
AAACCGCTTCGATGCGAAAATCCTAAACTATTTTATGGAAAAATGTGGGCGGCGTTGGCT
AAAAAAAAAAGACAACGATTCAATAAACTTTCCTTGTTTGTCCTTCACTGAATTTTATTT
GTTTTTCCCGTTCGATGAATATTTTATTTGCAATTGTTGCTGCTCTCTGCCCTATCTCCC
CATAAATTTTACATTCTCCAGCCGTTTCTTTTATTTCTACTTGCCGTGTTCCAAATGATT
TAATATGCAGAGTCGTAAATTCCATTCAAAAACTTTTTGGCACTCAAATCTCGGTGTGTA
TTTTTCAAGCGATTTTTCCTCTATAGTTTGTTTGTTTGTTGTGGCTATGTGTTTTTTGCA
CCTCCAACTTGGCGTTACGTGAGTTGTCTGCCCCAAGGAGACTGCAAGTCGAACTTTGAG
AGGGAAACAAATCAATGTCTCTCGTGGATAAACCACCACAACCCCCCCCCCAGAAATGCC
ACCCACTCCCCTTTCTAAACCATCGATGAAATTGCATTCGCGTGTGTGTATCTGTGTTTG
TTTTAATATGCGTTAAGTATAGTGGCTGCAAGTACACGGGAAAAAATTGTTGATCCATTT
GATTTGTATATTTGGAAATAGGTAGATGATATTGTGACTTCATTTAAATTTAATAAAAAT
ATAAAGAGTTCTACTTAAAAAATAAAAATATTTAAGAAATTTTTGACATATGCCAGAAAT
TTTCTCTGTGCTCCTGTTGTTTGCCCAACCAGCCACACTATGATTTGGATTTTCCACCCA
GCATCTACAATCCCCGCAGCACTAAAAACTTCAACGAAATGCATTTGCTATTGAAGTTTT
TTGTTTGCATTTTTCGTTGCTTTTTTAGTTGCATTTTTGTCACCAGCTGCTGTTGTTGTT
GCTCCTTCACTGTTTGTGCAACGTGTTTGCGGCAGTGTTTGTTGAGCTTAATTTTATTTT
CAATTTCGAGCAAAAAATAAAATATCTTGTTGGTTTTCGATCGGCAACCGAATCATATGT
TAAATAAATATGCCATTTTGTTCTATTAAAATTGCAATTTTCATTCGTTAAGCTCTGCGC
TGCAAGCAAGTACACACTTAAAAAGCGCAATTTATTGGCCATATTTATTATAAATCATGG
AGCGCAGAAATGGTGGAGCAGTAGAAAATGCAATGGAGAAAATGTCCACTAAGAAAAATA
CGAGAAAGCCAACGTCTTGCCGCTGCGGCAACGTTCGAGTTGCCGCAAATTGTGGCATTG
CTGCTCCCTGCTGTTCCATCCACAACCACCACTTCACCACCTCCTTTTCTTCCTAGTATT
ACCACTTTTTTTGTGGCGTGGCGACTCGTCTAAAAATAACTTTTCCACACGCTTTCAGTG
TGTTAAAAATAACATAATATTTTTCATAGTTCTTATAGCTGCGCTGTTGCACTTTGCGCT
CGAATTGAAGAAATGTGTTGCAAGTTGCGTGTTGTATGCCCGGGGGTAATCGGAGTGCTT
AGGGCGCTTAAAGCTAATAGTTAATAAAATGCCAGAACCCTTCAAGGCAGTCGCAATATC
CCCTTGCCCCCTAAGTCCGCCCAAAGTCCCGTGGCCATAATCAAAGTCAACAACAAACGT
ACCTGTTAGCATGCTTAACACACTCATATGTGTGTGCGTGTGTGTGTGTGTGTGCACCTG
CCTGTGACTCGACTTGACTTGAGGTTGAGTCGAGTTGACTTGGCCGCCTGTCATTCTGCC
CTTAAATAGGGTACTGTGTACAATTTCACTCCTTCAAATATATGTTAAATATATTATTAT
TAATATTATGTATCTTCGTTATTGTTTTTATGATGTAAGAGCATTTAAATTGAAAATATG
TATGTTATCTACTGGCGTTAGAGTATTCCTCGCGTCGGCTGCTGAAACGTATCCACAGCC
TTATGGTTTCCCATCTCACCTGTGTTGTCTGTGGCAAGCTTTAATGCCTGCGTGTCATGA
ATGGCATCGCAATGTTTCCACTTTAGGGCTGCCAGCACACATATGTACATACTATACGTA
CCGAGTTGGCTGATAAAATTATGACATATGAAACTTTGGCTGACATCGGGCTAAAACCAA
GCGAAAAGGCATGCAAAAGCTGTCTGCTGTTTTTGGCTCCCTTTTGTGCCCTTTGTTTCG
GTGATTCGCCGCACCATTCCATTCTGGCCATAAACATGCACACAACATGGCCTGATAAAG
CGAATCGGCCAAGTTAAGCTCCTCAACTTGTGCACTTGATTAAAGTGGCTAAGAACTGGC
GAATGTGGAGTTTTCGGCTAGCATGGCATTAAAGTGCCCGCTGGTGGGTGTTGGCTGAGG
TCACGAATTTTCCTAGGTAATTCTGTGGCAGCAGCAAACGTTAATGGTCGTCGAGCACAT
TATATTACGTATACGCCGCATGGGCGTCGTCAGCACAAAACTTGTCGAAGGAAAAAGTGG
TTTTCGAAGTGGAAGCCAAATACCCATCTCGAAGGATTCTCTCCCTTGAGAGCTGATGCT
GTCATTGCCATTGCCACTGCACATTTGGTGTTTTAATTAAAACGAAATTAACCCAAAGGA
CAGCGAATCTCCAGAATGGTGGAAGCAGATGTTTGTGGCAGTTGCGGGCGAGTGGACACA
GCCACTGTGATGTAAGTCACTTTCGTAATATAAATTGTAATATTGTAACAATTTCACTGT
GGCTGAAATGCAATTAACAGGTGTGAGTGTTTGCTGGCCGCCAAGCGACAGTTAATGCAT
ATCAAGCAACAATGTGAAGGAGAGCAAAAATGTTGATTGGATGTCGGACACTCAAGGGGT
TGAAGTTCATTCATAAATTTGTAATTAATTTGTTCAGCTTCGGAGGAATGCATTTATTGT
CATTAAAAATATTTTTAAGGGAGCGTTCTTTTTAGAATCTTTCTATAGCCAACAGTTTTC
TGAATGCGTTCTTAAATGAAATTCTTTGAAAATATTTTCTTGTCGCTACCATTTATGTCT
TTAACCATATATTAAACGATACAATACACCACTATTTCCATTCCGTTTTACACCATATTG
CCATCTGATATTTTTTTTTGCCCACTTTATGTGTACTCCTTGAAAAGGCGAAAAGCAAAA
TTTGCGCGAACAAGTTGATGATGATCCGATTAAAACTCTTATCAGTTAGTTATTCCTCCC
ACCGACATGAATTTCCCTATAGTGCGGCAACTTAGATTGCTCCTGTAGTCGGTGGAGTGG
CGGGGGAACCGAGGGGTGGGAAGCTGGAGAAAAATAAATTCTGTTAACTGAAGAGGCAAC
AGAAAAGCGGCAACCAAGTCCGGCAAAAAGGCGCATCGAAGCGGCAACAAAGTTTCGGTT
TCAGTTTTATATATACATATATATTATATATATATATATATTTTTTTTTTTCTTTTCGCC
AACTCTTTATGCGCAAGGGTGTAAAGAGGGGGAAGTGAGAAGGGAAGTGGTGGAGGGGAG
CCGGAACAAAAGGCCGACCAGGGCTACAAATTTCACTGGCTTTGAATAAGTTGGCTTTTT
GTTTCAGTCCCGGCCGCCCATCTTATAAATAAAAACATATTTATGCAAGGCTAAGACCAA
GGATAAGGATGATCCTTTTCGCAACTGCCGGATAAGTGCTGCAGCAACTTTTTTTTTGCC
CAGAACAAAGGGGCTGCGGCGGGCAAAGTGGCAATTTTTATGTATTTATTTGCCCGGCCT
GCGGCCAAAAGAGGCGATTGCAACTGCGGAATGAAATTTATTGCAGGTCGCGACGTTTTT
TGTAATTAAATGTTTGGTCAGTGGGCAAACTTCAACTCGGCGCTCGATTCGAGCACTAAA
AAGAATAAAACAATGTCTCGGAGCTGCCTGAAAGCCAAATTGTTGCAACAAGCTCTCGGC
CGCATCAATTTCGTAATAAATTCTCAGAGCCCAAAAGAATACAGCGAAAAAATGAAGGTA
TTTGGCCTTGATGGTGGGCGTGGCCGTGGTTATGGCCAGCCCCTCGATGTATTGCACAAA
GTTCTTTCGAAATGCCCAGCATAATTTATTTGCTTTGTTCTTGCTGATTTTTTTTTTGTT
TCTTCCGAAACGCCCAGGAATCATGCAAATTAACTACAATTTTGATTTTATTTAATCCGA
GACGCCCTCTGTACAGCTACAGCCAAAGTCAATATAATGATTATTCTTAAAAATAAAATT
TAGAAAATCCTATACTACTTAAATTGCTAATACATGCAAATTTAAATTTTTAAAATAAAT
ATGTTATGAATTGAACAAAATTTTGTTTTATTTATTTTCCTAACTATTCCTAAAAAGTTG
AACATCATAGTGCATGTTCTGTGTTTGCCTCTTCATCGAATGTGAAATTTATGCTTTTGT
TTGGTCTCATATGTTTTATGTTTTTTCCATCAGCCTTTGTTTTTCTGCTTTACTTCTTGT
TTTTGCCTTATGATGTTATAACCCGCTAATTTTGGTTAATTATGGGTTTTTGATTGTCAT
TCTGCGTATCAAAAGGGGCTTAAAGAATCCCCGAGAACTCGCCTCTGATGTCATAATGTG
AAGTCATGTGTGTTTGCCAGTGTGAGATGGAGGATTTTTGGATAAAATAAACAAACTCAA
TAAAAATAAAATATTTGTCTGCATTTGCAAGTACAAATTAATATTTTGCATTTTTCATGA
AAATAAATAGATAAAGGAAACAAAAATAACAATGTTTATTCATTGTTTTGGGCCTTGCTG
CATGACATAAAATTTTGAAAAGCACATGTTGAGCCAAAAGTGACTGAATTTCCAAGTGAA
CATTTATTTTCTGCCACTTTTGTGCCCGAGCTACAGTTACACATTGAATTTCAAATGTGC
ATTTTTCGATTGCTCATTGTTTTGCCGTTGCCGTTCTCTGTAAAAGGGAAATTGAAAATT
TCAAATTTTGCCTATGCCAGCTGGCTGGCAACTTCAATTGTATTCAAATATTGCCGACAT
AAATTATCATTTTGTGAGCCAAAGTGCATAAGACTTTACCCGCCTGCAACTCGACTTCCT
ACCTCCCACCACCGCCCACTTTTTTGTGTGTGCTGCAGTGACCTTGTTACTAATAACCTC
AATATGAGTTGCACACAAGCACACACACTCACACTCGAATGCCGCCACTCTTGGCCATCT
TCCATTTGTTTTTAAAAGGGTAAAAGTCTTCAGGGAGTTCTCATGTTACTCGCTCAGAGT
TTTCCCTTTTTCGGTTTCACTTTTCACCAGTCGAGTTCTCAGATTCGGATTCAAGTGCAT
GACGAGAGCAGGGACGGTGGGGAAAACGCCCCAAAAGGCTGGTGGAGGGGGGGCGATTGC
GAGCGGCAGACCCTCAAGAGCGTGAGTGTGAAATCTTAGCCATAAAACATCTGAAGCTCA
TGAGGCCTGATAATTAGAGTACAAATCTGCTCGCAAAGCTCCAGCGAGCAAGGGAAAGTT
TGGTAAACAAGGGGTACCAAATAGTAGTACACTATATATACTACATATGTGGAGCAGATA
GCAAGATGCGTACCATAACTGTATAGCGATAAATGAATAAATTGATGATCGGCAGCGGCA
TGCTGAAAAAGTAAATTACCAACAATTTAACCAGAACCGTTAAGGCAGCGAGCCACGTTC
ATTAGCCTGCTCCTCGCATTTCCGCATCTGTGCCAGCCATCTATCCACGGGCATCTATCT
GGCGATCCCCAGCATCCTATACCCAGTTTGCCCAGCATCCCCAGCCATCGACATAGCCAT
TCCATCCTATCAGCTACAAATTGTATCGAGTGCAATGCATAGAATTTATTGCTTCCTGCC
AGAGCGCGATGCCAAAACCCAAAACTCCGACTCGAACTGCAACTCAAACTCAAACTGAAA
ACTAAAAACCGCCGACGAGTGCAGCAGCTGCTGATGCTGGACTGGCAATTATGCCATTTG
ACATAATTCATAACTGACGCTGCAACAGGACACTGAGAAAAATGAACTAATATGAGCTGT
CAAAATAAAATACTTACCTATGATGCTTCATAAGTATAAGTATTAGTATGGAATGAACAA
AATGAAATAAAACACTATGATTCCAAAGCAGATTGAACAACCATTATTAAACTGGATATT
GCAATTTCATTGGAATATTAAACTACAAAAAATGTTGCTTATTAATTTTCTAGATTCGTC
ACTGTGCACTAAACGTTTGGAGCAACCAGTTTTGGTAGCCCCAACACTGATTCCCGGCCT
TTGTTATCAACAATTTATGCGAACGAAAGTTGTTTGAACTGCGTCTTGACTGCTGCAGCA
ACTGCTGCTGCTGCTGATGATGATGATGAGTATCAGTGGTTACATGAGGGAAATTCATGA
GGGGCTTTCCACAGGGGGCTAACACGAGGGCATCCAGCAGGAAACTCATTTCTCCGGCTG
ACCACGTTGCCGCCTGGCTTCTTGGCTTCTTGGCTTCTCCTGGGAATCAGGTTAGCCTGG
CTAGCACGAGAGTAACCATATTTCTTTGCTTCTTAATAAATTGACAAAAGTTTGTCATAT
GCATTGTTAGCCAAGAGCCCCTTGGGCCCAGTTCGGTCCCCTTCTTGGCCCAACGCCACT
GCGTTCGGTTGTTTGGCAGTTACCCCCTTCGCGTTGGCCTATTTACCCGCTTTAACGCCG
AGTAGGTGGCTCGGGGCTTTGGCTTTGAGTGCGGAAAGCTACAACTGCAATTGCAACTGC
AACTGCGGCTGCAGCTATGCTGTTTTGATGAACTTTGGGCTGCAACTGTGAAAACTCCTC
GTCTCCCCAATATTCCTTCGTTTTTATTCAATGCCCTATAGCCTGCTTCTCGTTATTGAG
GTATTTGGGTTAGAGATAGTTCAGAGGGGGATGACATCTCAAGAACAAATTAAAATTTGC
TTGAAAGGCAGGCACTCTACGATGCTATTTTATTGGAATAAGTTCGTGTTGAACTTGGAG
CACAAGTACCTGGTCCTATTAGTTTTTCACTATTTTCAAGAGTGTGTATGATTCGTTTGA
TTATATGCCCATTTCCTTATTGAAGTTTGCAACTTTGCCGGCTAGCTTTCATGTTATGAA
TTGCAACTTGTGCACAAAGAGCATTTGAAAATTGTTTGCGGCAAAAGAATCCGTTGCACG
CCCCGAAGAATTTAATTAAAGTAGCCCCAAAGTCTGGACGCTCCTGTTTTTTTTTTGGGC
GCAAAAAAGAAGGCAATCGCAGTTGCATTCAACATGAGCAATGGCAAACAAAAACTGCTG
GCTCTAATTACCTGTGCATCAACTTTTCCCAGTAAATGTTCATATTTATTTTTGCAGTTG
AGCAATTTTTGTCGACGTTTTTCTCTCGTTGTTTTTGCGATGTGAGCATGCAACACAGCA
ACAGTTGCCGGTGCAATGTGTTCTAGTTGTTTATGCATTATTCACATATTTATGCTGCAT
GCTCAGTTTCAGTTTCAGTTCACTGGGCTTTATTTTTACTTTCAGCTTACTGAAAGTACT
GCAAATGTGGCACATGACGACGGCACAGTTTGCAATCAACAAAAGGAGAAAGGGCGCCGC
CGCCTCTTCATATTTGTTTTTTTGCGAACATGTAGAAATCCCCGTCGGTGGGCCAAAACT
TTGTAGTTTTCAGCAGCCAGCCAAGAATTTTCACTTTTCATTGCTGCAGGGCGGCAGGAG
CAGCGGCAACATTGCATGCCACATGCAACTATAATGAAAATCAGCAGCAGCAGCAGCAGG
TTACAGCCTTGTTACTGATTATTGTTATTTGTCAATGATTTAATTCGGATTCGACTTGAT
TGACAGACACTCGAAAGTCTGGCTCAATAATTTGCCAGTCACTTCAGACTGTTTGCAATC
CTAGTTTCAGCCTGCAACAGTTCAAGGTTGCCAGTAAACAATGCCCCAAAAAACTTATTC
AATGCTAGATTACATAATCGATTGTCTAGCCGAAATTCATCATTTCAGTTCAGAGTGTAT
TCGGACCCTTTTGGTTGTGCGATTCGAGCAGCTTCCCCTTCAGATACTCGGCGGAAAATT
GCATTTCACATGCATGGCCTCAAAACTAATTACCAACTGAAAGTGTCAGGCCATTGAGGC
CGCCTCTTGTAGTCGAGTGTTCATTCGGCTAGAGTTCTTTCGGTTCAAGTGTCAAGTTGA
AAAAGTTTGTCTGCAACAAAGGCAGTTGCAACAAAAAAGCTGGCAAACTAGACCTACACA
AAATGCTCATACGTAACTTTAAGTGCAGCAGACAACATAAAAAATTTACAATACAAAAAA
AAAAGAATTGAAATAGAAATGGAGGATAAAGAAGCAAAAGAGGTTTTTCGGTGGAATATG
AACCACATTAATATCCTGTAAAAATTAAAATTATGAACCACTATTTTCCGTAACATTTCT
GAAGCTTTAAAATTTTAGAGACACCCCAAGGAAAATCAGAAACCAACCCGAAGAATTCTA
ATCATCATTAAAGTCATGGCATATATACTATATAGCGCAAATACTGATTTCGTAAGGGCG
TAAAAAGAGGTATAAAAACGTCTTAAGTTATTAAAAAATGGCGATGGAAAAGAAACCAAG
GAGGTTATACTGAGAGAATAATATTTAATAAGCAAAAAATACATGTTAGTTTTGGTGGAC
CACAAAATGACTGAAATTGTGAAAAATCTTGCTGAGCAACGTGCAACAACTTAAGATGAT
AGTAATATCACATGTAAATCGGTATCACAGAATGAATCCTAAATAATTTCTTTCAGTGCA
GAAAAGCGAATTTTCCTATTTACTTTTTTTTTTTGTAGCTGTGTCTCTGAAAAATGGCTG
CAACATAAAAATTGACCTCAGCGACAAAAGGCGGCCAACGACGCCGGCAACTTTAGGAAG
CAAATACAAGCGGCCAAAATGGGGAGCAGTGGGGTGGCAGGGGGGGGGCTGCCCAGGGGC
GATGGTAGTGGAGGGGGGGGGGGGTGGAGCACACACTCAAAAGTAGAGCAGCAATTGCAA
ACTGGCCCGGACCAAGTCAAGTCGGGGCAGCAGCAACAACAACCGGCTGGCCAAACGCGA
TCAGCAACCAAGTTTAGGGGCTTGGAAATTTGGTGGTGGAGCAGCTGGTGGAGCGGGAGG
AGGTCGTGTCTTTGGTGGGCAGACAAATTACAGTAGCCAGATTTTCTCGTCTTCAATGTT
GTTTTGCATTTTGCACTCCGGCCACGCCCAGTGCCCAACGCCCACCGCCCGTGTTGTTGC
TATTTAAGTTGATGTTGCTGCTGCTGCAGCTACACGCGCTGAACATGTTTTTTGTGCTCT
GGCTATTCATGGTTCTAGTTTTTTGTTTGGTCAGTAGTTTTTTTTTATTGTCGAGCTCTT
TTTTTTTCTGTTGTTAGTTCAGTTTCTAATGCTTTCAAGAATGTGGTTTACTTTTTGGAT
GAGTTAACAAGCTAGCCCACTGTGTATGTAGTACATGTGCTGACCATTGTTGCCATATGC
ACACGTATGCACTTCTATACGAGTATATGAGCACCTCGAATTTGTCATGGAAAGTGTTTG
CTCTAACAACTCGTACATCAGATGCAAGTGATAATTTGAGTCGAAACTGCGACGTGACTT
GGTGAATAAATCAATTTATGTTTACTCTTAACACACTACCCATCAGATTTATGCCCCATA
AATGTTGAAGTATTTTGTTAGAATTTTGATTTAATGCCTCGCAAATTACTAAAAAAAAAA
AAAAATATGTTTTACCGCTTCTGCTCGTTACAGAAAAGGCTACTGAACTGGTTTTAACGC
ATCTCGACGTGTTTGTTTGGGTAAGTTGGGGATAAACAAATCTCGAGCTTATTTGCTTAT
TAATTTTTGCAAATATTGAATGGCAATCAAGCTAGAAGCTCTTAAAATTTTCTAAAGGCA
CATTCACAACATTGTTTTCACATATTTGGCTATTTGTTTTCATAGACTTAAACTCATGCT
ACTGAATAGTTGAATACCAAACCGAAAACGTTTTTAATTAAACAATGAATTGGGATATCA
ATTTTTAACATATCTTGCGCATGACAGCAATAATCTAATAAAATATGTAAGACCCATTTA
TATGTTTGTGTAAAAAAAAAATGAACTAGTTTTGCGATTTAATAGATATTCCCATTTGGC
ACTGGTTTGGCATGAGTTCGAGCGCATGGCTTCCTACTTCCATGCAATTTATTAAAAATA
AATGCAAATTCGGAACGCAGTGCTCAGTGTGCCAAATGTGTCAATTGGGGGGCATCCCCA
GCTCCACTTGGAGTGAGTTTCAATCGCTTGAAGTTGGTGCTTGGTGCTAAGTGCGTTGGC
CTAACGGCAACTTTCTGGCTTATATATGTTTGTGACAGCTCGCTGTGGCTCATATGGTAA
TGAGGCCTAGTTCTGTTGACCATAAACAGATTATCAACCAATATTGCCATGCTCACTCTT
CTTTTTATTGCCATTAGACGCGAAGGAGATGCTTTCAAGTTGAGTCATAAGATGGCATTA
GCTTGATTATGGCTCTACCAGAGTGTTTAATACGCACTTGATGCCACCTCTCAATCTGCG
GCTTTTTGGCCAACAAGCTCGATGAGGCGTGGCCCCATTTGCCGCTTACGTCTTTCTCGT
TTTTGGGTCTAGAGGAATGGCTTCGAGGACGGGGGCTCCGACCTGCCCACGCTTCTCGAG
ATTTATGGCCAAGTGTGCGCTCGGCGTCAGCGTCGCTCGTTCTCAATCTAAATCTAAATC
TGACTCTGATGGTGACTTATTTATGTGACTGGCGGGCTGCTGTTGCTCTCTGAAGAGGCG
TGGGCAGCTCCACGAATTCCCAAGTGCTTTTCGCCGCCTTTCTGCGCGTTTTTCGGCAGC
CCAAAACGGTTGCAAAGTGCTACAGTGCAGAGAGAAAAAAATTCCAATCCATATCAATAA
TTTCAATTTATTTGTGACAACATGTTGTCACATTTGTAAGTAAACATTGAAGTATCAAAT
GAATAATAGAATAGTATTAGTAAACAGTATCTATGGATGTTTTGTATTTAAGTATTCAGT
ATTTAAAAGAATTTACTTTAATTTGATTATTATTATTTTTTCTTGTGCTGCGCGTTTCCC
TTTAGTGAAATTAGTTAGCCGCCTTCCGAGCTCGCAATCTTTGATTTATTGCTAATTTCG
GCAGCAAGAAATTCCCTTTGCTGTGGCAGTTGCAATACGGTAGCATTTTGTTGCTTTGAC
ACCAATTGGTGTTTTCGGCTGTCTGTGGCACGCTATTGTGCATTGTTGCTGCGATGTTGC
TGCTCCTGCTGCTGCTGCTGCTGCTGTTGCTAGTGTTGCATGTCAGTCACTCAAATGGCT
GACAGCCAGCGAACTTCGTGTTCGAGTTCGAGTTGTTGCTGCAGAAGCTGTTCCTCAAGT
GGCCCACTGAAGGTCAGGCAATTGGTGTTGCTATTGCCATTGGTAATGCTCCCATTGCTG
TTGTTGCTGCTAATACACTGGTTGTTGTTGCCGCTGCCACTGCATCGCAAAAGTGATCGA
AACAATGTGTTGAGAGTCATCGAATTTTGAGCACTTGAATGGTCAATGCCGCTTTTGTGG
TCACACTTCAAATTGTTTGTTTCAATCACTTTTGGTGGTTAATTACAATGCCCACGTAAA
AAAAATTAAATTTGAATTCACAAAAACATTTCTACTAGCACTTTGTTTTATAAACGAAAG
AAGAGTGAACAGATTATGGAAATTATTTACTGTCTCCGCCGAGTAATAAATATTATTTTC
CCTATTGAATATTGATGTCCCAACAATATTTCATGACTCAATCTTGAGCAATTTTGCTTG
GCAAAAATAAAAAAAAAAACAAAACAAAACCCAAACAATACGAAAACAATCAAAAAGTCA
AATGAAAGCAAACATTTGGCATATCATGAATATTTTATGAACTGAACACAAACCCGTTTC
GTTCACTTCTTGACTGCCAGACTTTAACTTCAACTTCATCTTCGTCGGCGGATACAGATA
CAGATACGTATTCGGATTCGAATTCGAATTCGTTCGACATTTTTCGCGCCGCCACTCACT
CACTCACTCGCCCTCATTACAAAACACAAATCATGCATTGCGTTTACTTAACGGTTAACA
AAAAGCTGACAAATTTATTGTCGCCGGTGACATAAATATCGGTATCAGAGCTCAGAGCTC
AGACTTCAGAATGCTGACCCACTGGCGATGTGTCGCGAATTTGCCAAAAGATCGTGCTGT
AATTGACATATATACGGGCAGTATATATGGCATATATAGTATATTGCCATATATCAGGTT
CTCATTATGCATGACTTTGGGGCCAAGACAAAAGGCTGAAATGGCGGAGAGAAAACGCTT
GTGAAAATAATCAAAAGCGTTCTGCGCAGTTTTTGTGTGGTCGCCGCTGCAAGATCAAAG
GAATAAATACATGAAACTTACTTTTAATGAGGGTCACATGGCTGACGGTTGTATTTTCCT
GCTGGAGAGTTCATCATTTTGGGTTAACTAATTTTGGATTCTTATCTTGGCTGTGACACA
AAAACACCACATTAAACCCAATTAATATTTCCACAACGGGAATTGTTAAGCGTGTGATCC
ACTTAAGTGGTCTTTTAACCAGCAACAAACAATGATTTTTCCATTCTTAATTGATATAAT
TTTATATAATTAAGGATGTCAACTGCATGACATTTTTAAATACAGAACGGTGTGGCTTTA
AGTTTGGAATATTGGAATAATTTTTGAAAACAACAGATGTTGCTGAAACGTAATATTTAG
TTACAAATACGTTTTACTTTTTTTCGTAAATTTCTCTGAACATTTTTGGGCATATCACGC
GTGTATTTCTGCATTCTTTCACTTTCCGCTTTTGTGGCCCATATTTGGTAACATCTGATT
AATTTTATGCATATTTCGTAGCTATCTTGCTAATGAACTGCTAAATGCCAAAATTGGGTT
CTGAAGGCGCGTTTGAGAAATTTCACTTTTCCAGCTGAGCATTGCGAATGCAAACTCCCA
ACCGGTTACACACACAATATCTAGTTTAAATTAATTTCTTTCTCGAGCTTTGTGTGTTTT
TTTTTGCCATTTTTAATTAAAACATTTCTGCTGAGTGAAAGTTTTTCCCCTTCGCATTAG
CAGATCTTGCTTGTTTTTGCTTCTTTAATGGTCAATTGTCAGCTTCCGTTCTGCAAAAAC
AAAACAAAAAAAAAAAGAGATAGTCGAAAAGGCAGATGAAGACCAAGATGAACAAAAGAC
AATTTTAATTAAGGCCCAAACAATGCACAATTTGTGGCGAATTAAATGGCATTTTTCCAC
TTGACAGCCCGTCGAGCGAAATGACCAAAATGTGCCAGGCCAACAAATTGTGTAGCCAGT
TAATTAATTGGCTTAATAGCTCACAGATGTTTACACTTAAATCTGCATGTTATTGTATTC
GCTTGACTTTTTCATCATGCTGACTTCATTTGAATGTTTGGATTATTCGCTTTAAGCACT
TGAGGTGCTTCAAGCCTCCGAGTTTGGTGCTGGAAATGTCCTTCTGCCAAGCCAGCGAAT
TCTTTAGAGTGCATTGACTTTGACTCCATCTCTGGCTTTTGGCCAGCAGTTCGCTTTGGC
CAATCCATGGGCTGAATTTAACACCTTTTTTGTTACGGCCGCGCATGTAAAGGCCCAAAA
GCAGAACTAGACACAGTCGCAGTGCCAACAATGGTTGTTCTCTGTTGCTGTTGCAGCTGC
CGCAACAATGACAACAGCGGCAGCAGCAGCATCTGCAACTGCAGCAGCAACAGCAGCAAC
ATCCACGGGCAAAACCCTTTAAAGGACAGCGGCAATGCACTCAAAAAACTGACGACCCAA
GAGCATGAGTCGCAGAACGTGACGTGACGTGATGCGACTGACGAACAGAAAACGGAAAGC
CATCCGCATTTAAGTCTCAAATTGATTCTCCCCAGACAACAATGCGACCTTGCTTTTCTT
GCAGTGCACACAGCGCGAAAATATTACCAAGTTTATGATCGTTTTGATCAAAATCAAAAT
CATACCGAATGTATATTTAAGCTTAGTTGGAAACTTATTTTCTGTAAGTTAAACATATTT
TTATTGATTTTCTTTATTTGATATCCCCTATTTTTCACCTTTCATTTAGACCTTTTAGGG
CTTCATATATTTCTTGCAGTGCAGCCGTTCTAAGCTGCCGTGGAACCAATCTGCTGCCCC
TTAGAGACTTGACAATTGTTGGCCATAAAAGTGCTAAGCAGTTGGCCATTGGGCCCAGCA
TTAGAGCCACGCACAGCGGCCGCATCAAGGAAAGTATAAACAAAAGACTTGGGCAACAAA
CTTGACCCACCCGGGCCGCTGCTGTCGCTGCTTTTTTGCTGCCTGTTGCTGCTTTTTGCT
GCAGCACCTAAACAATGGCGCGTGCTGCGGTTTAAAGTTATAGCCAAAGCCATGGAGTCA
AAGCCTGTTTTGCGCTGGCAATTGCGTAGAGTGCTCAAAGTGCTACATAGCTGGCCAAAA
ACCTGCTCTGGTCATGAAACTTACTGCACATTACTGCCATCGAGTTAGTTCTGCTTTCCG
TGGCAGCGATCTAATAAAGTCAGGCCAAGTCACTATGGGCCATGTGGCTAACGAAAGTTA
TTTATGCACGAGCCAGTCTACTTAGGTCGGCCTGCATGCGTCATCGGTTGCTGTTCATAA
TTTATGCCAAGTCTTGGCCCAACCAACCAACAACCAACAACGAGCAACCCAGAGAACAGC
AACCAAAGTTGCTGGCGTGGGTGTTAATGGCAAACAGAGCGGCAACAGCAGCAGCAAAGA
CACTAAAACACTTGGCTCTGTGTGTGTGTGGAAAACTGGCAAGAAGTTGGCAGTCAAACT
ATTCGACAATGAATTACCCAACAATATGGTATATGGTTGTCATACAAAAGACAGGGGGAA
AGTTTTATATTTATTTCATAAATATAAAATGGTCGTCATTACTAGAATATTCGATTTCAA
GGAAGGATTTTGATTTCCTCTTACAAATGAAAGCTACCTTCTTGCATTTAATTATATTGG
AAAGTAAGGAAATACTTTTTTTATTAATAACAATTTTGTAAATTCATTTTGTCTTTCCGG
GTAAATTTTAGAAAGCAACCACTTTTATTACCGAGAGAGGGTTAGAATAATTAAAACAAA
TCAATCTCAGGCTGCAGGATACAATAAAAGCCTTTCATCCCGTCTTTATTGCCTTTACAT
TTATGGCATGCAATTTCCAATATAAGCCCCTGTAAAACTATACCCATTTCCTTTGCAAAA
ACAGGGTATTCGACTAGAATTGCGATGTAGAATAGAACAGCAGCTATAGCTGTACTGGCA
CAAGAGCAGCACCAAAGGGTCGACGACTTCCAGCGCCCGCATCGCAGGAAGGAAGCCTGC
CACGGCAGCAGTCGTAACTGCAACAGCAGCAGCAACAGCAACTGCAGCAGCAGCAGCAGC
TGGCAGTGGCATAAAGCAAACAAATGGAAATTGTTTAAAGCCAGCTTTGGTTTATGGCCT
TTTGCATGGACCCGGGCCAATGCTAATTGCAAAGGAATGTACAAGTCCAAAAACAGCGGG
CGTGGGTAGCTCTCGGTTTGCTCTTGGCCACAGTTAATTGCCAAAAGATAGAGGGAGCCA
ACATTTAAAGTCCATCCAAAAAATATACACTCGATTTTGGGTTGGCTTCAAGTAGTTTTT
CAACAGGATCTTTATATAAAGTAATTCATTCAAGTGTTTTTGTAGCACCGTGCAAAGTAT
TTTTATATAAATACTTAGCCTTTATTATAAATAAATTGTAAATAATAGCAGTTATCTAGA
ATGTCATAAAACCATAAATTTTTATTTGTAAACTGTACGAAATATAACTAACTCCTCTGG
TTTGACGTCGGGAAATTGAATGCCTTGAACGACTCGCCCGCTCCGCCGAAGAACTTCGAC
TGGAACTCCACCCAGTGGAGCCGCAGGGTGTGCAGGAAGGCGCTCAATCCCTCCATCATC
ACCAGTATGGCCACTGTGAGAATGGCCCAGGCGAAGAAAGTGGCCATGAGCACGGGCACA
CCATAGTACAATGGCAGAGTGTTGGCGAATCCCTTGGTCAGAACCATGTGCCACAGGACA
TCGGACAGCTGATCGTGTGCCAACGAGAGGGCCCACAATCGAAGATAGGAGGCTGTATGC
GATACTGAGCCCAATACCGTTTCGATAGTGTGAATTCCAGAGTGAATCCAAATCTCCGAC
ATCTCGTGCTCCTCCTCGTTGTCAACGCTTTTCTGCCTGCTGGTCTCACTGTTATCATCA
TCCGTGTACCGCATTGTGGATCGCATTTCCGCGATCGTCTGACGTCGCATCCTCTTAAAA
TCCCGTTCCCGTTCCTGTTGCATTTTTCTGCGACGACGCATGAGATATATCGGCTTGCCG
GCCAATAAAATGGGTATCGTACAAAAGGCTATTCCTACCAGGGCGAACTCTATCATCCGC
TCATTAGGATACATATAATCCAGGCAGTTTTCCACCGGGTCTTCCTTTTTCATCAGCATC
ATGTTAATGAAGGTGATCAGAACGGAGGGAGCACACGCAGCATTGTAGGGCGCCGGCTTA
TGGCCTCCGTACGACATCCACTTGTAAAAGATCAGAAAGACGAGGTAGCCGAAGAGGCAC
AGCATGAAGATCATCTGCGGAATGACCACCAGAATGAGATCTGCTTTCCGATTCATCAGC
ACACAATTAGCGGCAGCCAGGCCCAGTCCAAACATCATTTGTGATATGCCCAGGACAATG
GCCATCTTCATCTTCAACGAATTGGTCGTGGTTATCGAGTCCTGTCCGCACACGGCCCAC
ACTGGATCCATTCCCAATGGATACGGATGGCCCGAGTAGAAGTGAGGATGCGAAGAGTCC
AGGGTCACATGAAAAGCGGGATCATACACAGTGGTCTCATTGTATCGACAACTCCAGCTC
GAACCAAAAAGATTGAAGCCCTTGGCCATGACTATGTTGTAGACTAGGCCCATGTAGACG
GAAAATACACCCATCAGTAAGATTATGTAGCGTCCCGCATATAGGATATTCAGGATCTCG
TTCTCCGAGGTCGCGTTAATCTGATACTTTTCGATCTCCCTGTGCTTCCAAATCATGAGC
GAGGAGAACAAAATTAGCAGAATTCCATGACCCAGATCGCCAAACATAACGGCAAACAGG
AAGGGGAATGTGATGATGGTGTACGGAGCGGGATTCAACTCCTTGTAATCGGCCATACCA
TAGGCGTCTATTAGGTTCTGGAATCCCCTGGTGAACTTGTTTAGCCGAAAGTACGTCGGT
GGCATATGATTGACCAGTCTGTTTTTCTTTAGCAATATGGCTCCAGCACTCATATCCTCG
AGCGGCTGGAAGTCGGCTTCAATGGGATAGGGAGTAGTATTGGGCATTGTTTTCATATCA
TTCATCTCGTCTTCATCGGATGAATCAATATTATCCGCACCACCACTTATTCGGGACGCA
TTTCGTAGGATTACCTCCACTTCGGGAACATCCGACGATGGTATATACACCTCGGCCAGC
AGATAACGAGGTACCTCTACTCCACCCACCAATCTCAGGCGATTCATCAGATCGTACACC
TTCAGCGCTTTGCGCAGATTCACACGTATAATGAATAGATCCCGACCAGCAACCTCCAGG
ATCTGGCGGCGCATCAGCTCGGCCTCCTTGAGGACCTTCTCCACGTTCACTATCTCCTGG
CTCAGCTCCTTAACCTTATCCTCCCGCTGGCTGGCAGAACTAGGGCAGTCGTAGATGTTA
ACATGATAGTGAGCACATATCTTAAGCACCTTGGGCCAGATCATCGTTGAACTGGCCATC
ATGAGAATTGCAAACTTGCGCACCCTTTCCGGCTTATACCCATAATGATATTCGTAGACC
GGACTAGGCATTTCGGAAAATCGAATGATCAGGTTGAAGGAGCACAAGCGGTAGAGCAGC
AGCTCAAAGCTATAGAATTTATCAGCTCGGATGCAGCCGATCATATAGTTCAGATGAGCC
GGATAAGCTCCAGAGGTGGTCGTGGCATCCTGAACCAAACCAATCACTGTGCTCTCCGAA
TAGAGCAGTTCACTGCCCATGTCGGAAACCATATACTTGTTGGCCTTGTTCAAAGCGAAG
CTGTGCTCCATCATCCGATTTCGACGACTGTCCAGTCGGTAGTAGTGCTCCGTCACGGCA
CTGGCCTCCACATGGATGCGTTTCAAACTATCACTATACTTGGCCAGATCCTTCTCCTTA
AGCCGATTCTCTCGATCGACATCCGGATAGAATATTTCGTTCACATGCAATTGGACGATG
TAAGTGTGCAGACTGTCCACGATGCGCAGTAGCTCATAGCACTGCGTCACCTTTTTGGAG
TAGAGGTTGTTCAGCAATCGGTCCTCATCGTAGACATTGTTGAACTGCACTGCTCCATGG
TGTCCCACCTCTATGAGGCAATCGAAGGCGTTTTCCGTGTGCAGCAGCAGTTGGCACAAA
TCCATGTCCTCGCTGCGGAAAAAGGACTTGACTTTCGTCTGCCGTTTCTTAAATACTCTC
ATAGTCCCGAGTGTCTTGTGTCCAATATACGACAATTAGATTGAAAAACGAAAACTAGTA
CTTTGTTTTTTTGTTTCATAGATAAAGATACAACTCCTATAAAAATATATTCCTTTAAAA
AAATGTTTAGGTTAAGATTTTCTCGGCCCACTTGGGTTTGGGTATTTGACTTCTGCTAAT
TGATACGTTTGTTTGCCTCTCCTATTGTTGGCTCTATTTTTTTGTATTTCTTTTTTTTTT
TGTTTTTAATTCGAGTAGCAAACATGTCCAAGACCAAGCTGCCCCTTGCTTGAGATCAAC
TGCAGATAATTTCATGGTTTGCATGCAAACTAGTTGCAGTTGCCAGTACGGCCACGCCCA
CTCCGCCGCCCCCGTCGCCGCCACGGTAGAGTGAACCAAAACTGGCCAACTGCAATTTAT
GCCCTTGTCTTCGCGGCTGGGAACACTCATTGTCAGACTGCTCAGAAATTGTGGGAATTC
TTGCATATAGTTAGTAATTGCCTTATACCTAATATGCCATACATCAGTGGCTTTTATAAC
TAAGTTCTCACTTTAATTAGATTATTACAAAACGTTCCAAGGATTTATTATTTAAATTAG
AGTGCTGGAAACGTTGCCAGAAATTAGTAATAATAATGCCTATAAATGAAAGACACGTTA
CGAGATTTGTGAAGAATAAAAGATACATAAATATTTTGATTGGCCAACACTGAACTATAA
TCAAACGATTTGTTGACATAACACAACGGTATACATTTTTATGACATCAGTTTATGATCA
TTTAGTTTAACGATAAAAGGTTGTTTACAAATTCGGAAATAAATTTACATATTTGACCAA
ATAATGGGGCTTAGAATATATCAAGAATGTAAAGAATTCATATTGAGATTAGAAAGTTGA
ATCAAACTTAAGATATATTTAATGGCTTTTCGTTTATTCACAGAAAACAAAGCCTTTTTT
TCACACATTTTACTTACATAAACATTTTTGTTAACACTTTGTGGGAGCTTCATTTCATTT
TCGCTCCGAAACATTTTCCCATAAAAATCGACTTCACATTCAAAGACATTGAAATTGTTT
GGTAATTTGGCTCTGTGACTGACTGCCGACCCTATAAAATGGGCTCGAAAAGCATTTTCG
ACTCATTAGCCGATGCTAAATGGAAAATGAGCATTACTCACTCAATTGAAAATTGTTTTG
AGCCCGTTTGCTCAATTGTTAGCACTTCCACGACAATGAAAGTAAAAGTGCCAAAGCCCA
AACTGCACTTGATAATTTCTTTGGCAAAGCAATGCCTTGACAATAAAAGTGCTATTGCCA
TTGTTAAGCGGCAGTTCGATTTCATTAGGCCGCTGGCGCTGCACAAAAATTAAGTCACCG
AATTGAAAGTTTCGAAAGCAAAAGTGAACAAAACCGCGGCGGAAAGTTTTCACTTTTTAG
CTGTGTGCGACAATTGCAGGCAATAAATCAAATCGAAATCAAAGTCACTTACAGAACAAC
GGGCTAACACGTGTTGTTGCCGCCACATGAATGTGTCGAAAATAAATACAGAAACAATGT
CAATTTGTAGCTGACGGCAGAGGTAGTTTTCAAGATTCATACTCGTATTTGAAGAGCTGA
GTCCATAAAAGGAATCGAGTTGAGGAGTTCATTGTCTGCTTGAGTGTTTTCATAAACTAA
TTTGCATTTCTCTTTTGCTTACTCATGTGTTTCTCTTTTGCTTTTTGCAGTGGTAATGTG
ATCGGCGCGATCTTCGGGAGCAATTAGAAGACTAAACAAAAGGTAAGCAGCAGCTGCCAT
CGATTTTGGCATTACGCCCGCGCACATCTATCTCAAGTCCCAATCCAATCCAATTCAATC
CAAAACAATCCATTTTAACTCACTCACTTTTCGCGGCGGCAAAGAGAAAGTGCATTTCAT
GTTTCTGGCCTCTTGGCCAAGTCTGTAATTTGCCAGAACCCGCAATTAACGCCTAAACAG
ACTGGGCCCAGTTCTCTCTTTCAGCTTCAGTGTGGCAGTGCCAATCAAGTGCGTGGATCC
CAAATCAAGTGGACTTTGAAGTTAACATTTCATTTCGTTTCGTTTGCTTGCCTTTTTAAT
TATAGAGAACCCGACTCATAAAACGCCGTGTGGGTGTTTCCCCACAGAATTGGGTCAAGT
TTGATGTGTTGGCAGGGAAAACTGGTAGCGAAAGTTGAAAGTGACATTTTTGGCCCTATT
TTCGGGGTGTTCTTGAAGTCACCTCCACGTTTATATATACGGCAAAGTCCAAAACTTAGG
TAATCCAACGCACTAACTGCGCTCATCAGGTTCGTCGCTTAAGTCATTCGTTTCGGCCAC
AGACGCCGGTGCGTTGACTTATCGCTATATAGACCCGTGGACTTGGCACCGTTACTAGCC
AGACGGCCAAGAGTGGCTGCCTCAAATGCTGCCTGACGGCGGCTTCATTAAAATGTCTGC
CTGCCAGATTGGCCCGACCAAAACCGTTTTGTTGCTTTTTAAGAATACCTTTTAGTTAAG
CGGGTAGGGTATCTTTGATATTTACAAACTTACATGCGTCTAGTTTAGAATCAAGCAAAT
ACATTTTCAGAACTTAAACATTACTCTTTACATATACTTGAGATATATTAGTAGGTTCGC
TTACAATACTTGGGATCATTGATATGCGAGTATTTAATGCAACATAGTAACTGTGGATAA
AATGAATGCGTATCAAATGCGACAGGTATGGAAAATTAATTTCCACTTAGAGTATTTCGA
AGTTCTGGCGTCGGTTGAAAGAGCTCTTCTCGTTTGAAATTGAAACGTCTCTGTCTGGTG
CGTCGACTGCAGCGACTGATGCGGCAACCAGTTGCGAGTACCTTGGCAAATGCATCATCG
TCTGTGGCACGTTGTGGATGTCAGCTTATCTGGCCAGACGAACGCATCGCAGGGAGTTAG
CGGGCTTGAGATAGGGGGGCCTTAGCTTTAGGCCCGCTCAGGGTCTTTTGGTCTGAAGCT
TCCGTCTGGCCCGGTCAAAATCAACTTGAGAACATCAGCATTGGTTGGAGCTTCGAGTTG
GGCTCAAAACTCCAACGCCGCCGCCACCAGCGAACAATTTTCAATTTGCCAATTGTAGCA
GTAAACTTCTTTATAGCTGTTCTTTCTCTCCGGCTTCTCGGCCGTCTTCTTGCCTTCTTG
GCCATCTTCTGTTTGCCGGTGTACCGTTAGCTTGGGTGCTCATGTGGATTGGCTTTAGGT
GTTTGTCTTGACTCCAGTTGTCTTGTCTTGACTCCACTTCACCTGTTCCGTCTGCCTGTG
TATGTTGGCCATGTGTGCGTGCTGGGCTGGCCTCCACTAATTTGCGACAATTGGCCAGGC
CATTAGCCGGGCTCTCGGTGGGCCGAAGGGGGCGTGGCACTGGCCATGGTCGGGCAGCAA
GTCAGCCAGTGAAGTGAACCAGCATATATATCAATTTATCGAGGAATTCTGGCATGAAAT
TATAAATGCAAAGATCTTTCTTCGTTATTTTGTTTTCGGTCTCTTGTGTGACTTAACTGG
CATTTGATGGGGCACTGGCCGCAGCGAGGGTTGTTACGGAAGTTCACTCTAAATTGGAAT
TCGGACATAATTGTAGTTGATTTGTGTGTTTGAAGGAAATAATTTTGTGCGAGTTCCATG
AAATCAAAGGTCGTTGATGGGATATGAATTACTGACGTGTGGAACATTGATGAGTTGCGA
TTTAGCAACATTAAACTATATATTAAATATAATTTACACAGAAGCAATAAATACAAGCAT
AAATTATTTTTCCTTGAAATCAGGAAATTCATTTTGTTGTAAACGAAGAAGTAAATACTA
ATGGTAAATTAGTTTTACCAATTATATAGAATTCAATCAGTAATCAAATACCTGAAGATG
TTCCAAGGAAAACGTAAAACAGAATTAGCTGTAAAAGAAGACTGAAATGGAGGTACATAT
CTCTAAAATACGAACCCAACTGATTCATTCCTAAGCCAGTCGACCATAAAAACCTCTACC
CATTAAGGCAAAACCCCAATTAGTGAATGACCCTTCAGGTCGGATTTATGTTCCATAAAT
ATCGAACAATTGACAGACAGTCGGCGTTATTCTTGCACCGGTGGCAGCTCTTTGGCGTAA
CTGCAGCGACCACAAATCTTGACCAGCCGTTTTCCGCTGGTGAAAAAAAAATGTACAAAA
AAGACTGCATATGGGTGGCAATTCATTAGACACACGCTGGTTTGCATGATTTCAGCTTAA
GGTTTTTTCCTTATTTCGTTATATTTTTCCCATTTTTGTTTTTTTGGTTTTCGTTTGGCA
ACATGAACGGCCAAACATGACCCAAATTTCGCCTATGACCGCACACACATGAATTGCAGT
GGCGTCCAGGCCCAAAAGTTCCACCCCCACGGCGAGGGGGCTTGGGTTTCCCCCCTCCCA
TCCTACCAAAAAGTGCGGCTCGAGTTCAAAGTGAAACTGTGTACTTTGATTGTTGTTCAC
ATGACCGCGATGGGTTTGTCAGAACCTAATCAACACATCATCAATAACAGTGGGGCATCG
CCACATTTTGGCGTTGCTGTTTGATTGGTTCTATGTTGGAGATTAATGATACACCAACAA
CACGAACTCGGCGAGAAATGCAAACACAGCGTTGGGAAAATAAAACAGCAAACAAATGGC
TAAATCAAATACTGCGGGATTAGGGGGCTACTTCGAAATGAACGTTGATTATGGAGTTGC
CAAAACAAAAAAGCGGCTGAAAACTTAATGAAAGCCAAACCGAACAGTTTGTGGTTTTAG
CAAATTTTTCCAGTGGCTCAGTGGCTCAGTGGTGGTTTGTGTGGGTGTCGGTGGCTGTGG
CAATCTGATTGCCACTGTCCACTGGCAATTTGATTGCCCCTCTGTGGCACTGAGTGGGTG
CCACTGCTGCTGCAATTGATGCCTGCAATTATCCCCAAAAGCCACACAAACAATGCGCAA
ATTAAACGCAATAAACAAAATCAAAGAGTCGAGGGGAGCGGAATTACTGGTAGCCGAGTA
GGTGATTACGCGTTGAAAAATTAACAAACTGCAGGGGAGATAACGTTTTTATGAGCGGTA
TTGTCTTGTATATGTATGTGTGTAAAATGTTGTATTTTGAATGTTTACCTAATTGATAAA
ATTGTTAGAAAAAAAAATTGTTAAAATTTTATTTATTGTACACTGTACTATATGCTTAGC
TTGCAAAACTAGGCCACAAGATGGATATTAGCAAAGTGTGTTCGATCCGAGAATTTGCTC
TCATGAATTATGGAGCAATGAGGCATATTATAGGAGGTCGATTGGAATACATTAGAGTAA
ATAGAGATGGAAGTAGGAAGCTCTGTGGAGAAGCTCGTGGCTTTAAAAGTCGGCAGCTGG
CGGCACAGGGTCGAAGTGGCTTTGGTCGAAAGCCCCGCGGCGGGGGCCAATGTAAATATT
TTACGCCACAATTGGCGCGTTGATTTGTTGCATATTAAACAACGGCCGCAGGCTGCGTAG
GCCGCTCCACCAAAATACCACCGAACCCCAGAGCCACCGCACCACCGAGTGGGGCACCAC
CGATCGCAACGTGTGTTTGTGGTGCAATTAGCTTTTTTCCGCCGTGGATTTCTGTGGGGC
ATGGCATTGGTTATGGCTGCGGCGCTCCCGTAATTTGCTCATAACCCGGCTAATAGACAG
CGTCAAAGGCCCGAAAGCCAAATTGGGTGTGTACCACTGTGGTGTGTTGCCACGTTATAT
GTGTGGCTAGCAGCGAACCGCCAGCATTTAGCTGCTGCCCAATTGCTCAGATGGATGGTT
TTAAAGCGCCAGCCGATTTTTGGCCACACTTGATGGCGGCCAAAAGCCTCGAAACACGCG
CCAGGAAATTGGTAGTGGGGCAGGGCCATAGACGTACACATTTGTTTACCAGCAAGTGTT
AGGCAAACTACTAACTACGGCCATAATTGAGATATGAAAAAGCATATCTGAATCTTATAC
GCAGTTTAAATACATAAGGAATTTTAAATTATTTTTTAAACGTACATATTTTAGCTTAAA
ATGTTAAATTAGTATTAATTTAGCTTTTGCCTTAAAAATTGGCATTTGCTGTTAAGAACA
TTTTAGAATGGCGGTCAAGAACTTTGTTTCCATCTCAAATTGGTTATAAGCATTTAATGA
TGCTAATTACTTTCGACATAAATAAAACATCATCAAAAATTATCTTCAAAGGCGTTTAAG
TGATTCTCGACGATCTTCATCGCGTTTGCCAGCCTCTTTATCACGCAATCAGCCCGTCTA
AAGCTGTAAGCGACCTTGGCTCAAAGCGCATTTTTGTGGCTTAGAAGTTGGCGCCTTGTC
ATTGTTTTTTTTTTTTTGTTTCGTGGTTTTGTTGATTTTTTGGTTTGGTCTGGTGTGTAA
ATTCATGAATTTATTCATGCGCTCATTGCCTCAATTAATGCGACATTGAGCGCAATTTGC
TGTTTGTCATTAATCTTCTTTTCAGTTTTTGGTTACGCTACAAAGGTGATTGCTGGTGTG
ATTAAAAAGGGTTTTATTAAAATGGATGGGACAGGAAGTTGCTTGTCGCCTCAGCGGCAG
CGAGTTAATCAATTTTGAAAAAGGCTTACCTGATTGAGGATCTTTTGGCAGCGGATTTTA
CGTCGTACTTTGTGGCTGGCTCACGTCTTAGCACTCGAACTTGGTTTCTGGCCCGGTTTT
CTCAAATTGCCAAGTTTTGAAGGGGCACGTATTACGTGCATTAGTATCCCTTTGTCACAG
GGCCACAATGCACTTGCGGGAAGCCCTTCAGATTCGTAACAGTGTGTCGAGCATCTTGGC
TGCAAGATTTATGACACTTTTGTTTAAGACCAGAGCACATGGCCAAAAACCTCAATGCAA
AATCAATGGCGCTGATGGCTATCGCTTATTGTTGGCCCGCTTGTCAAGGGGTCTTCTGGC
TTAATTCGCCTAGCCGAACTCTCTCCCTTTTGCTGATTGAGACGATATCTTCAATGATTT
ATGCTTGACACGCTTTATTGAAAAGCCATGGGTTCGCTCTGTGCTCTGAATGGGGTCATC
AGCTGATAGCATTCTGATTTATATGCGCCAACGGTTGACATTCATATTTTATCTGGCGGC
GGAGCTTGCCACTTGCTGTGCTGCTGCCGCTGCTGCTGCTGCTCCTGCTGCCTTTGCCTC
TGTGCAACGTGTCGTATGAGTGACATTAGCGAGAATCCCCCAGCTAACAAGCTGCCATCT
TCAGCCAGGAATAACAGTTAGACTTCATCTGGGTCTTCTTTCCTTTGCATGCACACTGAT
AAGGCCGCAAACAATGACAGCAGTGGAAGCAGCAGAGGAGCAGAGGAGCAGCCGCATCAG
TGGCAGTGGCAACCTGTCCCAGTCCCATTCCGAGTTCCATTCCAAGACCCAGGTCCATAT
GGAGCTGGGCACCCACCCCAAGAGATGCGACAACTCATGCCTCGATACACTAACAAAAAT
ACAGCATTTTCTTAAGAAAAGAATTATTTTTAAAAATTACTTAAGAGTTGCTACCTGTTT
AATTTGTAAACTGATGATTGTTAATTCAAAAAGTGTTACGGAACATAAAAATATATGTTA
TACCTATAAGCAGAAGTACAAAAATGTATTTTTACCTAATTTTAAAAACGTTAATGCTGA
CTAGCAGCTACCACTTTTACTTACATAATTGCATAATTTCAAATCCACCTAAATTGCATT
TAAAGATCTTCTGCCATATGCATTTCATACGCCTGTCGGATTTTTTATCACTGCACTGTC
TGCGGCATATACTTAACAGTAAAAATAAATATTTTACTATAAATCATGCATTAGAGTCGC
CTGCTGGCTGTGCCCCATCCCCCCTTTTTACCCGCCCCTTCCGTGTTCCCTGTCACATGT
ATGTATGCCTGTGTCTGAGGAGGCTGCGACTCACGACATTGCTCGGAAGTAACACACATT
TAGCGCTTGGCAGTCACAGAAATAGTTTGGACTTGCGGCCCGCGGATTGGCATGGCTAAG
AGATACCCGTTTTTGGCCAAGTGCCGGCAATGCTGGCTAAAACAGACAGCTGAAAGAGCA
ACAACCCAATGGCTAGAATGTGATTAGGCCTGACTAAAGAGAAGATACTTAAAGAATTTT
TTTTAATGATTTAGGGAAGTATTCGTTGAAAAGGCACGTGAAATTTGGAAAGAATATTGA
GGAACATCCCATAGAAATCTAAACGAAATCAATTTAACTAATTAAAGCTTTTATTGTTGC
AAGTAATACTTTTATAAGCTAGCTATAAATCCATACTGGTTAACTTAAACATCTCTGACG
ATCGAAATATTTACCCAAACTCCTGCTGCTGCTGCTTCGTAGCACCGGTGACACTTAACT
GGGAAAATGTTTATAAATAAATTGATAGCGATATATTTGTGTATAGCACACGCAGCAGCA
ACAGCAATAGCAACAAATGTGCTGCATAGCATAGACAACATATTACGTATACGACACGAG
AGTCGCCGCCGGTGCGTTGCAATTTCCCAAAAGGCAGCAGCCGCAACGCATGCGCTATGG
TCAAGGCAAGTCTTGGCCTCGTAATCGATGAGTACGCTGCACATTTGGTCAATAAACGCA
TTTCTGTCATTTTTGCCTGCTTTTACAGCTCCGATGGCTGAAATTTATGGCGCGATTTGT
GAGCCGCAAGTTGGCAGCCTAGCAACTAAGCCACTGGCAACCAGCAAACTTACAACTTAC
AACTTACACGTTGCACATTGCACGTTGCGCTTGCCAAATACCATTTTCGTTTTGACTTTG
ACATTAATTTGTGTGGCTGCCAGCTTGGCCAAAAGCAACCAACCAGGAAGTGCTGCTCGT
AGATGGAAAGAGCATTCATCATTCATCTTTCCATATGCAAAGCAGCCCCATCCATTGGGG
CACCATTGTCATTGGACCAACTAACAAGCTGCAATCGATTTATGCGTGCAGCAATGATGA
TGCCACTGAGCCTGCGTGGAGATTGCTTTCGACCAGGTTGTTGGCTTCACTGCCATTTTC
CTGGCCGGGGCCCATGTCACATCATTATTTGTGCCACTGACTTTGGATTCGGTTATTTAT
GGGTCTCTGGGTGAGACAACGGGGTATTTTCTCTCCGCATCTTTAGTTTTGCGGATTTAT
TTATATTATTACTTTTTTTTTTGCATTTTCCAAAGGTTTTCCTTTTGGCGTTTGGTTTGT
TTTGTGTGCGACAAACCGCTTCAACGGTTTGGCTTATATCGGTAAATCACAAAATCTCCT
TTGGCCCATAACAAGTGCGCAGAGCCGGAGGAGATAAGTTGAGTTGAGTTAAGTTGAGTT
GAGTTGCCAGCCTTTTGTGGCCGAAACGTAGACGAGGCGAAGGTTTATTAAATTTATGCA
AATTTTATTTATAAAAGGCACTGAAGGAGGACCAGGTTTGGCAGGAATTGCTGTGGACTC
CGTCGTCGTCGTTGTCGTTGTCGTCTCCCATCGATACTCCACCGAAACTCCTCCTCATGT
TGTCAGCTGCAGTTGGCTTCCTACGCCTCATGTGTGTGTGCATCCCAACTTCACTACCCG
CCCCCGCCGAATATTTTATGATTTTTGATTTAGTTTGAGAGTTGATTGGTTTTTAGAGAC
GTCAAAAACGTTGACATCGCTGACATGGCGCGGGCGTTACTGCTCGATTGCCATGTCTTT
ATTACAATCAGCCGTCGGTTGCCTAAGGAGTTTCTCGATTTATATGCTAAAGAGCTCAGT
TGTGGGGAATCGAATTGACAGGCCCAGCGAACTTGACTCAATTCGCGCTGACCCACTAAT
ACCGATATAAAATAATAATCACAGGGCCTAATTCAATTGCGTTTCATTAATCAAGCGGTG
GGTATAATTAGGCCAGGGCTTAGCTAAGCGAAATAGTCACAGGGGCAACGCCCCAAGCCG
CAGCTCGTTCCGATATTAAATATTAATTTTTAATTATGTCTGCAACAGCGGAAACATCAA
ACATACCTGTCATAATTTTAATTGTTAACTGGGTCGAGCGGAGATCGAACCAACATTGAT
TAATATACGAGTTCCATTGGCAGCCGGCAAACCCAAAACAACAATGATAGACGGACAATA
AACAGTGCACTGTGCTGAAGAGATATTCAATTTAAATTCGCACAACAATGGCCAAAACGA
CGGGCAGTGTTAAGAGATGTCTATAATGGGGGAATTGGAAATGCAACAATCCTATAGGAG
TAACAACAACAACAGGTACGGCAGCATAAACGTGGGCGTGTGATTAAAAAATAACAAGCT
TTAAATGCGCATAAATAACAATCAAAGATTAAAGAAAAAATCCATTGAAATATAGCACAA
TAAAAGGTAAAAGTGGTTCAGAGGGAAGTGGAAGTAAGACCATCCAGTGGCACAGAAAAT
AATAATTAAAATTGTGTTTTCTTAATATTCGAATATAATTATAAACAAATCCTTTATTCT
TATCCTCTTAAAATAAAAGAAAATCAAATAGATTTGGGAATAACTTTTTGCTACGTGAAC
AAAAAAATATCAAATAAAATAAAGAACTTTTTCATACATTTATATAAAACAAAAAACATA
TAAAGCTATGCTTTTATTAAATTGCAAAATGAGCAAGTTTTTTTGTTTAATCCTGACAAA
AAGGTGCAGAAATTTTGTTCTACATTGATTACATTAAAAAGTCGAATGAAAGTTAAGCGA
TATGAAAAGTATCAATTTAAGCAATCAGTGACAAATAAGCGATTCAAGTGTTTAATTTGC
AATTAAACAAATTGATGATGAATTAAAAAGCCTTTGAAAAAGAATTAAATCAATTATATA
TGTATTTACAGAAAGGTTAAGTATACGGCACTTCGGTGAAAAAACAAACACATTGCCTGT
GACAGTCAAAGAATTTCAAAAAAAAAAAAAAGGTTGTCAGCAAAAAGACAAATGAAATGC
CATATAAACAAACAAAAGTCAACTGTCATATGGACTCAGACGCATATTTTGATGGTCAGT
AAAAATATGAAATGAAAATAAATTCCGATAGACATATAGATTGACGGGCAGATAGATCCG
AAATGCAATTAAACGGAAGGGGGAAGTGGAAAACACGAGCGCAGTAAATCGATATCTTTG
CTTGGATTTGACCAGGCGAAAGAACTTGACCACAAGTGAATGACCCTTTGGAAAATGTTT
TCTCCGTCGGCAAATGCCCCACGCCCCACAACTCCCTGCCCAGAGTCTTTCACTTTAACC
CCATCTCGCCCTACCTACCTATCCCCATCCCCATCCGCCGCATTTCCATTTCCAACCTCC
AACTCCATCAGCATCTGCAGGCACACGCCCACTCCCAGAGTTGCCAATTTAACACCTTTC
TATTCTGCGTGGCTGCCTTTTACTTGGCTCACGCGTCCCAGCGTTACATTTCAATTGTTT
AACCCAAAAAAGCGAAGAGGCCAAGGGAAAAAGTTGAGGCGAAAAATTAACTTACAACAC
TAATGTTTCACGCCGCATCGATATCCGATCCGTATCTATAACTCTATTGGTGTATTCATT
CTGACACACTGCCCTTTGGCTCATCTTTGGATTTTTGGCTTTTAGTTTCGGTTCATTTAC
TTCCTCATTGTTTGCCGATGCTGCGAAGAGAAAGGCTTAGCAATTTCAATTTGCTTTGCC
GGGCTAATTACTTAAGCGATATATGAGTGTGTGTGTGTGTGTGTATGTTTGGCAACAGCA
ATTGGCCTAAAACAAAAGCAGCACGACACACACATACACACCCTTTTTGGTCAATGTATG
ATTAATGGGTCGCGACAGCCCCCAAGGACAGGCCAACCACTGAAACTTGAACACGAACCT
TAAACAAAATGTTAGCATTTTGAAATAATGTTAAAAAACTATTTCTTACAATATATTTAA
ATTTTATGTTGTTTGTGTTAAATGTAGTGTTAACTTCCAGAGACATTAAACTTAAGGAAA
TTTTCAAAATGAGTATCCATAACTTTTGCTAGTGTAGAAAGAGGCTCGGCCGCTGCAGGA
TCGTTCGTTTCGATTCGGATCGTTCGTGGCTTAGTCACCTTGCCGGCATTTTGTCGCATT
GAAAATATATAAATTCAAATTGTGTCAATTACGTCTCTGCCGCGTTCGCTGTCTGTCGCT
TATCGTTGCCACATGGCAGCGGGGACTTTGTAAGTCCGCCACTCTGTCCGTTTGTCCGAC
TGTCAGATTGTCGGTGAGTTGGATAGTCGCACTGACTGGCTGACAAACTGCTGAGCTGCA
GTTGGACTTGCAACGGCCTGCTGCACTGCAGTCGGGCCAAGTTTGACAAACCTGCGGCTA
GCCAGGCAACTTTTAGCCATGAGGCTGAAACTGCAACTGCGACAGTGCCTGCTGACATGT
CTGCAAGTTGTCAGAGGTGGCGATGGTGGTCGAGTGGGGGAGTGGGGAGTGGTTTGGCAT
TGGGCGGATTTATTGTGGCCGGTTTGCCAGAGGGTTGCTCGAGTGCTTAAGATTGTCGAA
ATTCCATAGCAATCAGTGAATAAACTTTATCTTTTTGGCTATGGGGAGTAGATAGGGATT
CATTTTATTGGATATAGTCAAATAGGTATACATCAAAGATTCATTTCTTCAAAAATTATT
CTAGCTTAGATTATCTTAAAACTCGATTAACTACCCGCTGTTTGTTCAAACGGATGTGTT
TGTTGTTCGATTACCCTGCGGGCTCCTTTTTGGCCTAATTGAGTTTATAGATTCTGCAGC
TTGATATCGTGTTATAAACGTGCGGCTGGGGCTAATGTCATCCGTAGCCAGGGGCCTGCG
ATCAAGTAGAACGACGCCAGCAACAATAAACGAGAACAAGAGCAACCGAGCAGCCGAAAG
AGTAAAAGTTGAAGTGGCACGAAGTATGTCACGGAAATGACTTGGTTAAAATGCGTGCGA
GAGCACTCTGCTCCAGGGTGTGGATGGCCCGGCATCCATAAATGTATCTGCATTAATAAA
CCAAATAGAAATCGAAACGGAACGAATTGGTCGGAGGCCTGCAGCGAACAACAAGAGGCC
AAGACATCCCAGACATCCAAGACATCCTTTAATGGCCAAGTTAGTCACTCAGTTGGGCCG
TTGTTGTTGCTCTTCTTGCCACTTGAACATGCAGCGCGGTGCCCTGGACTAAATGCAACT
CTCAACGGGCCGAAAGGACTAGACACGACAGCAACAGCAACAGAAACAGCACAACATCTG
CAGAATGGGCAAAAATGAAGTAAAGAAAAATAAAGCAGGCAACAGCAATGAACGCATCGT
CAAACATATAGACCAGGCTATATGTGCTATAACTCATTAATATTAAATGCCTGTGCCGAG
ACAAGCCCCTCAGCCAGAAAGGAAAATACATATAGTATAGTATAGTATGTGGCAAGACAG
ATGCCCGAGGAGATGGAGCTGGAGTTGGAGTTGGATGTGAAGCTGTGGCTGGAGTTGGAG
CTCGAGCTGGAGATCCCTGTCCCTGGACTCGCCTTGACGTTCGCTTCGTTACAAAATTTA
TGCGCATTTTGTTTCAATTTCATACACACACGTGACTTGTAAATTATCCATTGATGTGGC
AAAGGGAAAATAAAACAGAAAAAAAAACAACAGCACCCAACACATAATGGCATGAGGAAT
TTCGCATCGGGAGGCAAGGCAACAGACACAGACTACAGATTTGCCAGATCCTCTTGGCAC
CAACGATAATTCCTGCTGGCGACAAAGAAAAACGTACACCAGAGTGCCCTTGAAAGTGCT
TGGAAAGCAGATCAGTCAAATAATAATATAAATAAAACAAATTTTTAAATGGCAACAAAC
TTAAGTTACGAAATGTACAATAATATTCGCTATAAAATATATTTGTATTAGTTTTGTAAT
ATGCTTATATTCATACTTTTTGTTGATGTATCTGATGAATAGAACTACCCTGTCTCACAG
AGTATGCTAAAATGGAAAAAACTCGCCCACGGGCAGATAACTTTCAAGTGACACAGGAAG
CCAAAAGAAAGGGAACTGCTGTAAGTAAGATAAATTTCTGGCGGCAACTGCAGCGAAATT
ATGTCACGAGGGCCGAGACCAAATAAAAACATAAACTCCAGCAGAGGAAAGGAAAAGTTA
ACCCAAAGAACGGTGACAGCACCCATGGAGCACACAATAAAAGCCAAATAAATATGTGAA
AAAAAAGTGAAAATGATGACACGTTATGGCCGTGGCTGTTGTGTGAAAGTGTGGAGTGTG
TGTGTATCATAAATACGCATATTAGCCTCGTTTTATGTGGGGGACGCTTAATGCTTCCGT
CCGCCCCATGCCCCAACACCCCCAAAATACACATCAGTGTAGGAGGTCGCTCACACACAT
TTTTTCCCTGTGTATTTGTGTACTTTTGTCTCGCTGTCAACGGAGCATGCATGTAGTTCT
CATGCTGTAATTAAGCTTAATTACCTGTGTCAACAGCATAGGGCAAGATGATTTTGACGG
ATTTCACTTGATGGGCACGCAGGAAATATTCAATCTCTCTGGTCTGGACCATGCCACATG
CTCCACTCCCAGCAAGCCAGTGGATAGCAGACATCATGTGAAGATGTCTTGCCCTCATCT
GTTTCGGTTTCTGTCTCTGTTTCCTTTCCGTAATTATTTGCATGCAACTCCAACTCGTGC
AGACCGTTCTGTGGTCAGCATTAAGCCCTGAACTAGTCCCGCACTCAAATTACCCATATA
TACATACTACGTTCTGACCCGATCCGAACCGTAGGCACTGCTGAAACACGTTAATAACAC
ATATACACTGAGAAAACTGACCTAAGAAAACACAAGTCTAGTGTGTATGTGTTTTAAATA
TCTTTTAATATTTATTCAAATCAATACAGCTTCTAACATGCAGTTGCCCTCTAAATAGTC
CAATATTTCCAATTCATATTAAAAATACATTAATTTATTTTATGTTGATTTTCAAACAAG
ATCAACAATTATTTTCGTTTCGAATTTCCCTGAGTGTAAGAGTCGTACGGGTCGTAAGCT
GAAGATTTCTGCTCATCCCTGCTCTTCTCAGTCTGCGGTTGATTTTTATGGTTTCATTAG
TGGCACACACACTCTTTGCTCTTCACCTCTTCGTCGACGGCTATCTACGTATCCATGGCT
CTTCCCGCCAAGAAGAGCTTCTTCTCCAGATCCGCGGCCTGGCATCTGCGCATGCGTAGT
CGACTCCGTTGGCCTGTGTCCACGTCTCTGGCCCGATTGCCATGCTCTGCGCTGATTGCG
GCCTGAGAAAATTCTACTGACCCACAGAACTTTAACTTTTTGAGTGGCATTGTTCAATTT
AACTGCAGACAGCAACAGCAACAACAACAACAACATCAGCAACGATGGCAATAACAATAC
CAAGACAACGGCAGACAACTAAGAAATTTCACAAGCCTGGCGGCCATTTTTCTCCTCAAT
ATCAGAGGCCTTCGTAGGTAACCCCCATACCAAACCCAATCCCCATTCTTGCATCTCTGC
GGTTTTCAGGCTTTCTAGTCTTGGCTGGACGGGATTTTTGAATTTTTATGGACTAGTTAC
ATATGTAGTGATTATTGGCTGGCAACAAAATCGCGAAGGGTTTTATGTGCTTAATCAAGA
GTTAGATATTTTCGAAAATTTTAAAGACACTTTGGGTATGCATTAAAATTCAAAGAGTAC
AAAATTCAATTGCCCATTGGGAAAGCCTATTACCGCCACCTGAACTTTCCCCAAAAACTA
AAACCATTTAAAGTTTAAGCCCATTCGAACGCTGCGAGACTCCGAAGTCTGCCACTTTAG
GCCACAAATGGGAATAAAGCGCAATGGAAATGGCTCGGAACGAGAAAAGCCGCGACCTGT
GCGACACATTTGAGCAGTCAATTTCAATAATTCGGAGGAACATTTTTGGGGGGCAGTAAC
GACTGCAAAGGCGTTTAGGAATTGCGGAAATTGGCTATCGAAATGGAAAACATTTTCATT
ATTTGCCAACCTGGCCAAGCTGGCCATAAACAAGCGGCGCCCAGGTGGGCGTTTATGTTT
GGCAATTTATGGCTGAAAACATAAATTCGTTGGTACGCTTGGCTGAAACATATTTTGTTT
GCCAGTTTTTCGCGTGGATTGTCAAGCTGCCTGGTTATATTTTAAATTTTTTCCAAGCAC
TCGACGCGTTGACATTGCCATTGATTTATACGAAAACGGGTTCAAGAAATTGTCGTATTG
CCGAAAATGGTTTTTATTTTCTTCCTGCTTACGTTTAATTAATTGGCGCTGGCCACAACC
CTAAGCGTTTTTGTTTTAAATTCATTTGAACGTGGCCAGGACTAAGGTTCTTGACATCCA
TTCATTACCGAAACAAAACCGAAACACCGAAAAAGTGCTCGAATGTGTTAAAAGGTGTGT
TCAAGTTGGCGCACCGCACCTCGTGATTTATGCTATGCATTCAAATGCAATTTTTTTTTG
GGGCTACGAGTATGTGCTATATGCAATATGCTTGGCCGATCCGACTGGCAGCAGCCATAA
ATATGTCAATATAAGCGACCCGACAACAGCCGCAGCAATAACGGAGAACAACGAAAACAT
TTCAATAAAAATCAAAATCAAAATCAATAGAGCCAAAAAAAAGATCGAGTGAAATACAAC
AAAATTCGAAATCATTCACCACCGGACGCTATCAATTTTTATAAGCCATTGTTGTTGTCG
TTGCTGTTGTTTTGGGGCAGATTGGGGGATTGAGTAATCGGTTATCCAGGCACTGCCATC
TACCATGTCATTGCCAGCCAGTTTTTGTTTCAGTTTACCGATTTGAGTTCAGTTTACCAT
GTGCTGTTTGTTGTGTGTTGTATGGCCTGCCCAGGTGTGCGGCTGCAACACACGAGCCCA
CGAAAACGGAACAGACCCAATTTTGTTGCATGACTATGACACTGCTGAAGGTGCCCGTGC
CCCAGCAGCCGCCCCAAGCCACCAACAACAAAGGCACAGCAGCACAACAACACTGTTGTT
GTTGTTGTTGTTGCTGCCACATAGCGCATGACTCAGGTTCAAGTTGCCGCACAATCAAAA
TCGCCCGGGTGTCTGTCAGCCAACTCAAATCAGCCAACCAACCAGCCAGCAGCTCGTTCA
TTTGGGCCATGTAATATGCCGCATATTGGGCTCACCTGAAATATGCAAAAGATCCGCCGG
AGAGGAAATTGCGGGGGGGGGGGGTCCAAAGTCCATGGAGAGGAAAATGGATTTTCCTGC
GATGGAAGCACCCCAAAGGACTGGCCAAAAAGAGCGGAATCAATATATAAGCATGGTTAG
TTCACTGAATTTAATGTTGCAGATATCCAAAGGGACTGCATACAATGGAGTTTTAAGTCT
TTGATTTTGTTTTCAACATTTTACATCAAAAATGAAACAATTTATTATATAAATTACTGA
CACAACTTTGTACATCTATATTTGCCTGACCCACATCTGAATAATAAAACGAAATACTTT
ATTGAGGCAATTTTCCGAAAAGAAGCACAAAACAAGAGCGAGCGATTTGAAGGCGGCCAA
TCGGGGTAACCCACATGACCAACTGACTGAATGAGTGTCAAAGCTATTTTGCGCTAATTG
CCTTTTACGATTATTTTCACATTTGGCCAGCACACAAAGCCAACTTGGACTCCTCCAAGT
AACCCCACGTGACCCCTCCCCTGTGCGAAGCACTCGTGGTCCCATTAAGCCATACTTTTT
GGCCCAAATTCTCGTCGCTCTTCCTGCAGGCCAAAAACACTAAAACACTTACAAGCACGC
ATGAATATATGGTGGCAAATTATATTGGGTACTAGGTCAGCATGCCAAATTGCACAAGAC
ATTTAAAGCAAGATATAAATAAATGTTATTTTAGATATCTTTAATATATAAAAAATCAGA
ATCGGAAATCCATTTAAAACTTTTATTCATTTCACAATTATATGGATTAAATTACTTTAA
GAATTGTAAAATTTTTAGTGGAAAAGACAGTTAGTGTAGAAAAATCTTTTTTATTTATTT
ACTACCTTTTTTTCCCCTGTGTACCACATAAGAAACAGATAGATTGTTGAGAAGGTTGAG
GTGGGCCATGCACGAATGCGTCGCATTACACACAGATACTCACTCGCACAGATACTCACA
CATATACTCACATGGAGGACCGTGGATATGTCTTTGCAGCCATGGCACGCAACATATTCG
CTTATTAAATTGAATTAAATTTTTCGTACGTTTTATTTGCGGCCCGCGACGTGAGAGAGC
TATGCGGATCGGGATGGTTTGGAAAATGGGGGGGGAATTGCGTTGGGGAGTTAAAAATGT
GGGTAGGAAGTGGGGTGCTGGTGCTGCGGCTTGCGGGTTAATGTCAAAGATGGGGCCAAA
CCACACAAATACACAATAATAACCAGCGAGATAAAGAGCGGCTGGCATTCCGGCTTAACT
TTTGGTTATTACGTTCAATTATGGCTTACGGGTCAGAGAGCAAATGAGAGTGGGCACAAA
TAACTCTTGCGTCGGGCGACAATGCAAAAGCCATAATTTCATTAGGTGCCTGACCCACTA
ACTAAATAAAATACCAATTAATTTGGTACCGACTGTTTGGTTTGAGGTGAAACAAACACA
CTTATTGCCCCAACGGTTTTAGTAATAATTATGCAATTAGTCTTAAATTGTTTATTTGAA
CTAGATAATAAAGAAATCATTTGGGAATTAATAAATATTGCACTTGTTTATGCTTAAGGC
GTTAATTAAACAAAATTCATCAGGCACCAAAGAAAACAAAGAAAAGTTAATTAATACAGA
CATACATCATACTTTTGGGAAGTACACCTATTTTGTCCAACAATATTATTCTTAAAACTG
ACAAGATTATTTATCCAAAGAACTGGTACTTCCTAGCACAAGTCCATAGTAGCTACCCAG
TCTTCCTCAATGTTTGTTAAATAAATTAATTACCTTTTAAGCAAGCGATTTTCAATCTTT
TGCTGGCGTGCAAATAGTTAATCATGCAGCCAACTCAGGTGGGACTTTGATGTCTCATCT
TGTGGTTGTCTAGCGCATGTCTAAAAATAAATAGATATAAACATTGCGGAGAGGAATCTA
AAAAGCAGCATCAAGAACAAAAGGCAAACATGTTTTTCAGCCAATCTTAATCGGTAATTG
TCTGGCGAGCACTTGGTGCTTAATTGCCAGCACAGAGCCTCAATTGGCGAGTTACTTTGC
TGGATTGATGTAACTATTAGACAATAAAATAACTTTGGAGTTGGAGAATCTACTTGTCGG
GGCGAGAGGTTGGGGCTAACATGGGCCAATGTCAAGGCGAGATGATCATCAGATTATCGG
AAGGCCGGCAAGGTCAATGAAGTCATCGCAAATTCCATTGTGGCAAGCTTATTGGTATTC
AGCGATGTTAATCAAAACCGATAAGATCTTTAATCATTCTTAAGATGTAATAACTAGGAT
ATTTTCTTCAAGGAAAATCTATAAATATTTAAGGTTTTCACAATCTCAAGAACATCTCAT
CTTCTCACATAAATTTTATAATACCTTTCCACGTCAGTATGCCACATAAAATCCAATCAT
TTAAACTCGTCAGTGGGTTGGGTGAATATGTGCCAATATTTTAGGACAGCTGCTCAAAAT
GCGCCATTAATCCGAAATCCATAAATACCATCAACCATTCGGAGATATATTAAGCTGATG
TCGGATCAAGTTGAAGGCGATCATCATCATTATGGTGTAGAAGAGCGCCAAGGTCAGTGG
AGTCATCTGCGCGGCTCGATTCTGCGAAGTGGGAGCCCGACTTCTAGCGGGCTTAATGGT
TCGCATAGCATTCCTACCAATATCCCCATATACATGTATGTAGGTTTCTCTTTCCCGTTG
ATTTTTATCGCAGCCAGTTAATGGACATTTCAATTGCACGTTCGGGGCGTGAGTGGGGGC
GTGGCCGGGGCTCTGTCAAGGAAGTGCAGTCGAGATTGAGCATTCAATATTATAATTGAT
TGCGGCTCAAATGATTCGAAAGGTGTGGGAAAACAAAAGATAAGCACTTCGCTGGGCAAC
TGGGAAATTGAGAAACTGGGGAAAGTTCGAATAGTTGTATAATCGAGTGGAAAAGAATGC
AGCACGTGTCCAAATCAACTGACAAATGTGTCTGAGCATAAATAACAAATTGATTGGGCA
AATAAACATATTTACTATTCGTCGTGACTGAGTGTTTGAGGCAATGCAATCAGTATGTAA
ATTGGCTAATAAAAGCCCATGGACGGAATTGCGGCTTGGCCATATATCTACAATGATCAT
GATAATGATCTCCGCGATAATTATCAGCTTATCCCACGTCTGGTCAGAACATAAACATAA
AGAGCTTTAAGCCAAGGTTAAAAGATTTTTTCCAAATATTTTTCGATATTTTTTTTTTTA
GATTTTTGTTGTGGTCTAGCGGGGCAAACAAACCGAATCTTTGTTTGCCGTAAACCGAAG
AAGCTGCAAACTGACGATATTAGTCAAAGCTAAATAAAGCGTTGCTGTGGATTTTTCACT
TTCATCACGCTTGACGCTATAATTAAGCGAATGCGTAATATTTGCACAGTTTCTTTCTTT
CCACATTTATGTTCGATGATGATGATTTGCCAAAAAAGTAGCCGCTTGAGGGTCAAGTGC
ATGAAATTCGACATGTTACGCGATCGTAGCCACCAAACTGTGTCGATAATCACGATGATA
ATGCAATGTAAATCGTAATTAAAATCAACAGTTGAGCGGCAGTGCAGACGTCGGTGTAGA
TGTAGATGTAGATGTATGTCTCGGTTGTTAGCCAACTTGTGTTCTAGACCATGTTTTGTG
TGCATTTGAAATTAATTTATGCCAGCATTCGTTGCGAGACATGACGAGCAGTCGGTGCCG
CCAGAACTTCGACTCCTCGCAACTGGGAACTCTGGAGTCTCGGAAGTCTGAGGCCCAGAC
TCTGACTCAACTTGCACTGTGGGCTTAAGTTCGACTCGCAGTCGGAGTTAGTTGGTCGCA
TACATAAATAAATTAAAATTGCTAATGGCTGGCGGCCAGAGAAGAGAACTCTCTTCTACG
CTGCAACGCCCATAATTAAAAGCAACAAGATGTACAACGCCAAAAAAGCACAATAAAACC
ATGACCAGCTCAAGGGAAACAGGAATGGTGTTTGGGTTATGGGGAAACCGAAGAGTATAA
TGCTCTTATGGGTTAGGAAAACAGCATGGGTGCCAAATTCCGTTATTTATTTCAATTATA
CAGTCATGAAACCTAATGGAATTATATTATATCACTATCAAAACCGGATGTTCTTTTATC
ATTATTAAATTAAAATATTCTGCCAAAATATGAAAAAATTCTACAGTTATGATGCAATAT
GCCATATTCCTTATCAAAATGTTAATACCTTCAAAAAAGTGTATATGAACCTAAAACGAA
CGATCTTCTAGCGGAGAATCCCAGGCATAAATCAATCAATTTATCGTTCGCCGGAGTCAG
AGAAGAATACTGCCGCTTCCTACTCATCCGGCAAGTTATTGCACAGGAATATCCCCCACA
TTTCTAAGCGAGTGAGTGCAACGAACGCGCTCAGTCACCTTTAAGCCATGTTGTGGATTG
CCCGGGGCTCTCCCCCGCCAACCAAGCTTGTTTGCATACGCCGAAGACATCGCCCCAGAA
GTTACCTGGAAAATTGCAACTTTGCCACAAATAACCCAAGCAAATCTCCAGCCACCTTGC
CCCCCAAGTTCGTTTCCCCCACTCACCACTTCACTTCTCTGGTGGCCAGGCGTAATTTGC
TGTCTCTGCAGTTAAATGGAACTTGCCTCGTAATGTTCTATAATTCATTGCCGCTGGAAA
AGTTTAGCCGAAATGGAAAAACATGGACATAAGTCAGCGATGGGGACATGGCAAGAAATC
TGGCTTAAATATGTGCAGAATAAAAAAGCCAATTTCGCTTGGCGCAAATAATAATTTCTC
TACTCCATTATGATGGCCAAGAAGAGCTTTGGCCTAACAAGTTCTGGTGCTGAATGCAAA
AAAGATCGGGCTGCAACTTTTGGGGAGCGGCCTGGAAAATTGGCAATTGAAGTGCCAGCC
ATGTAATTAACACTTGGCAGCTGACACAGCGGCAATTCCAGCACGACCTCTTAATACTTT
TGGCCTTCTATGCGGATTTCTTTTTTCTAGGCCATTATCAATTGGCAGCCAACAATTTTT
TTTTTTTTTTGGGCGAAGCCATCCAAACGGTTCGAATAATCCGGTGCATATAAATGTTAG
GAGTGGAGTCAAGTGGAAAATACGTGGAACGTTAAGTTAACTTAATAAAATTAAAGAATT
TCTCTGTTAAATGACCAAAGTGTTTGTTAAAACAAGCAAATGAATTCTATTTATGCATGA
AGCCCCAAATCCGACACAGTTCTCATTTAATATTTTTTCGGATTCCGATTACCTAAATGG
AAAACAATGCGTCTGATGGCTTATTAAAGCCGTTGTCGTTTTTCCAGACGAACGCCAAAT
TGATGAAAGGCTTTCCATCACAGCTGTCCACTAAAACGCTGACGACACACACTGAGATGG
CGGCAATGCATCAAGTTTAAGGCTTAATCGATACCACTTACCACCCCGACATCCCCAACA
AACGCCTTCCCCGGGGCTCCAAAAACTCGATGCAATCGCAATTCTTAGTGCTCTTTTTTT
TCTGCACTTCTTTTCCACGCTTCGTTTGTGTCGACAGCAGCTTTTCATTAGACAATTTCC
CAAGGGTGATGGCAAAAGGGGGGGGGGGGGGAGTCGGAACGGGCGGCAGAAGATTTTCAT
TATGTCGAGTCGACACTAACAACAACTTTTACTTCCACGCTATCTCCGTCTCATTCGACG
CTAGCGTGTGGTACATTGTTAGCTTAATTGTTGTTGTTGTTCTGGCTGTTAGAATGTGCG
CATTATTGAGTTACGTGCTTGGCGGCACAGCAGCAGCAACAACAAGCAGCAGCAGCAGCA
ACATGCAGCAACAATTGCAGCAAGCAGTTGCAACTTGGCACGTTTCTATTATTTAACTGT
CAGCACAGCATACCCGCTAAACAGTAACAACAACGCCGAGAGTTCGAGCAACAAATGCTC
CACTAATTGCCCGACAAAAATGTCTCGCACTTAACATTGGTCTTCTTCATTTGCCAACAC
TTAATCGGCGGCGAAAATTAGCGCAAATCCGTTGCCACCAATTTGCGGGCGCGGTCGCGG
GCTCGATCCTTGGATCTGATCTCTGATCTCCGCAAGCCCTAAAACCTTTACTTAAACCTT
AGACAGGCGACACCTACGACAAATGCATCAAAAGTTGCCGCCGTAAAAGCCCACGTTCCA
TTATACAAAAAATATATGAAAATGCACAAAATGCACAGGGAGAAAAAACCTGAATCGTTT
CCTAATTAAACGAATTGTGTTGCTGTGATAAATCGTATATTATTTTTTTACAACGTATTT
TTTGTTTAATTCACAACTCTGCAAAAAACCCATAAAATGTTAGCTGATATGCACATTCAG
CATTTGAAAAGTTTTTCTATGCTTTTAATACCCCTATAAATTATGCAACCACAGGGATCT
CCCATCAGATAAAAACTGCAATTGCTGGCTTACTATAAAGCGATCACAATTTCCGAGGTT
ATTCATCTCAAAAAAAAAAATAAAAAAAATAAAAAACAACGAGTCGGCTCTTACGCTGAT
TGCAGATTTTGTAGCTGTTCATTATTCTGATTGAAGGCGGCCAATGAAAGTTTTTTATCC
TCGCCCGCCCACGCTTTATTTCTTACCCCCTGCTCTTGCTCTTTTTAATGGGAAGTGCAT
AAGCAGGAACAGTGCGGAACGTGAATATATCGATTGCTTTTGAGGTCTAAAAGGAGTTCA
TAAATTGTCCCAGGTAGTCAGTTTTCATCCATGGACAATCGGAACTCCTGCTGCAGATTA
GACTTACTTTTAAAGAAAATCTGGTTCAACTCTTAATCTTAACTCTTTAAAGTGCTTTAA
CTTTTTCTAAAATTTATTTATAATTTGGAAATATGTGTGCTCTTTGTATACCTCGCAAAT
GTAGCGCAATAAATCACAATAGCAACATTTAAAAGTAAATCTTTACGCTCCAATAGACTT
TCATTAAACTAACATTATGTTTATGCAACGCACTGTGAATGGAATGAATATCTTGATGGC
TTTTCGACGACATAACGGTAATTGCTTCCCGGTTTAAATAATTCAAGTTGCACGTGGGCT
GCTTTTTATATACATCTTTTTTTTTTGTTTAACCATTTTTTGTTCGACGAATCGGCAACA
GAGAAATTTATTAATTATTTATTGCTGCAATATCGGTGGCGTTTGGTTTTCGGCAATTCG
TCGCCATTGTTCGCTGCATTCAAAGAGATTTCTCTATGAGCCAAGGCAAGGTCACCGCTG
TGAGCTTTAAACTTAACGGTCGCCTCAGATGCTCTTTGTATCTTTCGAATACAGATATAT
ACATACATATATATAAGTATAAGTCTTTACAATAATACCCTGGCACGAAGTCAGGGCGCA
CAATTCGATTCAAGGCTTAAACGGAGGAGAGCTATGCAAATAGACCTGGCAAACCCAATA
AATGAACCGTCCGCGAGCAGGGGGATATACCTATATATAATATAGAGGGGGCAGGGGGCG
TGGCAAGGGCAGGGGTGGGCTGGCAGAAGGCGCCCACGCGCACCTATCAAAACCGCTTTT
GTTCGACAAGCGCTTTTTGTTCGCTTTAAGCAACTGTGACAACTTCTTTAATCAAAATCG
TTTTCAAAGACCGGGGCGTGGCCATTCCCCTCCCCCCTCCGCCGCCACCACCACCACCAT
CTTTTGGCCAAGTGTGTGTGGGCCAAGTTTTGTCTCATTACAATTTTGACGCTCTGCCTG
ACAACATTTGATTTCTTGCTTCTACGCGAGTGCGTAAATCTTTCTGCTTATGTCATTTAG
TTTAATGGGAATGGCATATTATTTGATTCCCAATCTGGCTTCGCTGTCTGTCGATCTGTT
CGATTATAATTATAGGCTCAAATTTGTTTCCCGCCTGACAACTGCTGAAAGTTTTATGGG
CTTTGATATTAAAAAATATTTCTACAAATGATTGGTCATTGATTGCAGATAAATGGAGAG
GCGTAGATTGGTATACATGTCTTGAAGTTGTAAAAAGTTTTATTTAAATACAGCTTGTTA
ATTAATATCATAATATAAAAATATTTTAGGGTATGATGATTTAATCTAAGTCCCAGGAAA
TCAGAATATATGGAGGTATTATTTAATCTATTACCAATCCTTTTTTACAAAAATCAAATG
GTAGGATGTTCTGTAGATACGGTCAGCAATATCTGTTTCTCATGGTTTTTTCCCATTAAT
TTGGCTTGAGTTTAATATTTTTCATCCAAGTTCAACCCTTTCTTTCAAAATTCTTAATGG
CACCAAAGGGGCATTCAACTTCCTAGTAACTGTTGGCTAATCTATCCGTCCCCACCCATT
TCTTTCTCTCATTTATATTTGTTAAACTAATTTCGCGTCCACTGGTTCAGCGTGCTGACC
TTATGTTGTTGCCATCTAAAATTTTCTTGCCATTTTTCGTGCATTTGCTGGCCACAAGCG
TGAACGACAGATGACGGACCAAACCGGACTGTTGGATTGTGGGGGACATTGACGTTGACG
CAGGCCGATTGTTTGGAATCAAAGAGCGTGTGAATCAAAACAAAATACAAAAATCCAAAT
TATTTGATTTCTTTATTTTATTTTGTCGGCTTGGAATGGTCTAAATAATTAAGCTTTTGT
GACGGTTGCTTTGGCGGCTCGATGTATTATTATTGACAGCGATTTGCCGTTGATTTGGGT
GACCATGAAGTGGGGGCTTCTCTTGGGTTCAATACGCTTTTGTCTTGGCTAATTTATGCA
GTGCGTCAGGGGGAAAATGCCAAAAGCAACAGCCTGAGTGATATTAAATGAACTGAAGCT
AGGTGCAGGAAAGTTCTCTTTATTAAATTTCCAATTTGAAGGCACTTGACGCCTTTCGAA
AAGGGGCGGGACTAGAAGATTCAACAGGCGCCAGATTTTCATTAAGGAATCACTGCGGCA
ACGTCTAGACCTGCAAAAGATGATCAGATCGAACCTGACCAGACTGAGACTAGATATTAA
TGCGGCAAACTAGTTTTCGTTAGCTTTGTATAGTGTCGGATATGCGCCACCTGTTGCTCA
AATGTGGGAACTCAGCTAAATTGCAGAGATGTTTTTAATTTGTTGATCCCATTTTGATGT
TGTCAAGGCCGTGATATGAATAATAAACAGAGAAGAATATAGTACAGCATATTAACAGCC
TAAGCTACTCGCTGCTTTTATTATTGCTATTATTCTTCAACGGAGAAAAACAACATTAAA
TGCACTTAAGCCAAATTTCGTAACTTCTTTTGTTAAATTAAAACTTTCAGTTGGCATTAT
TACTGCCAAATGTGATTACTCAATTTGTCATGCCAAGCCCACTTTCCAATGCTTACTGTC
AAGTTCACTTATTAACTTTCGGCAGACAATTCCACTTCCAAGTGCGCTTTGTGCCACTAA
ACCAGAATTATATTTTTAGAGCTATCAAAGTGGAGGAAAAAAAATGGTTATTTAGTAATT
TTCACTTAATAAAAACATAAAACATTTAGTCCAACCATTATAAATCAGTTTCTTTTTATT
TTTCTTTGCTGCTGTTGTTAAAACAAATTACACATAAATGTTGTTAATGCTTATCTGGGA
TTTCTATCTATTTGCAGGTAAGTCTGAGCCGCGAGACCGAAGGGCAGGTGACCTCATAAA
CCCAAATAGAATCGTGGCACGCGTGAGTAAAAGCTACCTATTCCCAAATGGCCAACAACG
AACAAAAAAAAAAAAAAAGCGGTTAAGAGATAAATCTCGAGGCGGGGTCGGGATTCACTT
TCTCCGCTTTTAATTGCGGCCAGCTTCATTTTGATGCGTGCGCAATTTAAATGCAGGAAA
GAAATCCTCCATCGCTCTGGCACTTCCAACCTCCAGCTCTTGCAACTCTTTTGCCGGATT
TTCAGCCATGTCAGACATGTCGACGGCATTGCACGTACCGAAGAATTCGAGAAGTTGGCC
CGAGGAAGTCGGAGGAGCAGAACATTTAAGCCGCTTAACCCACTTCCGCGGCACATTATC
GTGAACGGCATGAGCATCATTACCATTGTTGTCAGCAGCCTTTGCTTTTGCGACCGGCTC
TTTTTTTACCTCTTTTAATTTCTTTCAATTACACCGCACTTGTCACACGAACACAGAGCG
GAAAAAGTTACTAGAAGTCTTGTCATTTCGGTAACATTTCGTAACATCTTTGAGTAACAA
CGATTTTTTTGAATACATAAACTTCAAATTACTTTTGATACACTTGAGTGTTCTAAAAAT
TACACGAATTACATGAAAATATCTTTTAATGTAAAAGAAAAGCGGATTACTGTTTCTCAG
TGGCTACATTTTTCACCGAATTCGCTTGAAAAAAGTTTCCCTCTTATTCATTAGCCGCTG
AAAGACGTGAATCATATTTTATGTGGCAATCGTTCCAGAACCCAGCTAATGACGTAAGAT
GGCTGGCAGGTTGCAATGAAAGTTGCATCATAGTTGCAGATTGGAGTAACAAAGGAAAGT
TGGCCTTTCTAAATGCCGCAAATGTTATGTAGAATAGAGGCTGCTGCCAAGTGGAATTGC
CAATGCAATTGATGCGCCACAAGCTTGGCAGAAGCAGGGAACACAAAACCAATTTAAAAG
CCCCAAAACAGGCAGACTCCAGACTGATAAAGCCTGGCCAAAAGATGGCAAAAAGCATCG
GGGAAAATGGAAAAATAGGCAGCAAACCGCAGCGTCAGAGGAGCCAAGCAGCAGCTTTTG
TAATGGACATGACTACAAAATGCCAGGCAGTAAAAACAAATGAAGCCAAGCCGAATGCAG
AGGTCTGGGCATGGCTAATGCAATGGCTATGACCATACCATAGATCTGGCTTTGGCTATG
GCTATGGCTATGGATCTGGCTCTGACTCTGGCTAACTAAGATCCGTAACCCGCTCGCTTC
GATGCCAACTTAGACGCTGACCGGGCGCACTTTCAGTTTTCAAATAGCCAAGACAACGGC
AGCAGCAGATAACAAGAAAGTTGCCATTACCAGCTGGTTAGCATCGAACTTGGAATGCTC
TTTCAGACAGATCATTTTGAGGTTCTCAACAAAAAGTTGGCCATAGAAATTTAATTTAAA
GAATTTAAGTATGCAAGAAGCTATACCAAACAAAATAAATTCTTCCGTTTACTGATAAAT
ATTTAAAAAGGCCTGGAATCCTGCAGATATCAATCAATTTCGGCAGGTAACCCAGGCCGA
GCTCAACATCCTTCGTTTACCTTAAAAAAGATTCTGCTTATTGGCTTAGCCAGAATCTCA
AGGCAAACAAAATTTGTTATCATATTTCAAAGGCAAACATCATTAGACCCAACTCGAACA
TGCCCCGTCATAGTCCAATCAGTTTGGAATACCAAAACTGCAGCCAATTTGAGGGCCCCG
CGCATGCCGCGCATCCCTTTCCCTTTTCGATGGCCAAGCATTATGACCAAGTCGTAAATA
CCCTTTTTGGTAGTTACTGCAGGCGGGCCAGGCTCGATTCGCTTTTATGGCAAAGTCAAA
TAGGAAAACAAAATAGAAGTTAATCTAATAACAAAGATTGAGCGCAATAATTTTAGCGAT
TGGCAGCGCAGATTTACCATGGCCAAGAGCTAGGAGTAAGCCAAGAAGAAAAAGCAGGCG
AACAAAAATAAAGAGCCACAAAAGTAAAACCGTCTCGCGGTAAAAGGGAGCGTCCTATGT
TTTTGGTCTAAGCCGAAGTACCTGGCCAAGACGGCGAGCGTGGCCAAAGTCTCGTTAGCG
TTTTGGACCCTGTCTTTGGATTCGGCCGTGTTTTTTTTTTTTTTGTTTGCTTCTTCTTTA
GCTTTAGCATTGGCAAGTGCAGCTGCTGCCACTTTTGCTGGCTGCCACTTTTGCTGCCGG
AGACGCTTTGGCTGCTCGGCCCGTTCGTTGCACTTGCCGACTGCCGTATCTGCAGCACTC
CCGACCAGATAGCGTATCTAATGGATACATTTTAGTGCATACACCGAACGTATCTAATCG
GCTAAACGTTTTATTAAATTACGTTAGTCTAAGCTTTGTTCAGCCTGCCCACAGAATTGG
GTGGGTGGTTCGGGGGAAATGGGCATTGTAATGGCAAATGGGCATGGTCTTGGTCTTGGG
CCGACTGGCTTGCCCGACTGGTTTGGTTTAGTTATTTCGCTGAATTTGCCTAACTGACCT
TGCCCAGATGCCAACGCTGATGGCTCCAAGTTCAAGGTTAAATGTTAGAGCCTGGAATGG
GGTTGAGTTATGCATTTTTTTAATTTTATTATCTATCTGATCTCTTTAAATTCTCTAAAG
GAATTTAATTCGGGTAAAGAAACTTAAAAATTGCCTGGTCAGGTCCTTTTTTTTTGTTTG
GGTTTGTTTTATATTCAAAAAATTTGTAATTATCTCCACATGAGTAAGACAAAATTCCCA
AGAGGCAAGAATTTAGCTCGAAAATATTTTGTTAGAGTTTTGAGCCGGCAAAAGGCCGCA
AACAGAAGTGTCCCAGCAAACGAAGCCCACAACTGGGGGACAAAGGCACCCAAAAGGACC
CAACTGCAAAACATTTATTGAATGCACTCATGTTAGAACTCGTATTTTGCCCCGCTGGCA
TTTGGATAAGTTCAATGTGCTGACTTTGAGATCAGCAGAAAACAAATATAAATAGACCAG
AAGTTGTCAGGCGAAAAAAGAACAATTGCATGCTGAGACAGCCTGCCGAAGACCCACAAA
TGAAACTGAAATTGAAAACGAAATCAAAACATGCATATGGATGCCGAGGACCACAAATCG
AGAGGAGTTACTGCCAGGAAGCCACACAAAAACCGGACGAGTTCCAGGGGCAGAGGCGAG
CACGACATTGCCATTGCTTCCATGCAAATAAGCAAATGAGCCAACAAATAGCAGGAGCAA
GGGGTCATGAGTTGGTAGTGGAGACTGTTTGGAATGGATTATTATTGTAGCTGATGTCCA
GAAAACCACAAAAAGATACTACAAATTAAAACCATTATGTTAGAAAAATAGAACTTCCTG
TGTGTATCTAAATAAGACAAAGGGGAATGGACCATCAAGCTTAAGCAAACATTACAAAAA
ATAAATACATATTTTTGGCAATGTCATTTATAAAAGACACTTTCTTAACTTCTAGCAAAC
TTTCTTTGCTTTAGACAACAAGTATTTCTTCAAGTGCAGGCAAGTAAAAGTACAAAAAGC
GTTCGAGTGCGAGCGAGTCAAGAAATAATTGCTGCATTTTTTTGTGTGCACATATATATA
CGCGTGTCGTATCGTTCTGTTCTTCCTTTTCTTGAGCAGAACAATTGAAGTCAAGCCCCA
TTGCATTTTAACTGCCGGCGAAAAGAGAGTTGAGTCGAGTGGAGTCGAGTCGAGTCGAGG
GTCGCTCCTTGATTTGTTTGCTTGGGGCGAAAAGCTGGGGACAGCGACTCCTTCGACCAT
TTGGGCTGCCCTTTTTAGCCAGCAGCATGAATTTATTTGTTTTGAAATTGTAACTTTTGC
ACTCATCCGCATCCGCAACTGCAGCAGCAGCAGCAGCAGCAGCAGCAGCGGCAGCAATTG
CATCTGCAGCAGCAGCAGCATCATCCAGAGCATCCACATCATCGGCAGCACCATCGTCAT
TATCATGTTCATTGCCAGTGATTGGCTTTTTCCATTTTTCCCTTTGCTGATTGTGCGGTT
TCGATAAGAATGCAACTGCAGTTGCACTCAGTAGCTATATCTTCTTGAAAAGAAAAAAGG
GTTTAAGCACACACATTCATATGTGGCAGCGATAAATTAGCAAAAGGGAAAAGGAAGTGC
ATGACTGCCAAAATGTCAATTGGAGGCTAAGAAAAAGTGATGGCACGGCTGCAGAGCAAT
GCCATCGCGAAAATCGGGGGAAAGCCGTAAGAACAGGCAACGAATTTTCACTTCATCCGC
AGCGGCGGAGAAATTAAAATGGGAAATGCAGTAGCAAACGTCGCTGTGGAAATGCTCTGC
GTGGGGACTTAAATGCGAATTTCAATTGATTACATTTTCGTATCTTTCTCTTTGATTTTT
CCCACTCTTTTTTGTATGCCAAATTTACTCGGGATGACGTGCACTGAAAGAAATATTACT
AAATATATGTTTCTAATCATTTTAGACGGGTTTAAAAGGCTTAACAGAAAGAAAGTAAAG
GGGCTATATTCTATATTGATATAAATCTAATATATTCTATAAATTTCTGACATTTAATCA
CAGTAAATTATTTTCCATTTCCCAGAGCATTTGCTCGTCGCTTAGAGGCATTTGCAAATT
TAAGATTTGTTTTCCTCCATCGCCAATTTTCCCCCAATATTTCGCTGCTCTCGATGCTCC
CAAACGTGAGCGCGTGCAGAGCCGCCGATCATGAAGGGGGCATATGGCGGAGTCGGGGAT
ATAGTAGTATGATATAGCCGGGATATAGTGCGGGTGGAGACGACGTTGGTGATGGAGGTG
GAGGGAGTGCAGCTGGAGGTGGAGTCGAACAATGAGTCGCACCGAGGAGCATACATTACA
AAGATTACGGCCGCTTCTACTGCGGATGCAACTCTTCTGGTTCTTCGATTTGGCAGCAAC
TTTTACTTATTGCTTTGGCTCTGTGCCGTGTTTATTTCAATCTTTTTGTGTGTGGTGCTG
TTTTTCTGGGCTCTGGGCTTTAGGCTTTGGGTGTTTCGCTGCTTTTGTTTTCTTTTAATG
TGCCAGAAGTCGGAGCCGTGTTCTGCTGCGAATTCGTGAAACGTGATGCCGAAAGTCGTT
TCTTTGCCAGTGTTTTTTTCCACTTTTCTCCCCTTGTTTTTTCGGGGTTTTCCCCTGGTT
TTCTTGTTGATTTTGGTGGAGCTGCCCTTGGTTATGCTGTTGTTTTTGTTGTTTCGTTTT
CCCTTTGTATGTAGGATGCGGATGCTGTGCATGTTTGCTCGCATTTGAATATGGAATCCA
CCGCTCTGCCGGCTGGCTTTACTGCCTCTGGCTGGGAGCAGTCATCCTTGTTAAGCGGAT
CCATAACAGGGCATTGTTTCAGCCACTTTTTAGTCGCTGCTGCCAGTTGAACGTGCAGCC
CTATTAAGGCTCGGATGTTGAGAAAAGGGAGCCACAGCGATCGCTGTTTATGTTTTTCAG
AAAACAGGTAACATGAGAAATATTCTAATTTTAAAACGAACAATTCCATTTTAGATATAT
ATACTATTCTATACTATATATTGTTATTTTTTTCAAATTATTTACTAAGTCATACTTAGA
TCATTCTTCACTATGCGAGTCCCTACTGTATCTAACTTCCATAGAACCGAAAGTCGCCTG
GAAACTTTTTACCCATGGCCGTAAGTGAACCGAAAACGAAAGCCAAATTGGCAACTTTCA
GCCATTCCTGTCGCTTCCATAAAGAATGAAAAATGTCCGCGTTTCTCGCCCTAATTGGTG
GCGAAACGTTTGTCGCACCAAATAAATAATGATAATGGCACCCGGAGCGTGAAGTCGCGG
GTTCGATTCCGATTCCTTCCACCCGTAATATTTCTACTTCTACTTCTGGTTCTATATTTC
TATATATTTGCTTTGACTTCAACAGAGGCCATTGACTGGCAAAATGCTTGCTGATTGATT
GACGCTGCCATTGGCAGCTGTTAACAATTCCATTGCTGTTGTTTTCGGAGGTGCTGCTGG
TGGTTATTGGCGGCTTGGTTTGGTGGATAGTGGCGGTAGTCCCCATCCACGTCCCATCCA
CGTCCACGTTTGCGTTGTAATGTAATTAATTGCTTTCCAACCTGTGGCCAAATCACAAAA
GGGCAGTCAACAGTTCCAGCGGCAAAGTGGGTCAGCTGTTCACTTGATGAATGTGTGTAC
GCATGGTGGTGCCAGGGAGTTCGGACGGTACAGGTGGTGCCACAGGTAGTGGCAGATGCG
GAGAGTGGCAGCTCAAGAATGCAAGTTGAGTTGTCAGCCGAGGAACGTATGAGTTATGAA
AATAAAGCTGGTGGCGAGGGTTAAGTGTACAACATTTATCAAGAACAAATAATGCAGATA
AAATAAATATAAATAAGAGGGAATAAAGATTACACATTCGTTCTCAATAAATTTTAAAAA
AAATGTGTTATTTGTTTCCCAAACACTTGTAACTGGATATTACAAAGGTCAATATTTAGA
AGATGCCAAATAATCATATATTTCAATATCTTACTAAAAGAAAGAAGGGAAAATATTTAA
AGTTAAGTCCATAATTAACTGAATATGAAGAATACATAAAAGCAAATAAAACAAAACTCC
ATCACCAGTAAAATAAATTATACCTAATACGCTTTAAGCAGCCCTCGCTTGACCACTGCA
GTTAGCGAGTTCAGTGAACCGCCGCATTAACTAACTTTTCGTATGAATCAAACGCTAAAA
CATCAATCAAAGCCAAATTAAGCGTAAAATTCAAAGAGCCGGGCCAGTCAGCAGTCAAAT
ATAAGGCAGAGTAGGGTAAGATGGAGTCGGACGAGCAGACCAGAAGTGCGAGGCACGATG
GCAGGAGGAGGGAGTGCACAAAGGTTAGGCCCGCACGGCGACTCCGGCCATTCAGGGAAG
ACCCAGCCCGCATCTGCAGCGGGGGCAATCAATCAACGGGCGGACAAGCTTTCCAAAGAA
AGGCGGCGAGCGGCGAGAAAAAACGCTGAAAAACTGAAATAAGGCCCGAAACATGAAATA
AAACAGCGACAAAAGTGCAAGCTTCGCCAGAGTCACTGAAGCCTAACAAACGTTGCAGCT
AATTTTAGATCGCAGTCTCAGCCATCGCTTCATTTGCATGAGTGAGTGGGGTGAGCGGGG
GTAGGGAGTCGAGTGGTGCAAAGTGGTGCGGAGTGGCGCAGCACAGTCGTTCGCGATGAT
CTGCAGTGTGTGGGTTGCTGCTCGCAAAAGTGGCGCACGCACAAAGGCGAACAAAAGGCT
GGAGATTTATTTTAGCTGTCTGCTCGCTCGGTGTGTGTTATGCAAATCTTCCGACGGTTT
CCTGATAAATCCCTTCTACCGTTATAAGCGATTTCCACAAATTTGATAAGGCCCAAAACG
AAAGACTCAGGCAACGAACTTGCGCTGATAAGAACAATCTTCGCTGTCTCTCCGCTCAGA
ATTTTCTTCGTCCCTCGCGATGCTCCTCACAACCCATCGCATTCTTTTTTCACTTTTATA
TGTGTTTTTTCTTTTTATTATGCAGCCCTACGTGCTCGGCATGCTGAAAACAGAAAATCA
AATCTTTTCCAATGCATTTCCCACACGCCTGTGCCTGTGCATTTTTAATTTTAGCTGCCG
GGCGAAAAAGAAATTAAAAAACAATATTTAATCAACGCACATAATCTGCATTTTAAACAC
AGACTTCAAACGGCCCTTCAATATATGGGTGTTGACCATTTAACGCGCCCAGCGAAGAAT
CCAAACTTTGTTAGATTTTTATCGACCGTTTCTTCGGGGTTTTTTTGTGCCCTCGCTGAC
GGACTTCCTTGAAATCCGGCAGAGTTTTCGGTCTTGTTAATCCTTTGACGTGATGTCTGT
TCATAATTTGTGCTCATATTTCATGCTTTGCCTTTTTTTATGGCTCTTTTGATGGCTTTG
GCCTTGCGGCATTTTGAAAGGTTTTGTGTATGCCAGAGCGATTGAATATTCTAAAGTTTA
CTTGTCGTAAATCATATCTGTGACAGTTTTGCCAACTTCTACCTCCTTTCCCGCGGAAAA
ATCGCCCGTCTTTGCATGCATTATGGACCAAGTTCATTGGCTCGACCAAGTTTCGGCGGA
GAAAGAGATTCTCCCACAGTCCCTCCCAAAATGCCAATCTTCTGCTATAAATAAACTACG
AACTGGCGAGCTCTGCTTTTAATTTTAATGAACCATAAAAAATTCACACGCACCGCACAC
AAAGACGCTGAATATTACGATGCCACCAAATAAAGGTTGACACCGAACAGACCTTTCCTC
GATCCCTCGAAATGTTAATGAAACTTAAATACCTGCGAGAGTCGCATTTCTCAGCAAACA
AATCAAACGGCCGGCAGCAGCAGCAGCAACATAAAAATGCTCAAAATTCAAAGAAAACTA
TTAAACAACTGTTTGCCGTTTATCTGAGGGAATCTCTTGAGTTTCGAGTCTGCAGTCCCG
AATCTCGAATCTCTCACCATCCAGAGTTTGCTTAGAAATTAGAGCCCAAAACAAAGCGGT
AGATGGATGGTAAAACCACCCATACATACACGCCTGCACATCTACAAACATACGTATGTG
TGTGTATAGGACCGGTTTAACATAGCCCTGTTAACGCGGGCCAGTTAACAGCGACGACGA
CTGCGACGCCGGCAGCGGCAGCAGCGAACTTATCTGCGTTCTGGCCACTCAACTCAACTC
TCGGGATCCCAGAACTTCGGCTTTTCATTAGCTTGGAGCTCGTCGCTCCGACCGGTTCGG
TGTGTCCCATTGCGATCGCGAGTTCAGAACGCTTTTTAACCAAATAGTTCGCAGAATAGA
ACACCCAGCAACGAGAGTGAGTTAAGATATTGTGCGCGTGCGCAGCAACCCACGCGAGAT
TTTTCTTTAGCTCAGCGGCTTTGATCATCCAGCTGAAATTCGTTTCGTTTTTATGCAAAT
TTTCAACGGCGAACAAAATACTGGTATCAGCGTGTGTTTCGTCACAGTGTGAAAGTAAGT
GAAAAAAAATTCTTTGTGCAAAAAGAAATTTTCACAGTTCAGCGAATATTACGAAATACT
TACGTTGATTGCTAACAAAAAAAAAATTTGAGTGTGTACGAAAGCAAATAGAAAAGAGAG
TTTCGATCATTGTGTGCGTGTTAATTGATCAACAAAACAGTGTATATTTGTATTTGTTAA
ACGTAACGGCAAATTTTGGATTTCGGTTGTGTTTATGTGGAGCAGAAGGTGAGCAATCGG
TGGCAAATAATATTTAAAATACAATTAGCGTCATGCTCTATAAATTGGGTTAAATATCGG
ATATAAATAAAGTGTTTTCTTCATGTTTTTGGAGTAAGCTGGCTGCGAGAATAATCAGAT
GCCAATGAATGACACATATTTACTGATCGGTAAATTAGATTTGACTTTGGGAGAGATGTA
ATCGATTTGGGGATGTCGAAATGGGGTTATTGTGGATTTGATGAATTTTCGGGAATTTAA
TAAAATTAGATCTTAAGTAGATATATATTTATATCATATTTAAATTTTGTAATTGGTTTT
TATGTTTCTGTTAAGAAATAGGAAACTTTTTGATCGAGGCTTTATAGATTTCTTTGGAAT
TTGAAAACCTATAAAAAGATGTACGCCTCATCGTTTTACCACCTAACAGTTATTAAAGCC
TCCATTAAAACCCTGAGAACCTTGGATAATTAATGCTTTCGCTCCGAACAACTTCAATGC
ATCTTCGCCTCTTCAACAATTCTTATTTATGGGAATCTATTAACCCATTCATTATCGGTT
TCATTAGCGGAGAACCCAACTTGTAGCTGACAACTCAATGCAGATGTGAGCCCCCTTCTT
GGCCCTCGTTATCTCCGTTTTAGCCACTTTTATCATCACTCAACGCCAACGCGTGGAAAA
TATCTTTCAAAGACATTTTGGCTGATAGCGTTTTTCAAAATTTCACTTACAAACGAAAAA
GGCGGGCGCAACATTTTCTTATTGTATTTCATTTTCTGGGTCAATAGAGAGGATGGTCGG
GATAGATGTTGGCCCAACCCAGAAATGAAAAAAAAATACAAACCTGGCCCAGCCCAAAAA
AGGGATTTCCCTTTTACAACGAAAACTTTCATTGGCATCAAACGGAGGAAAAGAACGAAG
AAAAGTGTCAGGGCAAAAGAATATGCATACAATAAACACTCGCGGGGCATAAATAAAAGC
CAATGAACATTTTGGATCCATGGCGTCTTCAAAAGGCCATGGCCAACGGTTCTTTGGTTC
TTTGACAACGTTTTGGATTAAAAGCGGTATAATCGTACCAAATACGTTGGGCCAACTGTC
GTTGCATTTCGGTTTCGATTTCCTGTCCCCAGACATGGTATCACCCATCCCCCAAAACCC
CATCCATCGGAATTCCCGATCTTTTTGTGCATTCACCGCATGATTAATAAAAGAGAAGTT
CTTGACGTTCTTTCCCACTCATTGACCGTTTCGTTGATTAGTAAGCATGTCGACATTTCA
ATAAAAAAAAAATATCCAAAACGACATAAAAAAAAGTACAAAATCATCGGCGGGGGCAAC
TCCTCATCAACGTCACATTTTTATACATTTCTACCCTATGAGACGTTCTGTGGCTTTGCA
TTTTAATTGCTTTTGATTTCGAATCTGCGATGTGGCTGCCCCCGCTGATGAATCGGGGAA
TTGGGCGCGACTCAACGGACTATTCAAATTGGCAAAAAATCAAAAATATATATATAGAAA
CACGCATGTGTGCTACTAATCTCTAAGGCAGCTAAAGGTTTGAATTTCCAAGAAGAACCT
TTTCAAATTTAAGTGATTAATCCATTGAATCCATAAACAAATAAGGAAAATCACAAACGC
AAACAAATAGGGAAATTAAAATATATAAAAGTATATTCAAAAGCTTAATGTTTCATATTG
CTCAATAATTCCATTTTTAAATTCCGTTAACGAACTGCACTGAATACGGCTATTTCAAGT
TGTTTATTTTCAACTGATAGTAACCTTTATACAACGCACTTTTCATACAAAACTCCATAT
TACATTGAGCTTCATTTGTAACTCACAATGCGAATAATTGGAAACAAAGCTGAGTTCACA
TTCAAGTTTCGCATAGGTATTCTCCCAGAGTTTCGATTTTATGACTATGTATCGGGGATG
ACCGTGGAATTTCGAATCATTGGACTTACCTTTATCGAGGGCAAATGAATAGCAGCTGTA
ATGCCATGGGAAATTCCATTTTGGTTAATCATTTTACTATTTTTGTCGTGCCAGTTGGTA
TGGGTTCTTATTCCATTTCCGCTATTGATTCGATCTACATCTACGTCAGTGGGAAATCTA
TTTGTATGCTATTTATCTTCTTTTTCCAGTTAAGCACCAGGAATTTTATGGATGTGATTA
ATGCTTTTCGAATAAAAGCTTGAGCTTAGCAAACTTTTCCGCTTCCTTCGGCGAACATTG
TTTTATTTCCTCTTTTATTGTGATAAAGCAAATTAATTCAAGTGCAGAAATATAACCGGA
AAAAGATTCTTTCCAATACTCCTAGTGAATATATTTAATTATTTAGAATAATTTTTTTTA
TGTTTCCTGTACTGTGAAATCAGTTGTAATATTACAAGTAATTTGATGAGCACACACTTC
TCTAAATTAATTTGTTGTTTATTTACGTTGATATCAATTTCTGTTTCAGTTTTAAGAATA
TAATATGTTATAAATACTTTATAAAACTCTGTAGTGTGATGCAATGTGTGTTAATCCCTT
GTCACAGAGTATTTGAAGAACGACTCAACGCCACTTGACAAATGAAAGCAGAAATCCAAA
CTGTCCGCAGTTAGAAACCAAAAGCGTGCAAAAAAAAAAAAAAATAAACAAAAAAAAACA
CAGATAAACCAAAAACAAACACTAAACAAAAAAAAAAAAGTCAAGAGTGGTCAGCGTTAA
TTTTTCATGGCGGGACAACAGCAAAATAATATTATTTCATTTATTTACATCACGGGTTTG
GGTTGTGGAGATGGGCTTTTGGATGGGGCTAAGCTAACGCAATCGCTGTCCGTGGTCCAC
AACGTCATTAGTCACACCAGACGAGGGGGCGGGGGGCGTGGCGATAAGGTGGCTTTTCGG
GTGGAAATCGGTGGAGGTTGGGCTTGGGATATATAAACCAGGAACAGCAAACAAAAGCAA
AATGCTGTGAGCTATGAAACCCGCGGCCGAAAGCGGATAAAAAGTAATCAAAAGTGCTCA
GAACGACATAATAAGGCAACTGAGAACTTGAAGAGCAGAAGTGAGAAAAGGGGGCGCTGG
GGGAGTGGCTAGTGATGAGTGGTGAAAAAGGGGGCTTTTGGCTGAAGGTGTTTCTTTCGC
ACAGAAAAATACTTGACAAAGAGGAAGTGAAATCAAATAAAGAAAAACGAAGCACAAAAA
GGCGATTTTGCGGCAGAAATATTGCATTTATATGTGAGAAATACAGTCCGGATTGCTTAA
GTTGCATTTGGAATCGGCTTAAGAGGATGTCTAAATATTTTATGTTCGCAATGATTTATT
AGGGAATCCCACAGAAGTCTATAGAGATTTAAAGGCTCTTGAAAACACACCTGAAAGTAT
GCAACAGCCAGTGAGTTTTGAAATATTCCTTTAAGGACTTTCAACTGTTTTTGTTAGCCC
TGATGGAGTTGCGTCTACAGAGGAGCCACTGTAGGGTGCTGGTGAACATGAAGTGTTGGT
GTTGGCGGACGCCGCGGATTCTTAGCCGCCAAAGCCCTGAGCTGTAAGCCGCTTGCCGAG
AAGTGCGAGAAGTACGCGATTTTTAAGCCGCGGCTTAAAGTGGTGACAACAGCAATAGTA
TGAAGTTACAGCAACAACTTTTGGCTTCGGCTCCGCCAGCGAGTTGAGTTGCATTTTGTA
GAACTCTTTAGTGTGATTAATGTGCCACACACTGGCAAACACACACACACACATACATGT
GTGTGTGAGAGTTTCCTTTTATGAGCTCTTTGCTTTACAAGCAGGTCGTGCTCCTTACAC
TTTTCCTTTTTCTGCGGACTGTGGACTCCTTCTGCCTGCGAGTTTTTTATACACATTTAT
TTTTTTTTTTTCTGCCAGTTCTTGCTTTTGTTGGGGACAAACAAAAGCCCAGCCACCCAC
ACACACCTTCATGCACAGACATTTTCCGTTTGCACACACACACACACACACACCCACAGC
TGCAACGCCCTAATCCTTTTGACGTGGCTTTTATCGCACTTGCCTGCTTTTTCGTCTGCA
GATTGTGCCGAAAGGGTAGCGAAAAGGATTTTCGAGTTGTACAAACTATTTTACCGCATC
TAAAACTTATATGTCCACTTACTTTATACGATTTCAGCGGCACTCAAATGGTTAGACAAA
TTCCCAAAAATCGGTTTACATTTTTATTTCTCTTTGGATTGCTGGTTTGAGTACTTTATC
CTTCACTTGGCTTATTTTAAAAAGATTTGGTTAGTATTTTACTATATTGTGAGTTGAAAG
TTCAAAGTGTATCGTTTAGTCGGTTAATCCTATCCCGTTCCACTTCCTTTTCCTTTTTCT
TAAAGCTTTCCGTTTCGTTCACGTTTTTTAAGATTTTTTTAACATATTTTGTGTGTTCTG
GGTATCTCATTATGTGCTCGAGCTCCGTCTTGGGTTACATATTTTTCATAAGCATATGTA
TGTGCATAATGGCCACCCTCCCCGCGCCAGCACATATTGACTCTTTGGGGGCTTCATTTG
CTCAAGTGTTTTTTTCTTCAATTTTTTGTTTTGTTTTTGAGGCCCCTCGGGGGCGGTGGC
TCTTGGTGCGTTGCACAGGAAACAGCAACAACAAATAGCAACAGGCAGACAGGATGTTGA
AAAGGATTCCGCTGGGGGAGAAAAATAAAGGAAAAAATCATAAACCTTTTGTGGGGCTTC
ATGCCAAGTCATCTCGTGTCGTGTCAGTCATAAATTAAGTGAGTTTCTTCCAGTTTTTTT
CCGTTTTTTTTTGGTTCAGTATTTTTTTTTTGTTTTTTTTTTTTTGTGAAGAATATTCTG
CGGATGTTGGAGCAGCTGCTTTTTGTGCCACTTTCCAGTGCAAATTCATTAAGACATTTT
CGATGAGATCAACTTAAATGCGAGACGGGGCCAAATACAAATTACGAGCGCTCCGCACGT
GAAAAACTGTGTCATTGTGTGACATCAAAACCAACAAAAAGCCAACAGAAGCCGCAATAA
AAACTAACGAAAAATCCAGACACGTACGGGCCAGGAAACAAGACAGTTGCTGCAGCTTTT
TAGCTCCATCTCCAGCACCAGCTTTACAGATTGCTGATGCTGGACCAATCCTCTCCAGCT
TCAGCTCCAGCTTCAGCTCCAGCTCCAGCCAAGACGGCTCGGCGGCATCAATTTTTGTCC
AGTAGCCGAGAAAATGTCACGTTTCCACATAAGTTACAAAGGCTTTCGGCCACATTGAGC
GTGAGAATTGGCAACTGGCAGTCGCTCTCCTTCGCAGGTCCGTATGTGTGTTTTCCTGCT
CCAGGAAAAGGTACTTTCCATGGTGAAAATTAATTGCCAGCCGTGTTGCAGTCTCACTCT
TTGTCTGGCAATTAATTGGAAAGCAGATCCCCTAAGAAAAAGCGGGTTCAAATATGTACG
CCTCACATGTCCACACACAGGGAAAAACTTTAAAATGATTTTATTTAATTATTCAAAATA
TGTGTGTATATATTGGTTATTGCTCAAAAAAAAACCCATAGAAATTTAATATCGATTTTA
ATAGTTTTTTTATAATGGTTTTTTTTTTTCAAAAGAAGAACTTGATAGAAATACATGCTC
TTGATCTATGTTTTTTCCAGTGAGATTGCTAGCTTTAACTGAAGGCTTTTGTTTGACAAT
CCCGGAAAAGTCGGTCGTACTAAAAATCAATTAAGCGTTTGCATGCTGCAGCCAGGGGCC
AAAAAAGATTTAATAACCTTTGCGGACCAACTAAAGTTAGGGTTATGGTATTATGACCCA
ATAATCGCGGCCGTTGCATTTGGGGGAAGGTGAAGGAACCTCCCCAGGGCTCGTTAAATG
CTTTATGACGGACTCTTTATGGCCCCAACTGGGGTTTCTATAGCTGCTGACTGCTATTCA
TGCTCCAGTTGGAGAAGGGACGGCAATTAGAGATGGATGCTCTTCCCGGTGGACGTAGAG
CATAGTCAACTGGATGGGAGAACTGGCATAAGGACCGCAGCAGGTGCGGTCACTTTGCTA
ATTGCCAACTAATTTGGTGAAGTGGATTCCACACACTGGACTTTCATCTACATATTGCCC
CAAGAGAAACATGCAAATGTTGCAATATGACAAGCAATCAGTGATGACAAGCTAATATGA
TCCTCTAAGAATCAAAAATATTTGTAGGTGCATACTGTTTATAACCATAAGATACTAATT
CAAGATTTAGCTACATTTTTGCAGTAGAAACTTAGCCAGTATTACCCGTAATGCAATTTT
GGCAACACTGCCAGCCATTCAGGCAATACGACGTCTCGTAATCAGCCGCATTTATGTTTG
GCCATAAAATATGCAAATATCCTTTAAGTACTTTTAATGTCTTGCCATTTGTTGGACCGC
TGGCTGTTGGCCCATGGCCATGTCCTCCTCCTCCGCCTCCGCCGACAGTCCTCCTCCGCC
ATCACCTCCTCCCTTTTGTTAATGGCATGTTTGGCATTGTCGCACAGTCGTCTTGTCTAT
TCCATGGAATATATGGATGTATATGCACGTTCCTCTGTTGCTTGCATTTTCATTTTGTGC
ACTTTGCCATTTCTTCAGTTAAAGTCTTCTTCCCTACTTTATGGCCCCCATAAATAACAC
CCTGTCGTTGTATCGGTGTCCATATATATATATATATGGATATATCCCTGTGTGAGAACT
TCAAGAGCTGATCTGCGGACTCAGGAATATTTGAGCTTCGTCGAACTGAAGGGGGGAAAT
TTGTAGGCAACATTTCATTTACCTAATGTCTACTGGGTACCAAAGGTGTGTGGGCATTTA
TTATTCAACTCTGTGACAACACACTTAACATTCTATGATTATTCAACGGACTTCATGGGA
AAAAAGCATTTCCCATATCTCAACAAAAAAAATCTACAATTTAAATTCCAGTGTTACATT
GTGTGTCATTAATTTTATAATAAATATCTGAAACGCTTTTTGTTTTATTTATATTTAAGT
TAATATTTCACCTTTGCAGGGTATCAAATCGCACGCTCTTTTTATGCATACTCATAATTC
CTTGGGAAAATTGCGAACTTTTGCATATTTTTTAAGCTGATTTCCCATGCATAGCATTAT
ATCCTTGTCGTTGAGTGTGGCATTACATCGATTAATGTCTCTTCATTTAATTTGATTCTT
TGCAGGAGAAAAGGCTTCGGTAAAGCAGCTTACCAACTGGCAACGCGAAGGCGTCAAAGG
GAATCGAAAGGAGTGCAGGCAAATTGAAAAGGACTATTCGCACACTGTGGCCAGCGGAGG
AGGAGGAAATCGAACCGAATGCAGTATCTCAACTACGCTCTGCAGACATCCACGCGACTG
CTGACGTACCAGGGCCCGAACCAGGATCTATATCCTGACCAGACAGGAGTAGCCTCCGCC
CACGAGGAGGAAATCAAGCACGCCTGCTGCAGTCGCGGCGCTCAGCTGCTGAGATTGCGC
CACCGAGAGCTGGCCAAGCGACGAGCTCTCGAGGATCAGATTAACGCCAATCAAGAGGAG
CAGGAGGAGACGGAGGAGGACTCTCGGGATCAGCAGGAGCCGCTGCCGGAGGAGTTGGAC
AGCGAGCAGGGAGCCGTCGGCGGGGAGCAACTGCATCCGCAGCCAGTCCAATGAAACTTA
CTCTCATTTAATGTCCAACTGGCGCGCAGCAAGCTGCTATCGTTCTTCAACCGCGACATG
GCCGCCACCGATGGCCAAATCATATTGGCCGCCTCCCGATTCGGCGATGCCACGCCCGTT
TACCTGCGCGACTTTTCCAAGCAGCCGCTGCCGGCGGTGGCCAAGATCATCAAGGGCCAG
CACCAGGCGCTGGGGGTGCCCACATTGTCGGCCCCATCTCTGCAGAGCACCGCCCTATTT
CTGAGCGCCGGCAAGAAGTACCAGATCCTGGCCCAGCCCATCAAGATCAAGGAGGGTCGC
AAGCCCACCAATGTGGGCGCCAAGGTGCTCATCCCGGAGACCTACGGCGGCTACTTCGAG
CTCCTCAGCGAGGATGGTCGCTCCACGCGATGCATTGACTCCGTGCTGGAGCTCTCGCGA
CGGCGAAACGCCCGCGTCCTGGTGCGGGAGACCTTTCGATGCCAGCAGATGAACCGGACC
ATCCACGCCGGCGAACTGCTGACCACCATGAACGACAACGGGAAGTACCTGCAGTGCAGG
AACATCAAGGACGAGATCATCAATCTGCCACTCGATACCAAAGCCAAGTTCTCGCCGATC
GCCAGGGAGGACAGCATCAGCGGTGTCCACACCGTCAAGAATCTGCTGCTCAAGCGGATG
CCAGTCATCGTGAGGTGAGTTTAATATAATGAACGACTTTAAATATCTTAAATATTCGAA
TATTTTCTCAAAGTATCTTAAATTTAGTTTGAATTATAACTTGGGAACTAGTTTTTAACA
CCCATCCTAATATCCAATCCACAGACTCGTTCACGGCAGTGCGCCCAAGGGTCTGAAACA
GCCATTTGTGCCCGAACTGCGACTGCTGGGCTGCGTGGAGATCGACAGGATATTCGCGTT
GCCACTGCAAAAGGACACGGATCTGGTGCCGGTGCCGCTGAATGCCAAGATCAAGCTGCA
GCGAGCCAAGAACATGGAGCAACTGGAGCACTTCATCGAGTACTCGCGATTCCTGGACAA
GGCGCAGCGATTGCTGGCCGATGCACGCGATCGCCTGCAGATCGTCGATCTCAAGCTGAG
CGAGAAGGAGAAGAAAGACTCCAAGTTCAATAGTCGCAATGGGGGCAGGTTGCCGGTGGT
CATGCTGCCATCTGCAGCGGGAATGGCCAGTGGACTGGCGGAAAGTGGTTATGTGCTGCG
CAAGAGTGCCAGTTGTGATTCGTGGTCGAAGCAACAGCAGCAGGCACTGAGCAGCAGCGA
GATTGCGGAGGAGTACAACGAGATCGATCATATATATGATTATGTGAGGGGCCTGACGCC
GCTCTCGAAGGGATTGGCCCGCTTCGAGCCCATCTGCGAATCACCCACTCTGCGGTCCCA
TCACACGGACAGCGGCAGTGGCAACTATTGCAGTTTGATCAGGGCTCCGGTTCACCAGCA
GGCCACCACCTCCGGCAACAACAACTACAGCAGCTTGGAGTCGAACAAGCACAGCAGTAG
CGGCGGTGGCCATCATCCCGGTAGCCACCATCACCACCATCATCACGTGGTTAATCACTA
CCATCATGGCCATATTCAGGAGGACATCAAGCCGGTGCCGCCGCCCATTGAAACGATTCC
GGGCAAGAAGCCGGCGGAGAAGCGCCAGCGTCCCACTCTACCAAAGCTTTACATCAAGAA
TGCCCACAGTGCTGGGAGCAGCAGCAATGGCAACTCCACGGGCACCACCCACAGCACCAG
TCACAGTCACAGCCATAGTCACAGTCACGTCCACAGTCACAGTCACGGGCAGTCACAGTC
GCAGCAGCAGCCGCCGACACCCAATGGGAATACGGGCAATGCGGTGGCCAATGCGGCCGC
CTCAGCGGTCGCAGCTGCTCATCACGGTTCCCACGGATCGCACGGATCACATCTGCACCC
CCATCCGCATGCCAGTGTGCATCCACATCCGCATCCTCATCACGGCAAGGTGCTGACGCC
CAACAATCATCTGCCGAGCAAGGAGGCTCTCGAGCCGCAGTCGCCTCTGTTTCACATCAG
GTAAGCAACCTTTTGGGTCGACTTAAATTAAGTGGCTGCATGGCAAGTAAACTTCATAAT
CAGCTGGAATATTAAGTTAGCAAATGCAAAATCTATCAAGTTCCATTCGAATACTTTTTT
AATGAGAAGTAAGGATCGATGTCATTAAACTCCTATTGCCAACTTTATTTACTTTTTTAC
TTTTGATAGTTATAGTTAACTTGCATTACTTAATTAACTTATTTCAGGTACAAGAGTCTT
AGCAGTCTGCAGCTGACGCCGGACAACAACAATTGCTCCTCTGTGACGCCGCCGACGATC
TCAGCCCACGGCAAGTCATCAGGAGCAGGCGTTGGATCGGGAGCAACTGCGTCGGGCACA
CCGGGCACGCCGGGCACTCCACCGGATGTGGGGCTCAAGTGCGGCAGCATACTGAACGTG
CACGGTTACCTGTCCAGTCCGCATCCTCTGCCATTGCCGCTGCCCCACAGCCGGAGTTCC
AGTAGCAATAACCATCACAATCCGAGGGAGGGTACGCTGGATTCATCCCGCAGCGGAGGC
CGGACATCGGGCGACTCGAACAAGCTGCCCGAGAAGAAGACACGCCGCCTGTCCCGGCCA
AGAAGTCTGTCCAACCTGGTCTGGGATCTGCGGCCCTCGAAGGAGAAGTCGAAGAAGAAG
CTCTACATCCATCATTTCGATCAGCGGCAGCAGGCGACGCTGTATCTGTAGGATGATTGC
ATGGATGTATCTCCAGGATGACGATGACGATGAGGAAGTAGCAGCACGATGATGATGATG
ATGATGATTCGTTGCCAACTCGTTTCTAGCTGCCATCGACCCCCACAATACAGAAACAAA
AACAGTAACAGAAACAGAAACAGAAACAGAAAAACACTGAGAAATAAAACACAATAAAAG
AAGAGCAACTACAACTTTTGGCACGCTGTGTGTGTTCCTGCAGGTGAGTTGGATAGCCCA
TGCAAATCGTGCTGCGTTTTGATTGTTTTTTGCTTATTAAATTCGTGCAACAAACTAAGC
CAACAACAGAAATAAAAACTAAACAAACAATTCAAACGGCCAACTAATGCTTCTTCCCCC
CGCTCCATTTCATTTTGCAGCTTTCACCATTTAGCCTGCAGCAGCAATTTTAATTAATAT
TGAATTGTGCCTTTCCCTGCTACGCCCAGAATTATGCTTTAAAACCAGATTCCAATGGAG
TATTTGATGAGAATATTTCGACCGGATGGAACCACGACAAAATGAAAGGCTGCCAGCACA
CACACACACTACTCACACCACAAAACGACCACAAACACATACACAAAGCCAACATACACA
CACACCACACACACATGCATACACACATCAAGTCTATAAAATTGTGATTTTAATTTTATG
TTTAATTTAATAATTATTGCGAACCATCTTCAAATTGGAAAAAAAAAAACGAAAAGCCAT
TAACGCTGCTCAGAAAAATTCACAAAACGAACTTTAGAAACCACAAAAACTTAGTTGTGT
CTACAAACGAGATACTTATGCATTAAATGAGTACTGTATTTAAACAGGATAGCAAAAGAC
AAATGTAACTAATAGTAAGTCAATATTATCGAACAACCATAATCAATCATTTAGAGAATG
TTATGCAACACTTACAGCTAGCTAAAATGAATTTATTAATTAACGCAATGAATTTCCTCC
TCATAATTTAAATGTTGTGCAAACTGTTGATTGAATGCAATTAAACCATAATCGAACAGC
TCTTGTTTAGTAATTAGTTTGCTCAGAGCCAGATATTTCCCACAATGCCCCCCCGAAATC
CCCGGGAATATTGATTTCCCCATGATCTGCTCGCAATCGCATTGTCTTAGTCGTTTAGTC
TGTACATTTTAGTTGTATTACCCAGCTTATATGGCCTACACATAGGGAGTATATATATAT
ATACATACATACATATGTAAAACTATATAATATAACTTGTATTTGTGTCTAAATAAATGT
CTCAGAAAAATAAATGTATATGCAAAACAAACTCGAACGCTGAAAGTTGTCTTGATTCCC
GAGTGTGGGCGGCTAAACTATCCAATGAAAGCTTAACGGCCTGGAAATTTACTCAATAAT
AACCTGAATTGACCATATATAATTGCCAGTAAGCAGTTGAACAAAAAAAAAACAGAAGGC
GCCAAATGGGGTAAATGGAATTTCTATATTCTATATAGTGTGAGCAACAAATGATTTCAT
AGACTTTTACAATAGGTAAGTATACAAAACAAACTAAAATATAGGAAATTGGACGGGCAG
TGCTGAATATATTTAATTTCTAAATATATTAAATAACGTAATCTTAAATGTCTAAATACT
TTTTCCATTCAAACTGAGTAACAATGTTTTGTAATTAACAAACATGTAAGATTCAAGACG
CCCAAAAAATGTGTTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1247, 25473..25519, 36050..36101, 77585..78733, 78864..80099, 80327..81042, 81200..81517
78117..78733, 78864..80099, 80327..80807
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved