Drosophila_melanogaster Locus Uhg1
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Uhg1
Drosophila_melanogaster
Uhg1
2R
snoRNA:Me28S-G3081a, snoRNA:Me28S-A3407a, snoRNA:Me28S-A1666a, snoRNA:U29:54Eb, snoRNA:U29:54Ec, snoRNA:U76:54Eb, snoRNA:U29:54Ed, snoRNA:U27:54Ea, snoRNA:MeS28-G3277a, snoRNA:snR38:54Eb, snoRNA:U31:54Eb, snoRNA:U31:54Ec, snoRNA:U31:54Ed, snoRNA:U27:54Eb, snoRNA:snR38:54Ec, snoRNA:Me18S-A28a
1112..1180, 1606..1692, 1836..1908, 2124..2209, 2376..2463, 2645..2717, 2880..2966, 3133..3201, 3351..3427, 3593..3668, 3840..3906, 4076..4142, 4315..4381, 4541..4612, 4777..4853, 5006..5072
6226
TGTGGCGCGCTATCATATAAAGCTGTCCGATCTTGTACTGTAAAGTGATGAGATAAAAA
CTTTATTTCAGACAATATTATGAAGGCAAAGTACAAGCGGCCACACACCTCCTCCACCGT
AAGCGGCATGCATACGCGATACTCCTTGATTAGCACCATTTCTTTGGCGGATTTGTATGC
CGGAGAAAATACAAATCAAAACTTTGAACGTTACGCAAAGAGACACACACGCGACGCAAC
GGCAAGCAACAACAAATACGCAGTGTGGCCAGGCAGCAGCTGTTTAAATACATTTCGGGA
CTTGGAATAGAGTGCACGGAGAGGTGGAGCACTTCGTTGAAATATCAGCAGTGTCAAGAA
CCATTGACAAATATATCGATAAGACCGTAACAATATTTTAATAATTTAATTAAATGAATT
CATATAATAATGACAACAGTTTTGATATCGTAAGTAAAGTGAACATCAACAAAATAATGC
ATCGTAAACTGTGTATAATAAAATGAAGTGTGAAAGGTGTATAAGTATTAGATTATAGGT
AACACTAATATCGATAGAATTAATTATATAGTCTATAGAAACACGATAGCATAATCGAGA
TCGAGGGGTTTGAATCGAGAGCTTGATAGAGAAACAACTTGCATACAAAAACTTATCAAG
ATTGTTAGAGCATTCAATATTTTAATAAGAACCAATTTTACTAAGGATTATATTTATTTT
AATTTAATATAAGGAACAAAAATAAATGAACATAATATTTTATAAGAAGCAAATTAACAG
GGGATTCTATTTTAAAAATTCAATAAGCTTATTGCTATAAGCGCATTTACCTTTATTTAA
AATGCCGATGCTATAAATAATGATTACTAAAAAACAAGCTATTTACACTTTCCGTGGCAC
ACGATTCTTGGAACTACCCTCTATAACTATCGATTACATGCTCGATAAATGAATTATCGT
TACAGAATCGTAGTGCGGTCACATCGCCACGTGCATTCTTCCACTTCTTTTTTTCGTTCA
AAATGGACGGTCGCGTTTTCTGCTTGAATTCTCAACTAAAATTTAACAAATGGGTAAGCC
AACGTTGTAATAAAGTGTATAAAATAGGCAGGCTTACATGATGATTTTATTCGTACCGCC
CCAGTCTGAAGAGACGTGTTGATTGGTTATTTATACTGATAGAAAAAACCCGCAAGTTGC
CGACAGATCGAAGTGATAAAATTGCAATATACTCATATTGTTCTTTAATTTACAGGATGT
TGTGCGGTAGCAGGAAATGGAACTGAAAATAACTATGGAAAAAACAGTTTTTATGGCTTT
CTGTCAAATTTATCCACACGTGTCTCAAAGTAAGGTTAGTTTTGACTTAAAATTATTTGA
ACTTCACTTAACAATAGTTTGCAATAGAATAGCCGGATGCTCCTTTTAAGATCTACCGGT
ACCGGTACAGTATCCGTGAAACATGCGAAACAAAAATATTCTTTGGTTGCATGAACTTCA
CGTGTTTCTTATTTCGAATCCCAAAGATTTAATTTAAGAAGTGGATTTTTCGATAGTACT
GTACTGTAACCATATTGTAAACTATTGTTGCTTGAAATCTTTCATAACTCAATGATGAAA
CATTTACCCAGCTCGCTTTGATATTCAATGAAGAGAACTGTTCCATATCCAACGCAAAAA
TAAACTGCTGACTTGACTCTTGCAGCAAGCCATGCGCTATTTGTTAATATATGTATTAAC
ATGGTTGTGTTTCTTTTTGCAGATGGTCTATTCGAATAAAAGAGATTTCGCTTACGGCAA
AGGTGGGTTTTTCATACATTTAAATGGTAAAGAACTTGTAAATGATGATTTATTATTATT
TGCTACTCTTGAAGGTCATTGATGAATACTTTCACCTTAAAACCTGATGTAAAATTCTAA
AAATAAAAATCTCATCAAGAATTGTTTATTTATTGTATTAAAATATTTTAATTGTGTGTT
TGCAGATAGACGGAAGATTATATGATTCGAAATAAGTTCTTATAAATTCCTAGGGATCTG
TAATGTCGGACTCCTATTTTCCTTAATTCCGGAAAAATCAAAATGTTTAGGTAATAACAT
TATTATATTATTTGTAATACATATTTAGTATGATGAAACATTTACCCAGCTCGCTTTGAT
TTCTATGAAGAGAACTGTTCCATATCCAACGCAAAAATAACTTGCTGACTTCAATTATAA
TAGATTAGATCTAAGAAATTTTTTAACACAAATTTTAACACTTAAAATATTTAAATTTAT
TTCCAGAATTTAAGTCAGTGATCCTGGCCGTCTGCTTAAGGAAAAATGAGAAAATGAGGT
AATTAAAAGTATAGTTTATAAACTAGCATTTATATATTTGTATGATGAAACATTTACCCA
GCTCGCTTTGATTTCTATGAAGAAAACTGTTCCATATCCAACGCAAAAAATTATCTTGCT
GACTTTTATCATACGCTTATAAATGTGATTTTTCCTAAACCCCTATTACAAAGATTTTTT
TCTCTTAATATATTTACAGAAAATGGTTGACACAAATCATAATCATAATCAAACAAAATA
TACAATCCACGGATAAATCTTTTCTCAGGTGTGTAATCAATTCTTATAAGCAAACTAACC
AAACGTGAAAATGATGATTAATTATTATTTGCTACTCTTGAAGAGCTTTGATGAATACTT
ACACCTTAGAAACTGAGTCAATTATATATTAACAAGTGTTAAATCATCACAAATGTACAC
ATTCAGTACTAACTTATTATTATTCGATTTATCTTATATTTATAGAACAATGGAACACAG
AAATGCGGTCAAGTTTGGAAATATGAGGTAATTTTAAATAAGATTTAAGAACATTTTAAA
AAAGTATGATGAAACATTTACCCAGCTCGCTTTGATATACAATGAAGAGAACTGTTCCAT
ATCCAACGCAAAACTAAAATGCTGATTTAAATCATACAAGAATATTATATTTGACCTTTA
CGAATATGTTCTTAAACATCTTTCTTTTGTCTTTCCAGAAATATTTTTTCAAGTTTACTC
GTTGTTTTCACTGGGTTTTGCGCTTTGTAGTTAAACGGTAAGTAAATTTCTCTATTATAA
TAATAATATAATTGTTCTGTGATGTCAAACCAATAGACAAGCATATAACCGAACAATCAT
GTTGATTTTCACACGACTGAGCCAAAATGAACACTCTCTACTTTTAAAACAATTTGGTGA
ATTTAAATTAAAACGTGTTGCTTTATTTTACAGGGAACGCAGGAAAGCTTAGATATTGAA
CGAATAAAATTTAAAAATGGTAAGCATATAACTAGCAAAAGACTTTCATATGGGCAATGA
TGAACACTTTATTTAAGCCAAACAGTTATCCCTGTCATAAGAATAATTGATGATAAAAGT
TGCTGATTCATATATGAAACTCTTCTCCTTAGTACTTTCCTATTTTCTACTGATAATAAT
TAATGTTTTTATTGTTACAGGTATTTGCACACTATATAAATCAAGCTGCGAAGGAATTTT
GGTGATTAATGAAGGTTAGTTTTCCTCCTACCCTTTGCTGCCTATAAAAATTACCTTTGT
GATGAGCATCCTTTTAAAGCCAAACAGTTATCCCTGTCATAAGAATAATTGATGATACAA
TAATCTGACACAATATCTTTTTAAATCATTGACTGTATGTCTACCATCTTACTAATAATA
TTGTTTTTAATATTTCAGATTCGCTAATATCAACATATTACAAAATAAAACCCGATTGAG
GATGGCTAAAAATCTAAAGGTAAGTCAACTTTCAAATACTATTTTTTACGCACCATTTAA
TTTTTATGATGATTTCGTATACCGCCCCAGTCGGAGAAATGATGTCGATTGGAATTATTT
ACTGATTAGCCAATTGCTTAAATATTTGTGATTATCAATTTGAACTGTTTGCTAAAGTCG
TTTTTCCTTTATCTTGCAGGTATTCCCCGTGTTGACTGACAGCCGATTTGCAATGGCTTT
TTAGTACAAGGTATGTTGATCTATTATCACTCAATCTTTGATGCTACTTACTTTTATTTT
TGTGATGATTTCGTATACCGCCCCAGTCGGAGAAATGATGTCGATTGGAATAATATACTG
ATATATAATTATCCTTTTAATTGAGGAGAATATTGAGACCCTTCTTTTTATTAAAGGTGT
TTTGTTTTTTAACTTACAGGTCTTCATAATATGCAGTACCCAAGTTGGTTTGGATTATAA
TATGTATTTCCAAGGTAGGTCCATCACTAAAAATACGTTAAAGTTACATATGTAGATATT
ATGATGATTAAGGATACCGCCCCAGTCGGAGAAATTATGTCGATTGGTTAAACATACTGA
CTAATCAATGCTTTTCATTTAAGTCACTTAATAGAAGCGTTTATTAAAACAGCGTTTTAT
TTTTCTTACAGATGTTTGAAGATTACCAGGGAAAAAGTCTATCTACCCTGCAAGATTATT
AAGGTGTGTATTGAAAAATTAATTCCTAAAATTTACCTACCTTTTTCTGATGACAAACCA
ATAGACAAGCATATACCTGAATTCACGTGTGTTGCTAACATTTTTGACTGAACTAGACAA
ATATTTTTAGTTTTGTGGAATCAATTGCACGAACCAATTTTAATCAAAACTTTTTCTTTT
TAGGCTTGAACTAAAGAGCGGTCGTTTTGCATGGAAGATCCCAAATGAACGCAGAATATT
AATAAGGTATGTAATTGAATAATAGAAAGAAGCAATTATGATGTGATGAACACCTTATTT
AAGCCAAACAGTTATCCCTGTCATAAGAATAATTGATGATATATTCAGCTGACAACATAA
CGCATTTCGTTATAGTTGATAAATCGACATTTGTTTTAAATCCACATTGTTATTTTTCCT
TTTAGGTAATACCTGACATCTGGCTTTGTGATTCAGCTGAACTTTTGTGGTAAGTATTTG
CTTTAAATTTTTGCCAGCTTATCATTTTTTCTTGATGAAAACCTAGACAAGCATATAGCT
GAATTTCTCTGTCGACAACTCACGCGACTGATCAAGTCATATTTATTTCCATCAATGTGA
TTAACCATTTAATACTGAAACTAATTTCCATCTTATCTGTTCTTGCAGGTATCGTGCGAA
TTGCAAAGATCGACCAACGCCATTTCACTCCAAACCCCAAATTGCTGTAGTCATTTAAAC
AAATAAAAACTCAAAAGATACTGTTTAATATAACGTGATATATTTTATTTTATTTTGCAT
TACAAATTATGTATAGACATTCAATCGCTTCAGTTAGCTGGGAGATAATCGTAACGCTCT
GCTTTCCACATATAAGAATATTGAATTTGTAAATGTTGAGTCCTATACGTGTATATACCT
TTGCTTTGGATGTTCGTATATGTAAACATGTAAATATATAAGTACGTGGTTCAAATACAC
GTTACATATGTGTTTGCTTGGCTTGCGCCTTACATTCTTTATCATTGTAAATATATATAT
GTATGTATAATCATATATTGTATGCGTTGGTTAGGGCCGAGTATACACGTTCAAAAAAAC
CCAATTGCTTGTTGCACAAAAATCATTTGCCCGACTTTTTCGGCCAGTGTACGAACCTAA
CTTTATGATCGTCTAAACTTAACTTCCGCTTCCAACGCTATCAAATATTCAGATGTTTTC
GATTTTTCGTGCGTGGTTGCGTGCCATTTGCACACTGAAACATTTAATGGAAGAAAGCAC
AACTATAATTCGGGTATTTCGGTTAATAGGTTGCTAGTTAGTGGTTTGCATATCGATATA
AAATGTTCAATTCTACTAGACAACATTTATAAAGTTTATCTATTTGATTTGCGGTTGCAA
CGTGTTCCTCCACGCATAGATCGTTCGAAACTATAGCTAATCGAATAATGTGTGCTCCCC
GTTTCAGAAGTGGGACAAATCAGGCCAAGTCATTTTTTAACATCAATGACGATTTACAAG
AACACAAATGGGAAGAGTGCGAACATATACATTGCAGATTCTTGGGTTACACATAGATAT
CAATTCCGTGCGAATAATGTGGAGAGGAGAATGGGTCTGAATCAAATGTCTAGCGTTTGC
TTTCTCAATCACTCCTTTTTCGTTTTGTCTCATCAAATTTAATTTTCTTTTATTACAATT
ACTCAATAGATGTGTTTTCAAAAAACAATAAGGAATCAACAATATTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1072, 1255..1353, 1762..1801, 1985..2089, 2286..2337, 2539..2607, 2805..2846, 3038..3096, 3273..3318, 3500..3553, 3738..3798, 3979..4029, 4219..4273, 4451..4502, 4683..4745, 4925..4968, 5148..5226
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved