Drosophila_melanogaster Locus RpS11
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpS11
Drosophila_melanogaster
RpS11
2R
snoRNA:Me28S-C3420a, snoRNA:Me28S-C3420b
2077..2167, 2556..2646
4128
gcagcaacagcagcagcaaaagcagcagcagcaacagcagctgcagcaatgcttgccgc
aattttatgctgcagacagctgcattaacaatggcaatgaaaaccaggcagagcctgggc
gaatgcagcctccttcgtcctgcattctttgccacatccgtgacgtttagccgtaaacgg
atttatagcagctgcaacgcccgccgcggctgctgattgcgccttgaaagtgggcggcat
ttcaaggccgctcttctggcactcgtttacgttgtcattacttttaatccgacgtattcg
tggggcatgtggagaattagcgctctaggtatttcgcctgtaagtgcggcgagtttgtgt
gccgccaaataaaagaaagcccacaaaatgcaggcacaaaggcattttcctttttttttt
cttggcgtggagcactatgtacttgagtggtgcttgagaaaaacatggcttggctttgac
taaatattcttagtcaatggcgagtagatgaaggtcaatagcggcgacaaactatctgaa
tcagcagatatgcaaattcgagtgcgccaaataaaatattcaaaaagccaaaaccccatt
tgcacaagggcgccatctttcggaatacgtttggtgcttagcacagctttcaaccatggt
ttgagtttgtactgcaaacaggactggataaatgccaatgttaaactatctgttaatgtt
aaaataagttttagcttaacagcacaagataatattcaaatcaaaataatacaatatact
tgaaataataatataataatttaattaaattatagtttttataaagggtatagtgttgta
tgttatcaaatgatgtagttatatgttagccacaatattttactaataaaagccactgtg
ctaaaatgcctaacattgaccttaacagagcctgagttaccgccttcatcagcttggtat
ttcggcaccgctgtgcgacggtcccacttgcggcgccattgAGCAAACGGTCACTCTGAA
TCGTTCTTTCCTTTTTCATCAACATGGCTGATCAGgtaagattccacgagagtgtgctaa
ataaatgaaatacgcgggttaaacggctgatgcgaacccgcaacaagatgccctctgaag
tgtaagtgaccagtgaatggatgaacctatggagcagcgaacaaacgcactgggaagcgt
agcctggaccagcttcgccctaaccccactttagcgcatggtgtcgccaatagtgaacac
gaaatgatgtatattgcagcaaaccgaacgctcgttccgcaagcaacacgcggtggtcgt
tgtgcgtcgcaagagccccaacttgaagaaaaggccccgtttctatcgccaaattggcct
gggcttccgcgctccggcggaggtaagaggaagccgaacaaaccacgactaatgttgcgc
ccccttcgtttgttttccatttcacgccttcccacgcacgccgaatgttcccgcccgtgc
ctgccgcctgcctgttgatccgacaacaccaccaccaccgccaccttgaaccccaaacac
gattccaaccgaacgactaactaaccagAACGAGCGCGCCTTCCAAAAACAATTCGGTGT
CAACCTAAACCGCAAGGTCAAGCCCGGTATCACCAAGAAGAAGCTGCTGCGTCGCTCCCG
CGATGTGGGACTCGGTTTCAAGACCCCACGTGAGgtgatgcccaggagatagcccttgaa
atgcgtagaattccttcactaacaacattcgtatactccccctgctatagGCCATCGATG
GTACCTACATCGACAAGAAGTGCCCCTGGACCGGTGATGTGAGGATCCGTGGTCGCATTC
TGACCGGCGTGGTCCGCAAGGCCAAGATGCAGCGCACCATTGTCATTCGGCGCGACTACC
TGCACTTTGTGCGCAAATACAGCCGTTTCGAGAAGCGTCACCGCAACATGAGCGTCCACT
GCTCCCCTGTGTTCAGgtaaacatatcaataaagctagagctaaaaccctttttccatct
tcatgacatggaagatgtaaaaagagacctaatacctcatactctgatgataaaatcatg
acggtcttcataaaacaaattgctgaaagaacttgactctttttactaaatgtaaaaata
ctgaaactaagccttgtgcgctagctttgtgcttatactgtagggcctcctactaatccg
tgctatttcttaatttgcagAGATGTTGAGCATGGCGATATTGTCACCATTGGTGAGTGC
CGTCCTCTGTCCAAGACTGTGCGCTTCAACGTCCTGAAAGTCAGCAAGGGTCAGGGAGCC
AAGAAGAGCTTCAAGAAGTACTAGAGCGGACAACTACCATTCGGGCGATAATATTTGTAG
CAATTATTCTTTTTGAATAAAACAAAAAAAAGTAACTTTAAccatgggttttctccagtt
cttctctcagtttccacagcatttcagcagtcgtgcagccagctattccattaaaaggtg
tgtaaaatatattattttgtaaggcagctattaactggcattctgatgataaaatcatga
cggtcttcataaaacaaattgctgaagaaccttgactcttctcaataaaaatgagaatac
tgatatttatcaaagaaaagcatattgaaataaatgcaaatactccatactaatgacacg
atttcttattttttacagaaactaaagatgaccgcaagaatatggacacgaattgcattg
aatgtacattattaatatgattttcttaaataaaagttgattgattacaaattatgtttt
tattgaatgatttcaatggcaaagattttcgctttacattttgaatttggcggcggtttc
atttcgaaaagttcgagtgttgcaaagctttcgaatgtagccaaaaattggcatctgtga
aatgttcagcacaacagctggtaacactgaaagagggaaacaaaaataaagcaaaaaaaa
tggaaactggaccgaatgcagaaattggtaaaaattataattagcattgtgtgcatcaaa
ctttatgtttcatcagcgaatagaagagatgggctgataatacaccaaagctgtgccAAA
AAAAAAAAAcccacccaatccttcgatttcagagcttctggagcgcgtcctgttgcgtct
gggaaatgcggactcggatgagaagctggaagccgctgtgggcaagttcctgaccccggt
gatcctcaaaatgaactcgccccacaatgtggtgcgcacaaaggcaagtggatggtcaaa
caacgattggctgggtggttttgtacacccttctcgcatcgtgacattgcaaaattgacc
ggttgactaatgcactaaattttgtttaggtcgtagaagtgctcacccatatcaagaggc
gcctgtcgtcgcgcggacatgtgcaaatacccgtagaggcactgctggatcagtatgccg
cccaggatagcagcaccttcctcaagaacttcgccatcatattcattaccatgggctttc
cgcgcctggcgttggaacaacagactgcgctggccagcaaagtggtgggctgcgaggaca
agctggagagctaccaggacaagctgttcgccctgctgctgcccgtactgtcggacatga
agattcccgacgacccgacgcagcgctcaaagctacttgatctgcaggacaagccagcca
tctgtgcaaactttttggcactgctccaggatgtgctcctcctgccctatggcatcaccc
aggaacaggatgtgcctccgggtctgagcccgtacagttttacacgcatcatcgcctaca
attggcgggccgaagaactggaaaaggtcaagaagggaatagttcgtttcctgtgcgcca
gtgtgtttagtgatttgcagatattcgtgccactggtggtggcttccgcggacacacgtt
tcagcgtagccactccagcaatcacagagctgagcaagctctgtacaatgctggatttca
gcaacccagcggtgactgccccgttgtacactctgttcgctggcaaccaaagcaagataa
ctgaccgccagacacgtccctgctgcgcccgagtgcgccaaaaattgct
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1054, 1588..1713, 1790..1995, 2240..2516, 2718..2810
1043..1054, 1588..1713, 1790..1995, 2240..2363
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved