Drosophila_melanogaster Locus pAbp
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster pAbp
Drosophila_melanogaster
pAbp
2R
snoRNA:Psi18S-1347a, snoRNA:Psi18S-1347b, snoRNA:Psi18S-1347c
3725..3861, 3923..4065, 4102..4247
8161
TCGGTGAACAAGTACTTTGGTGGCGCTATGAATCGCATAGATGCTGGTGAGCCCTTTGC
CATTCGGGCCAAGCGGCGCATGGGAAATGGACAGGTCCAGTACCTGGTGGAGTGGGGCGG
AGATACAGCGACAACGGCGATTGGATTGCTTGGAAATTGAACCCTTTGGCATACCGACTC
ATTATGAATTTTATATTCTTCATTTCCATTATCATTTCTTTTCGTTATTATGTATTAATG
AACGCTGCCAACTACGGGCCTCTTTATTTGTTAATGTTTAAAAGTTTATTACCAACCCAC
TGCCAAAATAGAAAAAGATTGTTCAAAATATTGGTTCAGCATTAAAGCGATAAAATGTTA
AATTGTAAAAAAAAAAAACGAAAAAAAAGCAAAAAGCAACTGAATACAGGTTATAATTGT
GCAATGGCAGTTAAGTGTTGCAGCAGAACATAAATAAGTTTTCACAAAATTGGTAAAAGT
ATTACAAGATTAATCTGGAAGCCTATGTAAAATTCGCTGATGAATGAAAACGTATTAAAT
AATGAGAACAATTCAGTTAAGTTCAGTACTGTACTTTAGCGATACGCCACGCCCATGTAT
GTTTTTGAAAAATATACCTTCAAATGGGAAAACTCACAAATCATGTCATGCATACAAAAA
AAAAACAATTGATATACATACATACACACAAATTTAATAAAATGTAGGACTAGTTCAATA
ATTTTCACCCATAGTCTAGGCAAAACTACACAATAATGAATTAAGCCAGTACGTTTTATG
TTTAACTATTAAATGCTACGAAAAATCAAAATTGAGTTGAAAGCAAACTAATTCTCAAGC
CAAGTAAATGTTTGGCCAAACCAGATCGAAATATGTTTAATGAAGTATATAATGCCCAAA
TAAATGTTTCCGAAATGTCAAATCTTTTAAGATTTTACTCAGGACACGCCAGTAGGCGCC
CAAAGTGACACTTCGCTTTGAAGCTTGTCAGGCACCGACGCCTCACACCGCTTCATTAGG
TACTCGATCGCCAGATAGGGCACATGCACCAGACGTTCAAAACGGGAAAAAGAAAAAAAA
AATTATCCTCAGCCATCCTTGAATGTGGTCTATTTCGTAAAAACAAAAACACAAAAAAAA
AACTTAAAAAATTCTTCAATCTCTGTAGTGCCGATTTCCATCGAGAACGAAAAGAAGTAC
TCAAGCACTTCTCGGAGTGTCGACTTGCAGCCTCATCGCTTTATTCTCTGATTTAGGTAA
GTTCGCACAGTGGGGAATTACAAAGATGGGATTCGGTTTTCGGAGCATACGCTAATATCT
GTGCAGTGCCAAAAAATCATTTTCTAAAAGTCTACGCTCATTTTTAAAAGAAAAAAAAAC
TGCATTCCTAATTTTGGATTGTGTTTTATGAGACAAAGTATTCAAGGACATTGGCGAAAA
TATCAGAACATAAATGAAGCAGAGTTACCAAAGAACCCCTGAAAATGCACAAGTATTTCA
TGTTTCGGGAATTAGCTAAATATAAAAATTTTTTATGTGTGATGGCTGGCTTTTTTGAAA
TTCAAAATAATGCTTCGTAATTAGTAAATTGTCCTCACGGATTTTTTAGTGACATTTATT
TGTCTCTAACCCTATGTGGCAGCATTGTGCAGTGGGATTTAATCGATACTTTGTGGGGTC
ATCGCTAACGAATCTCCTCTCTATGAGTCGTGTAGAGTCCGTTTACGTGAGCGGTCGTGG
ATTCGCTTTCAGCACACGGCTTATCACATATTTTTTGTGAAGAAAAAACATATAAAAAAT
AAAAAAAAATATTAAAACACAAAAACGTAACAAAAAAAATTGTAAAAAGTAGCAAAAAAA
ATCGAGCGTGTTTGAGAAGTAAGTACAGTGTAAAGCTATTGGTTACAATGGTGTAGAGAG
TGAGAGGGCGCAACGCACGACAAAGCGAATAGGGAAATTTTCCTTTCCCATCGAAATTTG
CTTTGTTTGCGGTCGTTCTTCGCTCAAAGATGGCGTCTATAAACGCCAGATTGCCCGCAA
AATAGTGGTCTAGGAACTAGTTGTCGCATATTTTCGAGAAAATCAAAGAATTCCCCAAAA
TTCGATCAGGCAAACGCGTGTCTATCTTTGTGTCTGTGTGGAAATTTTCCAACACGAAGA
GAAATAAAAGGGGAGAGCAAAGAGCAACAACAAAGCAAATGCCAACGTTGCCATGTCTAC
CGACTGTCACATGTACCAGTGTTGCCACCCAGACACACAGACAGAGAGACGAATAGAAGA
CCGAAAGCCACGCCGCTTTTTTTCTTTCTATTTCACCGCCTGCCTGGTCGAATCCATCCG
GTCCGTAAAGATTAAGAAAAAACCCAAAATTCAGTGTCAAAAAAGTGGAAATTAATTGTT
AAAAATTGCAGGTAGACCTGATCACCAAATATGGCTTCTCTATACGTCGGTGATCTCCCA
CAGGACGTCAACGAATCGGGACTTTTTGACAAGTTCTCGTCTGCTGGTCCAGTGCTGTCC
ATTCGTGTCTGCCGCGATGTGATTACCCGTCGCTCGTTGGGCTATGCCTACGTCAACTTC
CAGCAGCCAGCCGATGGTGAGTAATCCCCGCAAAAGTAGTGTAATTTTTTTAGTCTTACT
GCCCGCAAAAGTAGCCCCCTTCCGCGCGAAACAAAGAAAACACGTGTGCAGTTTTGCACT
CGCTTACTCACACACGCACGCACACTAGCGCATGTCATACAGTGGGGCTAAACGCAAGTC
CAAACTGGACTTTATTGAAAGATGTCTTTCATAGGAGACCAGATAAACGGCTTCCAAGTG
TTTCATAACTTGTTCCACAGTGCACTGCTTACGTTAATCTCGTCGCGCACACACACACGC
ACTCAATTCCCGCCAGTGTGTACACACACACACATGATTATATCAGTTCCAGTTATTCTG
GATGTATACGATTTGTGCGGGGGGATGATGGGGGCTAAACAGCTGGCTCGTGGCACTCAT
CAACTGTTCGCCTAGAAATTTCCGTCTCAATTTCGCACAAAATTGCAATTATGATGGAAT
AATATGGTTCCATACTGCCCAAACTGCTTATCGCAGCCCCGCCCATTGGTGGTTTCATTG
TTTCCTTGCCCGTTCTTCTCGTTTTATTCGTGTGATGTGTGTTGTTTCCAAGCGGCAAAC
TTGCGCGCACGCACACGCCGACGCGCAAAAACATGTGTTCATTGTTGTTTGGACCATTTC
TTTTTGGCCTTCATCTATTTTAGGTTATATTCCATTAACTGAGTTTCCGCACGTTCGCTC
TTTAGTTTTCGTACTGCCTCCAACTTTTGTTTTGCTTTCACTTTCTCATATCTTCCATAC
TCTCCGCATTCCATCCATCAACACTTCCAAATTCTTGACATGTCAGTGAACTGCTTTTCG
GCCTCTCTTTTAACCATCAAAATCTTGTTTTTACAAAAAACGAAAACAAAACTTTCACTG
CGCATAGTTGGTGCTTCTTCGATTCCCGTTGTTCGCTTACATTTGTTTATTCAATTAAGC
GCACAATGGCACAAAGCTGGCGGTTGGTGATGATTACGCTGCGTGTGAAAGTCTGTCGCA
TTCCAGCAAGTTTCTTGAACTCTAGCTGTTAAGGTTAGGTTGGAAAAACAGACCTTTCAA
AAATGATACCATCTCGTTCTAGACTAGTAACACCCTAAATGTTTTTCTTTTTTCGATTCA
TATCTCGCAACTCCTACCCATTGGTTGGTCAGATTTATCTCTTTTTGACACGACTAAGAT
TCAATGTTGCCAGAGAAAGCAATGCAACTTACCATGTAGATGGCTGATCTATGCCATCCA
CAGAAGTAGAAGCATAACAAACACTAAATAATACATCATATGATTAGACTCGAAGGATTA
TGCCCTTTCTTATCTAAGCTTCTAGCAACTTCTACCCATTGGTTGGTCAGATTTAACCCA
TTTTGACACGACTAAGATTCATAGTTGCCAGAGAAAGCAATGCGACTTACCATGCTGATG
GGTTTTGCATACCATCTGCATAACAAACACTCAATGTATCACATGATTAGACTGATAAGA
TTGTCCTTGTATTTAGACATCTAGCAACTCCTACCCATTGGTTGGTCAGATTCAACCCTT
TTTGACACGACTAAGATTCATAGTTGCCAGATAAAAGATCAGACTTGACTTACCATGCAC
TGCGCTGCTTTTGCTCATGGCCAGTGCAGAAGTTGAAGAGTCACATTGTTATTTAAGCCC
CTTCAACTTATAATGATCTTGATATACCCAAATCGTGTCGGTAGTAACCAAATGTTTTCC
CGATTTTCATCAACAGCTGAGCGTGCTTTGGACACCATGAACTTTGACCTGGTTCGCAAC
AAGCCCATTCGCATTATGTGGTCTCAGCGTGATCCTTCTCTTCGTCGCTCAGGTGTGGGC
AACGTGTTCATCAAGAACTTAGATAGGGCCATCGACAACAAGGCAATCTACGACACTTTC
TCCGCCTTCGGCAACATTTTAAGCTGCAAGGTAGCCACCGATGAAAAGGGCAACTCAAAG
GGCTATGGATTCGTCCACTTCGAGACCGAGGAGGCCGCAAACACGTCCATCGACAAAGTC
AATGGCATGTTGCTCAACGGCAAGAAGGTCTACGTGGGTAAGTTCATCCCGCGCAAGGAG
CGCGAGAAGGAGCTGGGCGAGAAGGCTAAGCTCTTCACCAATGTATATGTGAAGAACTTC
ACTGAGGATTTCGACGATGAAAAACTGAAGGAATTCTTTGAGCCCTACGGCAAGATAACC
AGCTACAAGGTCATGTCCAAGGAGGATGGCAAGAGCAAGGGCTTCGGATTCGTTGCATTC
GAGACAACAGAGGCTGCTGAGGCGGCCGTTCAGGCTCTCAATGGCAAGGACATGGGAGAG
GGCAAGTCCCTGTACGTGGCTCGTGCCCAGAAGAAGGCCGAACGCCAGCAGGAGCTGAAG
CGCAAGTTCGAGGAACTGAAGCAGAAGCGTCACGAGTCTGTGTTCGGCGTTAACTTGTAC
GTTAAGAACCTGGACGACACAATCGATGACGATCGTCTGCGCATCGCGTTCTCTCCATAC
GGCAACATCACATCGGCCAAGGTCATGACCGATGAGGAGGGTCGCTCCAAGGGATTCGGC
TTCGTGTGCTTCAATGCCGCAAGCGAGGCTACCTGCGCCGTCACCGAGCTGAACGGTCGC
GTCGTCGGCAGTAAGCCGTTGTACGTTGCTTTGGCCCAAAGGAAGGAGGAGCGCAAGGCT
CATCTCGCCTCGCAGTACATGCGTCACATGACCGGCATGCGTATGCAGCAGCTGGGACAG
ATCTACCAGCCCAACGCGGCTAGCGGCTTCTTTGTGCCGACCCTTCCGTCAAATCAGCGT
TTCTTCGGTTCCCAGGTGGCCACTCAGATGAGAAACACACCCCGCTGGGTGCCCCAGGTG
CGTCCCCCAGCAGCCATACAGGGTGTCCAGGCCGGAGCTGCCGCTGCTGGTGGCTTCCAG
GGCACAGCCGGTGCGGTGCCCACTCAGTTCCGTTCGGCTGCTGCTGGCGCTCGCGGGGCA
CAGCCTCAGGTGCAGGGCACACATGCCGCCGCTGCTGCGGCTAACAACATGCGCAACACT
GGAGCACGCGCTATTACTGGCCAGCAAACTGCAGCACCCAACATGCAGATCCCCGGAGCC
CAAATCGCTGGCGGTGCCCAGCAGCGTACTTCCAACTATAAGTACACCTCAAACATGCGC
AATCCTCCAGTGCCACAGTTGCATCAGACCCAGCCAATTCCACAGCAATTGCAAGGAAAG
AGTAAGTTTTAGGTCGACTGAAAATATGCACAATTTGTCACTAATGGCACCATTGCTATT
TTTCTTGCAGATTCTGAGAAGCTCATTGCCTCGTTGCTGGCCAACGCCAAGCCGCAGGAG
CAGAAACAGATCCTGGGCGAGCGTCTGTATCCGATGATTGAGCATATGCACGCCAATTTG
GCTGGTAAGATCACCGGCATGTTGTTGGAGATCGAAAACTCTGAGCTCTTGCACATGATC
GAGGATCAGGAGGCCCTTAAGGCCAAGGTGGAGGAGGCTGTGGCCGTGCTTCAGGTGCAC
CGCGTCACCGAGCCCGCCAACTAAGCTCGAACAGCTCAAGCGTATGAACATTTTACAAGA
ACACTTTACACCCAAAAAGTAAGTAGTCTACAAATTTTCCGAAAAGTTCAAGCTGTCTAA
ACTCGCCTCTCTTTTGTCCTTGCAGTTTTCCACTAATCTTTCAATACATGAACAACAAAA
ATTCGCATTCACTGATGCTTTGCGCAGGGGAGGATTGCCAAGGACACACAATTAACACAG
AAAAACAAAGCGAAAAATCTACGGCTTTTTCTTTTCTAATCCCAGAAACATCAACAAAAG
CAATTTCAATCATTTAATTTCGAACGCATTTACGCAAGTACACGAAGCAAAAGAAGAAAG
TCACGCAATCAAATTCTGCAGTCCACTTATAAATTCTTTTTTTTTACATAAACATGTTAA
TTAAAAAAAAAAACGGAAAAATGTGAAATGAAAAAAATTTCGTTATTGCTTTAACTGGAT
CGATATTATTTTGTATGCGTATAATGAAAACACCAAAAAACCATTGCAAAATAAACAGAT
TAAAGCAAAGCATACATGTAAACCGCTTCTTGCAAGTATTGAAATTGTGTTTTAAAAATT
TTAAAGAAGTTTCTAGTGTTACATACATATTGAGTTTTTCGTACACTTTTTCCATCCACA
CTTTCAAACAACAACAAACACGAAAGCGATATGTAATTTTTTTCAATTCTTTTTTCTCAA
ATTCAAACTTTAAGAAAGCTTTGTTTAGAAAAAGAAACGCGACAACCATACACTTTTAAA
AAAGCAAAGAAAAAACAAAAAAATTGCAAAAGAGTTAAAATAAAAACGAAAAAATGGAAA
GCAAACTGTGCAGAGAACAGAAGAATAGAAAGAAAGAAAGAAAAAGAAAACCGCAAGAAT
ATGAGAGTCAAGTTTTTGCTACTTTGAAAAAAGAGAGAAAATACAGAATACCAACAGCTG
AAAAAATATGTTGACAAATGAAAACAAAACATAAATCGAAAAAACTACAAAAAAATGGCA
AAACCTATGTAAAAACAGCAAAAAAAAAATAATATATATAAACACAAAAACACACACACA
GCAACACACATATTAAACAACCACAACATATATGAGAAATACAAGAAACACATGAAAAGC
GCTAAAGCGTAAACAACTTATGAAGCATATTAATAAACAACAAAAAAGCAGACAGGATTT
TTATGATTACACTATTATCCGAGAGAAGGAAAAACATGCATACATTTATAAACATTTGCA
AGAACATATATGTATTTAATGAGAAGGAGCTGGTAAGTCGCCTCGATTTCATTTGCGTTC
CGATTTCTGTTACAAAGGATATCGAGAGTTTTACCAGTAAATGATGTTTTTACACCATAC
ATACATAAAATGATATATTAACGCAAGCGGAAGTAAGAAATGGCTTTCGCTCTGGGCAGT
GAAATACATATTTTTTTATTAAACAAATCGAAAACTAAAAACAAATAAAAACCCAAGGAA
AAATCATTGAAAAAATTGCAAAACACAAAACCACATGTATGCAGAAAATGCAAAATTATT
TAAAAAAAACAAACAAACAAAATAATGAGAGTAAAACAGAAAAAAAAAACATAACCAAAA
CCCGAATTGGAATGTTAGTTCAAGGGAAATTGCGAAGAAGAAAACTTTTACTTTTCACGA
AATATACGCAAGTCAACACACTTCTATATATAGCAGATATATATATGTATCCTTATATAT
TAAAGCGAAATAAAACATAATTTGTATGATTAAAGAAAATAGGATTCTTGAAACTTGATT
GCCCGTCTTCGAAGCAAAAGCCCAGCAATTAAAACCATTTGAAGAAATTGTAATAAATGC
AGAGAGAAAGTCCTTAAAACATACCTTTGTACACCCAACAAATTTAATTACAATAAAATT
CCACTTCGGCAAAAGCGAGTGTTTTCATTTTTCAGCGGAATGTGGGTGGGATGGATTTTT
ATGTTTAATATCTATTTAATATTAACATACATATATGATATTGCTTTCATATGAGATGAG
AT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1255, 2411..2595, 4336..5820, 5890..6197, 6265..7161
2430..2595, 4336..5820, 5890..6140
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved