Drosophila_melanogaster Locus Ef1alpha48D
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Ef1alpha48D
Drosophila_melanogaster
Ef1alpha48D
2R
snoRNA:Me28S-A1322
2032..2104
5520
TTATTAATGACTAATGTCTATATGTGTGGGTTTTAAATGCTTTAGCTATAATTCTTTCC
AGTCACACAGAAAAGTTGAGATCTAGATTTAAATTAATTTAATTGATACCGATTTATAAT
AAAATTTTGTCAAATTATCATTTCATAAAAGATGGTAATTGCATTTATTGTTAACTGATT
TCGCAAGCATAACAATAATCATATTATTAATAACTAATTAATTAATTTCACAAAATTAGG
AAAACACTTAGGAACTTTTAATTGCGTCCTATATAAGGGGCAGGCTAACAACTTTTGTTC
TATGCACAATGAATAAATTTATTGAGTACAAGTGAAAACTGAGTGAAAAAATAGTCTAAC
AAAAAATATTAAGCAGTAAGTTACAAATTCAAATAAATATTAGCATTCTGATGAATTCCA
GAAGAAAAAGTATTAAAACGTGAGATCTTAAGTTATAAATTTTTACAATATTGTATAAAT
TGATACAATACCAAATTACTTATAGTTTTATTTGTAGCATATTTTAGTTGTAGCAACGGA
CGCCAAAAAATGTATAAATAAATGAAACGTATTACATAAATTTAAACGATCTCAAGCTTC
TATTGTTATTTAAAGTTCTATTACGTTAGGGTTCACATACAAATTAAAGTTCAGGTTCTA
GTCTAAAAGTTCAAAATGCGGACTACTAATGCAATTGTTATAGTTTTTAAATATTAAGAG
ATATGTGTTCCAATATTACGTATAGAAATTATAGACATCGTTTTGTAGAAAATATTTTTG
GAATCACTGATTATTTAGTTTTTCATATAAAAACAATGTCGAGCAAACAAGGTTTTTTAA
ATCCCTCAATCGTTAGGTTATTGTATTTTGCCACTTTCAATCACTTAAATTTCAATAAAA
TGAAGTGCTTCATTCGCGCGTAGTGGAAACACCGCAGTGAGAACACGGTTTCTGCTCTTT
TGACAGTTGCGTAGCTTCGGTCACACCATGTGTCAAACGAGGCTTCCTGTGCTGAGCTCT
GCCGAACGCTCGTTCACTTTGTTCGAATCCGTCGCCGCTTAGACTTCGTGATTTCTCATT
CAGCTTATTCGAGAGTAAGTTTTACCTGCGAGGCTATAATTAAGTAATTTCTGCAACGGG
ACTGCAGCCAGAAAACAATTTATAAACAAATATGCAGCTGAGACGCCGAATTTGTGCATA
TTTCCAGTGTTTTTCCTGTGTGTGTGTAATAAACCCGGAGATAACCTCTAACTGCGGTTT
TCCAAAGTGAAAGGTGGCCATAGAAGCAAACACGTGGCAAGTCTGCAAAGGCAAAAATTT
TAACTGGCGTTCCCAGTTAAAGTTCCCAGCATTCTCAAAATAATTTTCCGGCTTTTCCGG
CCGCATTTTCGCCCTGCAATATGGTGCACTTAGTGTGTAATTACTTTGCCACGCCCACGC
CGGACACAGAGGTCATCCACCAGATGTGCTCATTAACCGAGAAAAAAAAACGTGCTTTCT
CTCTTGCCTTTGTCATGACCTATAGATATTCCTTATTCTTTCTTTTTGCGGCATGGAATT
CTAAAATGGCGACCCAGTGGCGTGAGTCAAGTGGGCGAAAAAAATTCGCCTGGCAACAAG
CGAAAAAATGTGCTTTTTTGGGTTTCCAGCCCATTAGCATATCTGGTGAAATGGCACTCG
CATCAGCTATTTCGCCATTTCCAACCGACTCCATAATTGGTTTTGGTAAAATGGCTGCCG
CTGCACTACGTTCTTGAATAATTCGTTGTGTGCCCCTCTCTTTTTCATTTCTTTCCAATT
ACCAATTGTGCCACCGCGGCGAGATCGCTTGCATTTGTACAAGTCACACACGCACACTAA
TGCACATCCGCCATTTTGGTCTCTCTCTCTCTCTATTCCTCTCTTACTTTTCCTCCGGCC
GGCAACAGCGTCACACAAATACACAGGCATAGATATACACACGCATAGGCAGATAAGCAC
ATGTGTATTTGCGAATTAAATTTGCTGGAATTTTCCTTTGGACTCTTCGATTTAACATGA
TGATGATTTTTCAGTTCTGCTACTGAAGACAGTTGACGAAAGCAAAAATACCAAAATCAC
TGAAACAAAATCGAGTTTCCATATGGAATTTTATTTGCACGCTCTTTTCTGTAGTTGCGC
CCCACTCGTTTTACCCACACCCTTACATGCGGGCACTGGACCTAACCTCAAAAAACACGT
TTTGTACGGCTGCAAGAGTTTGAGGTTAGGTTGTGCTCGCGCATGCAAACAAAAGTCGAA
CGTACGCTAGGGAAATGAGAAAGTGTTATACCCACTAATAATTGTAGTTGTAATCCCACC
GAATGCTAACGAATTGTTTTACCCTTTGTTTATTCCAACCTCTCTTGCTCGCCAACCCGC
CGAACCCTGCAACCTTCCAATGTTCCAACGTTCCGTCAATCCAACACTCGAATACACACA
ACAGCCATAGTGTAATCATCCAACATGGGCAAGGAAAAGATTCACATTAACATTGTCGTG
ATCGGACACGTCGATTCCGGTAAGTCGACCACCACCGGACACTTGATCTACAAGTGCGGT
GGTATCGACAAGCGTACCATCGAGAAGTTCGAGAAGGAGGCCCAGGAGATGGGAAAGGGA
TCCTTCAAGTACGCCTGGGTTTTGGATAAGTTGAAGGCTGAGCGCGAGCGTGGTATCACC
ATCGATATCGCCCTGTGGAAGTTCGAAACTGCCAAGTACTACGTGACCATCATTGATGCC
CCCGGACACAGGGATTTCATCAAGAACATGATCACTGGTACCTCGCAGGCCGATTGCGCC
GTGCTGATTGTCGCCGCCGGAACCGGAGAATTCGAGGCAGGTATCTCGAAGAACGGCCAG
ACCCGCGAGCACGCCCTGCTCGCCTTCACCCTGGGTGTGAAGCAGCTGATCGTTGGTGTG
AACAAGATGGACTCCTCCGAGCCACCATACAGCGAGGCCCGTTATGAGGAAATCAAGAAG
GAAGTGTCCTCTTACATCAAGAAGATCGGCTACAACCCAGCCGCCGTTGCCTTCGTGCCC
ATTTCCGGATGGCACGGCGACAACATGTTGGAACCCTCTACCAACATGCCCTGGTTCAAG
GGATGGAAGGTGGAGCGCAAGGAGGGTAACGCTGACGGCAAGACCCTGATCGATGCCCTC
GATGCCATCCTTCCCCCAGCCCGTCCCACCGACAAGGCCCTGCGTCTGCCCCTGCAGGAT
GTGTACAAAATTGGCGGTATTGGAACAGTACCCGTGGGTCGTGTGGAGACTGGTGTGCTG
AAGCCCGGTACCGTTGTGGTCTTCGCCCCTGCTAACATCACCACTGAGGTCAAGTCCGTG
GAGATGCACCACGAGGCCCTGCAGGAGGCCGTTCCCGGAGACAACGTTGGCTTCAACGTC
AAGAACGTGTCCGTGAAGGAGCTGCGTCGTGGCTACGTTGCCGGTGACTCCAAGGCTAAC
CCCCCCAAGGGAGCCGCCGACTTCACCGCCCAGGTCATCGTGCTGAACCACCCCGGTCAG
ATTGCCAACGGCTACACCCCCGTGTTGGATTGCCACACCGCTCACATTGCTTGCAAGTTC
GCTGAGATCAAGGAGAAGGTCGACCGTCGTTCCGGCAAGACCACCGAGGAGAACCCCAAG
TTCATCAAGTCTGGCGATGCTGCCATCGTCAACCTGGTGCCCTCTAAGCCCCTGTGCGTG
GAGGCCTTCCAGGAGTTCCCCCCTCTGGGTCGCTTCGCTGTGCGTGACATGAGGCAGACC
GTGGCTGTCGGTGTCATTAAGGCTGTCAACTTCAAGGATGCCTCCGGTGGCAAGGTCACC
AAGGCCGCCGAGAAGGCCACCAAGGGCAAGAAGTAGCTGGTTTGCTTCCACTCAACAACA
ACAACAACACGCAGTAGTAGCAGCAACAACAAGCATATAACCAACATCATAATGCAGCCA
ACAACACCACTCAATAATACCAGCAACAGCAGCAGCGAACACAATAGTAGTATAACACCA
ACACCTGTCCTGCGCAAGATGACCGATAAGATGATGTTTCAGCAGAAGCATAAGTTTAAT
TTCTTCCATCGAAAGGAGTTTCGACGGATACGAATGCTAAATGCAGACGAGGCCGCCTAA
ATTGGGAAACGGTGGATCCCAAGGATAAGAGTGCACACTGGGAAAACACTTGCATTTATG
CATCCACTCCTCATCCACTTCCCCGTCGATCTTTAGTTTACTAAATATGGTATGATGCAC
GGAGTTGACTTCGTTTTATCATATCATATATAGGAATCCTCTGTAGCATTTATGATATCG
TTTAAATTAACCTTTATACTTTGATATGTATCATTTATCTTACCCTACTTTTGCACACAC
TACTTTGTACACAAGAAAAGAACCAGAATAGAAGCGATAACTATATTTACAAAAAAAATA
AAAACCCTATTTTTGTATTTCTTTTGTTTTTACCACCCAGCCCGTAAAAGAGCACTCTCT
TTGCTTGTTGCCTCCCGATTTTCAGCGCCATGATCGATCGTCCCTAACTCCAAGTTCACT
TATCGTCGATGCCACAAAGTACAAACAAGAGCTAGTCGAAGAGTACAACAATTGAATCTG
ACAACAAATACCTCAATCGTTTAAATAAAGCAAGCAATTGCATCTGAAGAATAATGAATA
TTTTTTATTGTATTTGAGGGGGGGGGGGGGGCTTTTATTTCTCATCGCAAATAGAGAAAA
ATGCATTGATTTATTTATTTAAATAATAACGAACGAAGTTGGAACAAGTGTTTTTTTATA
ATTTCTGTTTAAAGTTATGGGATATATTATTTCCTTCGTAAAATCTGTATAAAAACAAAT
TAAAAAATGTACTAGAAAATAAACTAAGATCGTAAAATACATATATGGATTTAAATATAA
CTATATTTACATTGGAGTAATTTGCACAAAAAGGTGAAACAGTGTGGGAAAATGGTACTC
TGTGTGTCCTAGCTTAAATATTTAGTAAAGTGAAGTGGATGCACCCACTGATCTCTATTT
GTCCAGCACAAACGGTGGATCGACGAAGTCGTGAAGGTGCCTTCTTTGTGTTTTGTCCTC
ATCGCGATCCCTAGGATCCTCGTACCGGATCCCATCGGCCGAGATAATGGCGCTCTTCAT
AAGATATTTGCCAAAGCGCTGAATTTGCATATTCGTGATGCTGTCCAGCACCCAGTAAGG
ATCGAGATAGACGCGATCGTCCTCGGCGCGCCGCTTGTCCCCGATGATGTACTTGGCCTT
GAAGCGGTTCTCGGTCAGGGTGGCACCGCCCAGCAGGAGCAGCTCCTTCATATTGTTGAA
CTGCACCGGTCGGCAGAGGGAGGACACATAGAAGGGCTCCATAAAGCGAAACAACTCACA
CTGGTAGTGGACGCCAAAGGCCTGCCTTTCTGTACGACAAATCTGAAGGATTAGAAACGG
AAATGAGTTAGTAAGTAGCTACTGGTGAGAAAGCATAGAGCTTACCTCGATTGCACGCGA
A
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1093, 2464..4520
2484..3872
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved