Drosophila_melanogaster Locus tou
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster tou
Drosophila_melanogaster
tou
2R
snoRNA:Psi28S-1180, snoRNA:Psi28S-1936
25347..25491, 28501..28649
38950
AAGGTAAAACACATTTGTGGATTATTTTCCGGGACACAATTTGACAACTAGTTTTTATA
TTTTATATTTCTAATAATTCACGCAAATATTAGCCAAAAAAAAAACTAAATAGACTGATT
GACGCAATTGTTCAACATATTTTTAAGTAGAACAATTTTCTTAAAATCCCCCTAAGCCAT
CACAAATAATCCAGCATTCTGGGAAATCAGCGTGAAATGTCTTAATCCGTTGAGTTTACC
ACCTGTCCGCCTTTTCCGCTGCACTGGGAATTGGATTTGCATTTCGTTTAAGTGGTTGAA
CTGGGCGAATTGATAAAGAATTGACAATTTGCTAAGCGGCGCAGGAAGACGGCCAAAAGC
GGTGTGAGTGTGTGAGTATGCGGTCTCTTCGTTCATGAACGTGTGTTAGCGTGTGTGTGT
GTGGACAGGTGGTAAAATAGCCTGTACTGTACTTTCAACGTAAAGCAGCTAGCTTACTTA
GAGTACTCAGTCAATATCGGGTCAATCAAAATGTGGTTAAAGGTTTTGTCTAAACAAGCG
CAGAATTCCTAATAATTTGGATGACTATTAAATGATTAATAGATAGAACCGTGTGCAAGT
GTGCGTGTTTGTTTGTTTGTGCCCACAACTACACAGCAAGATTTGGTTTCATGTCCACTT
GTTTCGCCGCCACGCTCTCGCCACTGTTAGTTAACATAGCTCTGCCAGCGACTAACATGC
ACTCACACTCGTGCAGCGGCAGCACTGCAGGCAGCGAAAATCGAAGAGAGTAGATTCATA
AAAGAGTATCGGTTTCTCTATCGAAGCGTTCGGACGTCGAAAAGATAAACCCCAATTTAA
ATCTAATCCATCTGCGAGCAAATTAAACAACAATAATGATAGATTCTTAAGCGGCGCGCA
CATACGTGTCTTATTAATCGATTTTGATGTTTAAAAAATAATATAGAAAGTTGAAGTGAA
CTTGCAAACCTCGCGAATAGCTGGAAATTTGCGCGTGTGCGGGTGGAACAGTGACACTCG
TGTGAAAATCATCGCTAAGGAAAAGGCGGATAATATAAAGGAAAAACGCCCGCGGCGAAA
ATTATTCCATTGGTGTGAGTGTGCAAAAAAAAGGAAGAAATATCAAGAGCAAAGAAGTTC
GAGAAATTGCTAAAAATTAAGTGTGTTTGTGCTTGTGTGAGTGGGTGACAAATGAATGGG
CAGCAAAAAGACGAGAAGTCAATCAGCGATAAGCAGTTTAAACAAACAAAAAAGGTGAGC
TAAAATTTAAAGCTAAATCAAACTCATTTATATGTAATACAAAGTGTATAAATATAAAGT
TCACTGATGAAAAATTAAATGATTTCACCCTTAAAATATTCCCGTTGAGTTCAATACAAC
ACCCCCGCCCCCTTTTATCAGCCCTCCCCACTCCCCTTCCCAATTTCAACCGCAAACAAA
TAAAATAGGCAGAAAACCGAAGCGGATAAAAAAGAGGAAGAAGCGAAAGAAGTAGCGTCG
CCGATTTCAGTCCTTCATTCCATTTCATTTCGTTCCACATGCTTTTGCTGCCCCTGTGAT
GTTGTAGTTGTTGTTGGTGGTGCCTTTGTTGTTCTTGCTCTTGTTCTTGTTCTTGCTGTA
TTTCGGCGGTGACAGTGAGCGTGAGCAATGAAGGCGGCGAACGGCGAACTCTGGAAATTG
CCACAAGCAGTGGCACACGACGCGGCCAACAAACACACACACACGCATGCGAGCATACTC
TGCTGGCCAGAGCAAATACAACATACAGTGGGACTTTGTTTGGGCGGACAGCATGGATAG
TTGAAATTAATATATTCCTTTTCAGTGACAACTTAAACAAGAATCTACGTAAAATACTTA
CTTTTTGCACCAAATAATTACCATTTTTAGCAGTTTGTAAGAAAATGAAATGTTTATAAT
TCCACTAATCTTTTGAGTTTGCAGTGATAACCGTGTAAATTGAACTATTACAATCTTTTT
TTTATTTATTAAAACTATTTTTTTATTTATTAAAAAAAACACAATTTCTATTGATTCGAT
TACTGATAAGTACTCTATAGCGATTTATGTATATTTAAGCAATTAGTGCTAGAGATCAAG
ATGAATACATTTATTTTAAATGAAAGATTCAGGTTAAAGAACTCTTGATGACAAAAAAAA
ATAAATATTTTAATTTACGAGCTTTTAAATTTCACATACTAATCATATAGCCATAAACTA
AAACCGGGGAATTTTGAGTAGCCAATCTTTACTGTACTCGCACGAATACAGTGACAAATG
CAGGGGGCAGCGAAACACGACAGCGACGGCGGCAGAGGCAAAGACACCTCGAGGAGTCAA
CTCACCTCTCGAAACCGATTCCTCTGCTTCAATTTTTTCTTTTATTTTCCTTTTTGCGCT
CATATTGTAGTTTAATTTTTATTTTATTTTTTTTTAGCCCGCCCTGTCCGCATGTGTTAT
GCGTGTGTGTGTGTGTTGGGTTCACACAAATACAATTCATCAGCGGCAGAGAAGTCGGCG
TCGCTTGTTGTTTTTGTTGCTGGTGCTGCTATTATTTGTTGTTGCTGGTTCTGCGCGCTT
TTATTTGAGATTTGCGCACGAATGGCTTTTGCTTTTGCTCTTGGAGTTGTATATAAATTG
TAAAGCGTGTGGGGAAGGGGCAGCTGCAGAAGGTGGAGGATGAGGGGCTTTCAGGCTAGT
TTCGTTCTAGAGTTCGCGAGCACACAAACACGCACACACAGTCACGTACATACGCTCGAC
AGAAATACGGGTACACAACATAGAGAAAAAATAAGGAGAAAAAAACAAGACTGCAAGTGG
ATTGGGCTTTGAATTTTGTTTTGTACACTTTTCCCTCGGCCCTGCTCCTTCGTCCTTCCT
TCTTTTGAGTGAATTTTTCACCTCCTTCCCTACCCAAATACTGCTATTCCTTAGCTTTCT
TGGCATATTTCGCAATTTCCCCTTCGCATGTTAATTGCCGGCGTTGAACTTTTAGTTGTT
AATCAATTTGGTTTGGCTGCTATTTTGCCTCTTTTCACTTCTTTGCGTTGTTTGTTTTAC
AAACACACATGCCGCTGGTTTTTTGTCTTTTGTTTCAAATATAGCATTTGATTCGGGAAA
AACTACAATTATTTCTATAATGACAAGCTTAGGATTTTAAGAAATACAGTTCACTTACTA
AATTGGAAATACATATATGCCGGTTTAACTCAAAATAAATGCAACTTATCGCGAGCATAG
TTTATATAAAATATATTAGTAATTAAGAGAACATACATACATACATGTACATATATGTAA
GAACTGTTTAAAGTTTATGTTAGATTGATCTATTTATGCTAAAAGATTATTAATAGCCAA
AGTTAACATTAAAGTCATGAATGCAATTGTTTTGTTTGCTTGCAAATCAATTAACTTAGC
TAATCAAAACATTAACTGCGTCTATTCAGGACTTCTTCATTTGTTTGATTGCAATTTCCT
CTTTGCATTTCCGATTCCCTTTTTGGCCAAAAAATTAAAAGAGGTGCCAGCCGCCAGATG
TCGCCACTGTTGGCTGATTCCGGCTGCTGCTGCCGCTGCTTCTTCTACTTCGCTCTGCTT
TTACTCTGCCCGCAAATCGATTTCGATTTGGTTCCGTCTCTTTCGCACACACCCTCGACT
TCTGGCTGTGTGTGTGTGTGAGCAATAAGCTTAACATAAATCATTATAACGGCACATACA
GGAGGGACCTTACATGTCACCCCAACCCCCAGTCCCCCCTTGCGCCCACAACCGCCCATT
TTTCTGTATGTCTGTGTTTGTATATTTGTTCGTTTCGGCTGTCATTTCATATGGAATTCT
ATATGGGAACGCACAAAATCGATTTCTAATCGTGTAAATAAATGGCGACAAATGCTGCGA
CCTCTCACACTCGTCAACATGCTCGAGCTCTGCCTTCTCTCCTTTCGCATAGCAACGAAA
AGCAGGAAAGAGGGAGGAGAGGCAGAAGGTTTGCATGGGCAATTGTTTCAAAACTAAAAG
TTGCACACTGAGAAAAATGCTAACTACGTAACTGCGTTTAGTTATCGTGGCCAAATGGGA
AATAAACAGTGAAGACTTTCAATCACAGAAATTTAAGTACAATAAATATGTGAATACCAT
TTATTATAACTAGAAGAAAGAAAGTATGTAATTATAATATAATTTATAAACAACATTGGT
AGATGTTTTTTTCCTGTGCAGTCAACAGATTTCTGGTTGCACCTTGAGTTTTTTCGATGG
CAAGGAAATGGGGAATGTGAGGCTGGCCAAAATCAAACAGGATTCGAACCTAAAAGGTGA
GAAGTGTTAAGGAGGCGAAGAAAGGCGAGAAGAAGGCCTAAAGGAGGAGCAAACAGTAGC
CACAGTCACTCTGCTTAAATGCCAGAGATAAACGAAAGGACTTCGGAAGGAGGACTTCCT
GAAATTCGGATTCCAAAAGCACACAAAAACCTACATAGCAAACAGTAGTTGCTCCCAAAA
AATCAGCAACATGGGCTTAGGCAACTCAAATATTTTAGATGGGTTATATGCACATAGGCG
CATATATATTTTTTGAAAGCGCAGAAACGTGAATACTCTTTCGCAAAAAATAAGAAAAGT
TATGTTGAATACATAAGTTATATTTTGACATTCTTTTAATGAACTAAACCCAAAAAAAAA
GAATGGAAAATAAAAAAGTATTTTTATAAGCTGGAATTAATACGTTTGAGACCATAGTGA
TAATACCCAGCGAATGCAAAGCAATAGAACGCAAATATCTGAAAAGGGCTTTACATTTTG
TCAGTTGATTTTCGGGTAGTTTAGTAAGGAGGGGGTGGGGGGTTTGGGCTGATGAACAAT
TGCATTTTGAAATGCGCACACATTTTATTTGTTTTGCTGCTGGAATTTTGGGGTCTCCCC
CCTTTCCCCCCATTGCAAACACAATTCAAAGTGGCAGCTAAAAGTGGGTAAAGTAAAAAA
TCGCACGCCAGAAGTTCGTTGGTTGCATGTGATTCTGGTGGAGGGGTGGAGGGGGGGAAT
TATCTCTATACCTCTGTCTCTTTCCGATTCTCTGGGGAATCATCGATGGATAACACAAAA
TTGAATTTACTACTGTGTGCGCTGGCTTCGTTTGTGTTTTTATTGCAATTGCTTCGCACG
TTTGCAAAATATTGGCAGTAATTGAATTTATAGGGGGAGGGGGAAGGGGGTGGAATAGCA
GGGGGAATCGGGCGGGTCAACACTATCCAAAATTGAAATGCTAAAGATGAGTGAGTTAAC
CTACCTATATATACTTGCAGGCCCGCTTTTCCAGCCATTCGTGCTGCTCTGCCATTGTCC
ACTCATTTGCCGCTGCGATCGCCATCTCGCTCGCACACAATGTTCGCCAATTTTCATTGC
GATTTTCCTTGTGGTCGGAAATTCTCTTATTTCTGCTTGATTCCGTTTATTTGTGGAGCT
TATATCGAATTACGAAATATATGTATGAGCATACATACATACATATATATTTCATCAGTT
TGGTTCGGTTTTTAATTGAATCGCTTATCGGCGGTTTGGGCATACATTTTGTGGACTGAA
ATGGTGGGACACAATGTTGTTGCTTGTGTAGATGAATGCAATGCTCTGCATAAAAATGCA
ATTGCAAGGCTGTATTCCAAACTAACCACTACTAACTAAACAAAAGCTGTATAGGTTACC
TGATATGAACGAATTTTATCTGCAAAATGTTACAAACAAAGCAAAAATATCCTTACACAT
TCGTTTTTTAGCTAGTTTGTAAATCATTTGATGTGACAAGCAAGAAGCTTCCTCCATTTG
AAGTGGATTAACTGTTAGACAAATAAGATTTTAACATTCATTTATTTTTTAGTTGCCATC
GTTTTGATGATGACTAAAAGGTGTTGGCTTTATAATTGGACAAGTAATGGTTATAATTCT
TCCAGATATCCGAGCTGCTGCTTCTGGATAATCCTGTTATTTTCCAGCTTTCGGTTTCGC
GTATGCTTCACCGCCATCTCTCTATCTCTACTTATTCCTTTTGTCGGTTAGCTTTTGGTT
CGGTAGTTCCATGTGAACTTTAGCCCCGTGCTGTAACCGTTGTTGTTGTTGTTGTTGCAT
GTTGGGCAAAGGAGATCCTGGATAAAGAGCATATAAAAGGAGGGGAGGTAGGGCAGGTTG
CGCAGGGGGTGGGTGGGTACGCAGGGACGATGGTCGGGGTCTCGAGTGGGCAACTGTTTG
GCTTTGGTTTTGGCCCATCATCCAGTCACCCCAAAGGCATTTGTGCTCTACTTCATTATG
TGGATATATATTTGTACGTACGTATGTTGCACTAGTACACATGTGTATAGCTGTATAGCT
GTATAGCTGTGTGTGCACGGCAGGCGACTCTGTGTGTGCGTGTGTATCTATGGGTGGGCA
AAAGGTATGGCCAAAGCTGAAGCTTCGCCTCGCTCATGTCCTCGGTTTCGTCGTCTATTG
AATCCTGCTTATTTCTGGAAGGGAGCGCAAGTGGCGGCATTTTCGTGGCCCTCGAAAGGA
GATTGGTAAAGCGACAAGGACGCGGAAGAGAAAAGGGGTGGGAAAATGAGGACGAGCGGG
GAAGCAGTGGGAGCGGGAAAGTCAGGATATCCTCGCCGGGCGGCGGCCTTTAACCAATGT
TGTAATTATATGCTCACTAGTTGGCATATGTGTCCATGTTTCTGGCTATTTTCTCTATAC
AAAAACACTAGGCAACAAGGTTATTCCAAGCTTAAACATTATCTAATTTAGCCCTGGGAA
TGAAAATGTATTTATATTTGTGGCAGGTAATCAAGGTGTTTAAGGATAACTTGTGATCAT
AAGCATATGCAATAGTTTAGTTTTGTTCACTCACAGAAACATAAATTCAAAGGGTTCTCT
ATAATTAATGTAAAGAAATAAAGTTTATATTTATTACTATTAAAAGTACCATTTTATTTA
ATGTGAAGTACCAATATTTTGTTCGGTGCATCGCTGTATTGATTAAGATATTTAATAGGA
AAGCAGGGCCATGTTGACCAATGTAATGCGAGGCATCTCTGTTTGCATGCAACGCGAGCT
CAGAGTGGGCTCTCGTTCTGCTTCTTCCTGCTAAGAGCCACCTCCCACGCCCTTGCCCCG
CCGAAACGCCCTTGCCCCGCCGAAACGCCCTTGCCCCGCGCCACTCCATCGAAATTTCTG
CAGCGAAAACTTTGCAATTTCGCTTTTGTGCTCCGAAACTCATGTGCTGCTCTGGTCCGT
GTGTGAGTGTTGCAAGTATCTGCAACTGTTGTATCTGTATCTGCGCAGCGAGCAGTTTCC
TTGTGCCATTGTGCAAATTATACAAATGCTGAGGAGGATGCCGAGATGCTGAGAAGACGC
TGGCGACGGTGGCGAGGCTGTCACCATCGCCAGCTCGCCGTCCATGCATCTGCGAGATAC
ATTAGACAGTTTGCTGCGTGCCAAGCGGCCACATTTACAAATACAGATACAGATACATTT
GCAGATGCAGATACATTTTGCTGGTACAGCTGCAGATGCGGATACACATTCTGTATCTAT
TTCTGTGCGGCGTATGGGAAATTGTTGTAATTTGCATGGCTCAACTTTGGATGAGCTGTC
GCCGACGCTGCTCTTGCATCCGCAAAATGTACAAGTATCTGCGAGTGTATCTATGTATCT
ATGCTAGGTGCGTGGGCGTGGCACTCCGCCGCTGCTCATTAGATTTACTTGAGATACTTT
CCACCACTCATAAAGATAACTCATCGATAAAATGTGCAGTCACATCCGATTTGTTCGCTC
TGCTAATTAGAAAATAAGATTAGACGTCGTTCGGCATTCTATTTGCCTAGAAATTTCATA
GCACAAAAAGCATGTCATTGTATTGAATACACAACTTGAGTCACTGGAAAGCACATGTCT
TTTGCTTCATTTGATTGGGAATGGCTGAATCATTTATTGTGCGATTTAGGCATCTTGAAA
ATCAAATACCACACTTTCAAACTAAGCAAACTAAGCCCATTGAATTTAGTTTAAATTGTT
ACGCTGTAAAGCTTTGTCTAAAATTGTTCGGCTACTGAATTCAATTTGTAATGAAAATAT
AGGCTTAAATCGATGTGGAAAGTGATGTAATCCAAATGACACCTTATGTTTACGGAATGA
ATATCCTTTCAGGCATTTAAGTGCGCATACAAATACTGCCAAAGATGTTTATTTATTGCT
GTGAAGGAAGTCGGCTGTCAAAAGGCTTCTGACTCAAAGATTGACTTATGCCCAAAATGA
AAGTAAGCTTTTAAAGATTCTGCTGACCAGCTTGTAGTTCCCTTGCCAACCCGACAATGG
AGCCCGACTAATCACAGTGAAACGTGCCTTGCTCCTACTTCTGAATGTCCTGTCCCCTGT
CCCAAGTCTCGTATAAAAAGTGTGGAGACCGTGGGGACACACAATCACAATCAGCTGCAA
AAAGCTGCGCCGTGCCAATTAAGCTGACTTTGAGGAACTTCGTGGTGTCCTTTTTTGTGA
CTTTTCTGCCTATCTCTGAAGCTCTCCCTTTTGGACCCACTCATTTTGTGGTTCTACTGA
TGAAAATTAACAAAAAGCTGAAACGTTGTGGGCTTTGCTTTTGGGCCCCTTGGCGCTCAT
TTTGTGTACAGGGCGCATTCGTTCTGGTAAACACAACCATTTGGTGCTTGCTTTATTTAT
TTATAATTTCTGTGTATATAAATATGGATCAGGAACCTGTTTAAAATAAAGTTCTGTTTT
GTACCCATATCTTGTTTCAACTTACTTGTATTTCAGTTTAAGAACCAGTGTTATTTATTG
AGAATCTACTGTGCTTTCCGCTGGCCGCAGTTCCTTTTCCTCCTGCTTCCTCTTCTTAAA
AATGCTCTACTTCTTGCTCTTTCTGGCCGCGTTGTTACCCTCTCTTTTGCGCACACACAT
ACGCGTGTGCTTAAACATTTTTTCTTCCGCACATTTTTTATGCACGTGTGTGTGTATTCT
TTTGCAAACTGCAGCTTCGCTGTTGGACAGGGATGTGGCCAAAGTGGAGGGATGGGGCGT
TTTGGTTAAGGGGGTTAGCGAAGTGTGCGTTGGGATGGAGATAAAGAGTCGTAAGCGGGG
GGGATTTCAAAAACTTGGCCTGTGTGCTGTTGCCTCTGACTCTGGCGTTTTTCTCTGCAC
GACATCCCTGCTTGCGCCTCGCTTCTCGATCCCGCTCCCTTCCCTGCATCGTCCCGTCCT
GCTCCCTCTGTCATTTCCTTTATTCCGCTGTCGCCCCTGCCATCAGCACCCCCTCCTCCC
CCCTGTGGCACCCTCTCCTGGCCCACGGCTATGGCAGCCAGCCAGGCTGACGAGCAAGTT
TGAATTGTAATCCTGGTTGTTGTAGTTGGCACACGCTCTTCGCCGCCTCTTGTCTCTCTT
TCCTCCTTGTTGCTGCTGCTGCTGCAGCAAGTTTCTGCCTCCGCTGCGCTTCGTCCCCCA
ACCCGCTCCTTGACCCCGCTCTCCCCTTTTATCAAGCTGCGTTCGACAGCATCAGCCTCT
GCTTTTGTCTGCTGCCGCCACGTCGCCGCTTCATGCACCTACTCCAGCTCCTCTTCACCC
GCCTGTTGCCCCTCCTGCTCCACAAGCTCCTCTTTCTGGTTGTCCTCCTACCCCTGCCAC
CCCCCTCCACCTCCTTCTTAGCCTCTCCACCTTTGGCTATGTGCACGTCCTTCTTGTCGT
TGCCCTTTTGCATTTCACTTCGGCTCGCAGGTCCCACAGCTTTAGCTTGAAAACATTGCG
AAAAATGTGCAATATTATTGATGACGCTTGGTAAATCGATTATGTCCGAGGGGAGGGGGA
AGTAGACCACTCTACGGCATATATTACATTAGTTAAATAATTATGGTTTCGTAATGCGTT
TACTTGAGCAAGTGGGCATTTCCATGGAAACTTGGTTTATTCTAAGAACTTATAATTTTG
CTCAAATTATTTATAGTATTGTAAATAGCTTATCAAAAAATGCGTAAATATTTATTGCAA
ATCAATTTCAATCTGTAAGAATAGAAAACCTTTTTATACGGAAAATCTGTGAATAAATAA
ATAAAGCTGTAGACCAGAAATTACGTTTTAATATTGATCCTATTATCTGGATAACTGTAC
AATTCGGATTTGATAGGTTCTATGATCTGATGATCTAAACGTACGCCAGAAAAAATACAG
TGGTTTTCTCGAATCAAATGCCAGGTATTTAGATGTCGACTACACTAGCTTTTGCTTTTT
TAATCACGCTCTAATAGCAGTTTTAGCACCTACGCCTGTTTCTGAATGAACGCGAAAGAG
AGTGGGCGGGGTGAGAGCGAGAGAGATGAAACGATGGCATGGAGAATACATGCGTGTGTC
TGCAATTTTCCGACTTGGCCCCCCAAACGCCTCTACCCAGCAAACACACTTTCCGCTTAC
AAAAACGCAATTTCACTTGACATTATTTAACAATTTGCATTGCTGCTTCCGCAACAGCTA
TATAAACAACAAGTACAACAACAACAGAAACAACCGCCGCAAAGTTTAGGCTGCAACAAC
ATAGTCAACATTAACAGGACAACAAGAAGAAGACACCTTTTCATTGAGTTCACACACATA
CACACGTACAACTCCAGACTCATTCACCCACACAAGCAGGCATGGCGAAATTCGCTTGCT
CACTTCCATTTTGCCGTTTCCTGTTACCCCTTTCCATCTTACGCCCCTCACGCCTTCTTT
TGGCATCATGCATTGCTTAATTTCTCACTTGTTTCCTTTACATTAGGGTGACCCTGTTTC
CGACTGGAGTTGTTTCATTCTCAGGAGTAAGCAAAGATAAGGAATTACAATGAATCAATC
CTTTAATCCGTAATAGTTCGATAATCTTCTTCTTCTTTTGCTAGTTATAAGACTTTAATC
TCCTAAATATACGAAACGACGGTTTAACAGTTTGAAAACCAAATCGATATGAAACGTTAT
TTAAAAAAGTGCGTGAAATTACCTTTTCAAAGCATTTAAAATATGATTAATTTAAAGTGC
ACAATGTGTTATGATTTCCAAAGCTTTAAAGCATTACAAATTATGAAATCTTAACTTTAT
TTCGTATGATTACATAGGATAAGGATTTACATATGTATGTATATCGCTTTACTTTAATAT
AGAATACACCATCTAAAACGATATGACATGTTTAATAACCGACATTGGATTGCAATCGAT
TTTTTTCTTCATTTTGCTAGTTTTGCTTAATATTCCAACGCCTAGAGTGGTCCTTTCACA
ATTTTAATTGACCCACCCTAACGTCAAGGAAGCAGTGTCATCTGATTTAGTTGTTAAAGC
AATTTTAATTGCCATCACTTGAATGGACGAAGCCGGCCTGCAAGAGCAGCACAGGTTTCA
GCAGTGGAAATTAAAGGCGAAGGAAAATGAAATAAAGAAATTTAAATCATACAAATGCTT
TCCGTCTTTCTCTAATTTCTGTTGTTGCCCTCTCCTTTCCACTTTGGCCCCTAACAACGA
CACCTTCACCTGACTAACACCCGCTCCTTCACCGCTCTCTCCGCGCTCCCGTTCCCGCTC
TCCCACTCACTCACTCACTCAGCCCCCGTCCATTATCCTACCCTTCCCCCTTTGCCCATG
CCCTGTGGGCACGTTCGTTAAATGTTGAATAAATTTTCTCATATAATCGCAGTCGTCGCC
CGTTGCTCTCTGCGGCGGCTCTCTTCCCCCGCAACCCGCACCCGCAGCACACTCAACCAC
ACATTTTCTCCCTCTCCCAATCAGCAAACAACAACAGCAACAACGCGGTTGTCTCCGCAG
CGTCGTCGGCGTCGCAGCTGGCGTCACAGTCGCTGCCGCCGATGTTGAATGTTTGATGTT
GAATGTTGATGGTGTTAGTTTGGTTCGGAAACTCGTCGGTCGCGCAAGTGGAATCCCAAG
CGAAAGATAATAAATCTAAAACAAATGCTTAGAAAAGTATGAAAGATATGAAAATATGAA
TGCGATTTCGTTGCGAAATAATTAGAAAAGTGAATGTGTGTCCAAGATTTGTGATTGTGC
CAAAGTAAGATAGCAAATGCATAAAAGTAACCAATAACAAAATAAAATGTTTTAAAAAAG
CCACCAAAACAGCAAAGGAAGTGCGACAGATACAGATAGAGATACACAAAGCTAAAACGG
AATCCGTTTGGGCCAAGTTCTGCTGCTTCTTCTTCTTCCTCCTCCGCTGCTTCTTCTTCC
ATAAACGCAGCCAAGCGTGGCAGTATATATATGTGTGTGTGTGCTGTGTGTGTGTGTGTG
AGCGCGCATTTTCTTTTGTCCATTCCGCCACCTTATTCTTCATGCTCTTCTTTCCGTACA
GCCGCCAAAGGAGACGGCGAAAAAAAGGATTAAGAAAAAGTCAGCTTGTTGGATTATATT
TATTTCGCTCCCAAAATTGATCAAAAAGGTGCCGTATTGTGATTGAAACTGATAGCTAAG
GTAAAGATGCAATCGTAAGATAAAGATACTTTGAAAACTGAGATGTTCTTAAGGCAGTTG
TAGAGAAAAGCCGGTTATTTAATGGAAACGACAGTTTCTTAGTTATAAGTACAATAAGAT
CTGAATATAAACAAACATGCTGTTTACAACAACGCCTACTACAAAAAACAAATTTTTGGT
AAATATAACCGAAGTGGATTCTCCAGTTAGATGGTCAAACCACATCAAATGCACATTTTA
CTGATTGATTGCATCGCGGGTGTAAATATGCTGTTAGGGATTGACTTAAAATTAAAGATT
AGGAAACTTTATCCAATCAAATTGGCGAAAAGTGAAATGAAGTGAAGTAACCAGTTGTTT
GGGCAGAGATTCTTATAAATACATAGGTAAAATTCAACAGGAAAGTGACCAATTGGTTGG
TAAATCATATGCGTTTTGGGTTTTAGCGAATATTGACCCTACGACTACTGGACGCACTTG
ATTAATAACCATCTTATAATTAAAACTAGAAAATGTGCAATTTGCAGTGTCGTTCAAAGA
TTTCTCACGATATTTGTAATTTTCAATGCAATCGTTTTTGAGCAGCGTGCAATAAGATTT
ATTATGACCACAATTACAGTCCGGCATTTCAACTTGCTTTTGTTGTATTTTTATGTATCA
ATAATTACAAAGAGCGAACGAGAGAGGGTGCGAGGAAGAGGCAGAGGCAGCAGGCAGCAG
GCAGAGCAAGAGGCAACAACAACGACGACGACGCTTGGGAAACGAAATTGAAGCACACGG
ATGGAAATGGAATGAGAGGGAGTGCGAGTGCGAGAGCGAGTGAGAGGGGGTGATGGAGTG
GGCCAGTGCGAGCGAAAGGGAGAGGGAGACGAGGGATACGTAACGGCCAGTCACAGCAGA
AAGCAACAACAATAACAATTGCAACAACAGCAACGGGTGAACATTGGAGACATGTTTGTG
CGGCGGCGCTCATTTATTTTATGTCTCGGCTCGGTTTTGTTGTTGTTGCTGCTGCTTTTG
CGCTACTTTGGAGCTGCCTATCCTGCTCCCCCCTCCCCATCTTCCCCCAATACATAAATG
CATGTGTGTGTGTGTGCATGACTCGCTTGTTACTTTGTTCTTGTTTTCTGGTTCTGTTTC
ATATTCTGCCGACTCAACTTGACAAACGAAACGAACTGAACTCAAACTGAAAAATGCCGC
AAAATCGAGACCTTAACGGATAAAAACTGAAATACAGAGCAACTTGGCTAAGCTCGATAT
AAACATAATATTTAAAGTGGAACAAAACGCAAATAATGGCGGCTTAAGCGTGTCTAAGCC
ATAAAGTGCTAGTGGTCCACAGTTTAATGTTCTTGGATTTGTCTCGATCGTTTGTAATGT
TTCATTGCTTAACGATAAAGCCGCAATCTGAATTCATGAAAAGAACTCAAACACATGTTT
TGATATTGAAATTCTGCTAAAAAATGTATTTGCTAGGAATTTTAATTTGACACGCGCCTT
GTTTATCTAAAAAAAAAAGCTTTAAATATAAAGCATTAGGCTTGAACACAAATTTATTGG
TGTTCATGACTTTGATAAGAGGGTAACAATCGAATGTTGTGTTTTAGAGAAGTTTCACTG
TGAAATCATTGAGGAATTGACAATTGACAAACATGTATTGCGTGGGCTCAATGAGCGAAT
GAGTGAGCTGCAGATACGACTGTGAAGTCATCTGTTCGTTATGGAAGTGGAAGCATCATT
CCGGATCATCTCGACATATTAATGCTTTAACCCTTTGGTGGCGAAAACCAATTAAGGCGA
GTTTTTAAAGCCTAACCACGCGCAGTGGAGCCGATGTCGGCTGAAATTCCTGTGTATTTC
CCCCGTTGTGAATTGTTTCTGCGTTTTGGCCAACTTACCGGCGTCGCTGCCTCTGCTTCT
GCCTCTGCCGGCGTCGCAGTTCGGTCAGGCCTCCGTTCATTGTTGTTGTTATTATTATTT
TTGTTGTTTTAGCTCTCGGCCATTCCTCTCCACTGTCCACTGTCTGAATCCCATTCGTTT
CTAAAATAAAATCTTTCGCTGTGTTTGGACGCGTTTTTTTTCGCATACCCTATTATCATC
AGAAGTGCCATAATTTCAGTATTAAGTCATTAACGAATTATTATTAACTGCTTAATAGAT
TATTTTTAAACGAAGTTCAAAGAATTAAAATTTTTGAGAACTTCTTGAAAGCAAATACTT
TTTAAACTAAAATCCCAAAATGGGAAATATGTTGATAAAAAAATTTTTTCTCTTGGGTAC
ATGTTGCATTCTTTTTAGAATCCATCAGTTTTACATATATAAATTATTTTAAATATGAAA
TTCATCATACTGTACTTGAAAAGTAAATATAAACTGGCTGCGTAGTCTTTTAAGCATTAA
AGTGTATAACATTTTCGGCTTAACGCAGTTTGACCATCTTTATGGTATTTTTTTTTCGTG
CTGTTGCGGATTTGTGATTTCGATATTTAGTTGGATTTCTGTCTGTCCCCCTCCCATTCG
GTCCCCTTTGCACCCGTTCCGCCCGCGCCCGCTTGTCCATCTGTCAAGTTTTGTTTCGTC
TGTTGTTTTGCCGTCGGTTTCGCTTCGCTCCTCGCTGATTGCTCTGTGCCCCGTCCAGCT
TCTCCGCCCCTCTTTGCTGGCCTCTTTTTCCGTCCCCCGCACCATCACTCTTTAACGCTA
CCCCCTCTTTCGTTTGTTTTTGGGTGTACGCCATCGTCTCTGCAGCGTGTTTCTTTTCAT
ATTATTTAATTTATTTCGTTGGTTTTCATTGTGGCCATGCTCGTTGTTGCCCCTGCCGCT
GCCCCCTCCCCAACCTCATCCGCATCGTACTTCGCCTGACCCTCCTCCCGTTCATCGCCC
TCTCCCTCTTACACGGCTCTTCCTCGTTCTGGGTTCATCTGTATCTACAATTCGTCATGT
CGTTTGTACCTTTTTCTCCGCTGTTCAGCTTCATCATCATCCCTTCAACGGATTTTTGAG
GCATTTCAGTGATGAATTTGTTTTCTTGTTTAATTTTAGTCATTTGCCCAGCACCCTAGC
ACCACCACAAATGTAATTCTAAACACACACACACGCACACCACACAAATGCACCCGAATA
AATGCCCTTTGAGAAATGCATCTGCTCTTTGATCGCATTGGATTTACAGTTTTTATTTTT
CCACTGTCAACGAGAGGCACTGAGAAAAATGATAGGCACGGAATGCTAGCCAACTAAAAC
AAAAAAGGTTTAAACCAGAATAAAAGCGATGAAATAACATAGTAAACAATCAACTGTGTA
CCAAAAAATTACACTTTATGCAAACTTAGCCTAACTGAATAGGCTTCGTATTTCTCACCG
TATAAAGTGGTCAGTTAAAAAGCCATGGCATTTAATCACTTGGCTAAAATCGAGGGTGTG
TGTGTGTGTACTCTATAGAGCAATTAATGGATTTTGCAAAACAGATTTCCAGTTTGCCGT
GCGCACGATAAACAACTAAAGGTTTGTTTAGTTAACGGTAGAGCTCTGATATCATTGGGG
CACTCGAAACGCATTAGAAGCAAACGCTAAAGTTCCAGGCAATCGGTTAATTAAATTACA
AATGTTTTTACATTTACCAATAGGTGGAAAGCGCAAGCTGAAACCCAAACGATAACACTT
GGCCAAAGAGCGATAATTTACGGTTAGGTTAGGTTCGTTCTGTTGGCTGTTGCTATCTGA
TTGATTGCATTGCCACAGAAATACAGTGGAGCTTCTTACGCTTGGAAACCTTATAAAACA
AGAAAACATCTCAAAAAAGTGGAAAGTAAATGTGATATCGCTTATAGTTTTATAAACGAG
GCGCTTGTTGTCCTAGTACTTATCTTTTATGATAGTTTTAAGCACTTGCTGAGTTTAACT
TCAGCCCTTTTTATCGAGTATTCACTGTGGAAAAGTATACAGACGGCAGTGCACAGTTCT
TTCGATTTAAGGCAAGTTTCGTTTGCTTTTTGTAGCCCGGATTTATTGAAGCGCAGCGCA
CAGACAGGCTATTCGCTTCCCTCTCGCTCGCTCGTAATATAGCCACCTCTTTCTCGACTC
CTCCAACGCACTGTGACTGACTGTCAATTGTTTTCTTGGCCTCTTTGGCCCCTCCGTCTC
TTTTTCGCCCAGTTTTCCGTCTCGTTCTGCCAACTGATTCAATTGAAAAATGTTGACTCT
TTTCTTATTTGGTTCTTCCCATTGCTTTTTCGAATTTCGGATCGGACTCTCCGGCCGTTC
ATTAGCTTTCGTGGTACAGAATATTTAACCCCCTGTCAGCCGCTGGCTCTCTTTAACCCC
CTGACGCCACCACCTTCTTCGGGAAGTGCTAAATGACCGACCGGCAGCTTCGAGAAGTTG
ACCAAAATGCTGCGAACGCCATTGTTTATATAAAGTAGTGACTCACCATCCCTTCATCTC
AAACCCATTTTTTTTTATAGAAAAAAAAAAAAATAAAATAAAACAACAAAAATACAAGAG
AATCCCATAGAAACACATCATTGTTGTTTGCTTGTCTGCTTAATTTCAGCAGAGTGAGGA
AAAATTTTAGGAAAATACCGAAATTATAATTGTGCATCGCATTCTTCGGGATTCTTTAAT
TTTGTTTTCCTATAAAAGCTTTTCTTTTGAACGACGGCATCCCATAAATTTCAATAATCA
TTTCAAATTTATTGTGTGTTTGTGTTAACCAGCCCAAAAAAAGAGCGAAGCGGAAATGTA
TAGAAAAGAAAAAACCAAAGAAATTCGCAGAAATCATTAAGTTATCTATCTAACCCCTGA
AAAGAGAGTGAGAATTAAGTGAAAATTAAATAGATGAATGAAAAAATGAAAGCAAAATTG
AGTGGCGACAAAAGTGAATAGTTGAATAATACATACTAATAAAGGAAAGCAAATCAGCAA
CAAAGCGAAACTGAAAGAACTGAAAGTTTATCTTAAAGTTTTGTATTATTTCGAGAGGTG
AGTTGTTCGCAAAGGGATAAAACTATGCTTAAGCATTTAAAAGCAATCTTGATTAAATGT
TTTTCACGCCGATAAGTTGTACTTCAAAAGAGTAGAAAAAACTGTTATTAATTTATATAC
CTTATAATAATATGTCGCTTGACAGATGTAAAAGTTTTTATTTGGTTAAGAACCATTAGG
TGTTTGGTATTCCCACGAGTGATATAAAATATATGTATAAAATGTATCTGAAAATTGTAC
ATCTCTTAGTGGTACCAAGTATGCACAGTTGCTTTCCTGTTCCTCGTTGCCCATCTCACT
GTATCCTTTTATCTCACCCCCGTTATTTCCAACGCGTTCAGCCTTTTGTTGGGATAATCT
GATTTAAGCATTAATTAAATTGCTGTGCGGACTGACGCATGTGTGTGCGTCTATGTATCT
TTTTATCCGTGTATCTATCGCCGTCACTCTGCGGCCGTGTGTACAAAATAAAACACAGAT
ACAAAAACACATACGACTGTGTGCTGTCCATATTAGATTACGTGCAACAAGCTCTTTAAT
TGTATTTGCCGTCTAATGAAATCACCGCAGCGCAGAGCAACATTTAAAAGCTTTGGCCAA
CAAAAAGCGAATTGCGTACAGTTGTGCAACGGCGACCATTCGATTCGATTCGATTGGTTT
GGATTGGATTGGATCGGATTGTAATCGCAGGCGGTACAGAGGGCCGCAGCAAAAGAATCG
TTCATAAACCGCACATGTAGTTATCGAGATATTTCGGGGAAATGCCTGGCGCCAAGTGTG
GGAAATCAACGGAAACATTTGTGATTCGAAGCGGGGTGGATTTGACCGGTGCTATAGAAA
CGGGGGTTAAAACTAATGATACTTAATTTGACACATTTACATTTTTAAGCAGACATGCAT
TACATATAGATTCTAATAGAATTTAGTTCCTTAGGAATTAACTATAATAGTATACTACTC
CTACTACAGTTGTTCTTGACCAAAAAACACTGATTTTAACAACGTAATCAGAAAAACTAT
TATACCGCAATAATTCCACCAGTGCAACATCGAAAATGTAATTTAAAGACAATTCATGAG
CTATTTTCGGAAACAGAGGTGTCAGAGATTTAAGTTAAGTCCTTGAAGAATCGAACATGT
CCCTGATATCAGATGCTTGTCCAGTGAAGGTAGAACCGAAGGCGTAAAGGGAAGTGAAGA
AGAAAATGAGTAGAAGGAGGAGGAGGAGAAGGAGGGACAGGTAGAAGCAGGTGGCTGGTA
TAAATTGGCAACTGCACATGGTCAACTGCACATGACTGGAAATTGCATCACGTTATCATC
ATTTTGCGAATGCCAAGGAGAAGCACGGGGGAAGAGAAAAGGAGAAGGAGGGATTGCACT
GGCTGCAGCCACTAAATGCGCCCACTCCGCCCACCACAAGGGTGTGCGAGTGAGGGAGAG
AGGGAGATGGAGAGAGACAAAATCTCCCTTACTCTTTCGCTTCCTTTTTGCACTCTTCTT
CGTCTCCTGCTCTCCTTTGCTCCTCCTTGAAATTGCTCTGGCACCTTGTTGTTGTTGTTT
CTTTTGTTGTTGCAAATGGCAAATACGTCAATGTTGTTGCATTCCTTTCGCCCCACGTCC
TTTTACCTCCTTGCAGAGCTCTCATTCGCACAGTCGCGCCCTCTCGCTCTAATTTATGGG
TCGTGCGCGCTCTCTCGTTCCACTTGGAGCTTTTGTCCCTTGTCCAATGTGCCTCCATCT
CTCCCTTTCGCCCGAATCGCCTCTTTTCCACATTCACCTCTGTCCCTTTGCCACCGCATC
CCCGCATCCCACATCCTGTGTCCCGTGCATTCCCCTTACTCCTGCAATCCTGCAGCAGTT
ACAACATCAACCACACCAATATCGCTACATAAATACCAACTACAGTCCAACCTGCCTTAG
TCATAATCAATTATATTTAAGTTATGACACTTGAACTTTTTTTGAACCGCACGTATCGAG
TGTGTATTATTAATATCTTATTATTATCATATTAAGATACAAAGCTCTCTAAAACTAAAT
AAAACAAAAATAAATAATTTAATTTTAGTTCATTTTAGGGAATCTTTACTGTAATAGAAC
TGCCTGCGGTTGTCATTGTTGTTGTTGTTCTAGCCTCGCTGCATAAATTCATTTGTTTGC
TCCCATTGCTGTTTTTGTTGTTCATGTTGTTGTTGCTGCTGCTGCAGTTGTTGTTGTTGC
TAGTTTTGTTTCGCTGCCGCTGTCGCTGCCGGCAGAGCAGCCGACGCCAGCGCTTACTTG
GACTTCATTTGGTTTTGTTGTTCTTGCCATGGTTGTTGTTGTCGTTGTTGTTGCCAGCTC
CGCTGCTTCTCTGCCCTTCTGCTTCGTGTTCCTTTTTCCCTGCATCTCCTTCCCGCTGGC
GTTGCCATTTTCAATTTTAGTTTTGCTGTTCTGCTGATGCCGCTTCTTCGTCCCCTTGCT
CTACCACCCATTCGCAATTCTCGATTCTCATTCGGCTCGTTTTACTGCCACTTCACTCTG
GCTAACCCCTGCCACGCCCCCATTTCTGCACCCACCCAGCCGCACAACTCCCCCTTTTTT
GCACCACCCACACGCCAAAGTTGTGTGTCCTTGCACGCTCGTTTCCTGTTCGTTTTGTTA
GCCTGTTCGTCCTGTGTGCGACAACCCACGATTTCTCCGCCTCTCCTGCTTCTGCCTCAC
CTCCCCGCTCTGCCCATCGTTCGTTACACGCCCCGTTTCGGTTCAGAGTTTACATTTTAT
GTGTGTCCTTTTTTTTTTGCACAGTTTTCTTGCCCAGGCGAGAGACCCAACACCTCCCAA
TTTCCCAACCCTCGCCGACGGTTTTTCTCCCAAAAACTGGTTGGCAATATATCCTTTATG
ATAATGTATTCCAGCCCAGAGAAGTGCAAAACAAGAATAACAGAATCGGCGCAGGATTTT
CGTTTCATTTCCAGTGGGCTTTCTTCTTGTTTCAAATATAATTCTCACCCTTTTGTGCCA
AGGACTTCATCGGAATAATGTTTCCCATAAGTACCAGATGTTTTCCTCCTGTAAATAGTG
ATATTTCATTCAAAGAAATCATTTTATTGTAGGTGTTTCTAAAAATTGCATTATTGCTAT
GCTAGTAGAAAGGACTAATTGACTTTTGGTTAGATAGATAGTAAAATCATTAAAGAGATT
GTATCAGCTTTACAACAATTTCGGGTCTCGGAAACTGTTTCATTACTGATTTTTCGTAAA
CCCAGCTAAGCTCACTTAGTAATTAGTTATATATAGTGGCAAACTGCGTAAATGTATTTG
TTTGATGCTTGATCTTTAAGCTAAAGAGCACAGATTGAAAGTGCATCTAAATATAGTCTT
AAGTACAGATTGTCTTACCTTTTTTCCAAGTACTTTCTCGCCATTTGCAACTTTGAAACT
GTGTAAAGAGCTTTAAAGGTCTTTTTTTCTACACAATTTCACACATTTCGAAGCTGTGAA
AATGTCTGGATTTAATAAATGTGTGGTAGATGGCTTAATTGGAGCAATTGATTAAATTAA
ACGATTATGCATATTTTATATTGCTGTGGGTAGATTTCACAATTTGAAGAGGCGAAAAAT
TTAAAGCATTTATCAGGTAAATTGCTTAAAATACTCGTTAAATGTGTCAGTAGGGATGAT
GGAAATGAAAGCGGAAGGATAACGGAAGGGATTAAAGTGTCCAGTGTGAGTTTCAGGCAA
AATGATGAACACTTTAAATGAAATCCAAGTTTAAAAGGCAATGCCATGTGTTTTTGATTT
ATGAGTAGTAAGTTAGTGTTTGGTCACTATTTTTATTATATTATTTATTATAATCACTTA
AAAAGAGCTCCGTAGAACGCTTAACTTAGGACCCCAAATTGACTAATACAAAATGTGTGA
AAAAAAGAAAGTGGAACTTGTTGCTGCTGAAGCTGTTGCATTTTCTTCTTGCAGCACTCG
ATCGGCAGGCATTGCAGAGGATCGTTGAAAAGGGAGAGGGGTAAAGCAGGCGGGCCAGGG
GAAACGAGACTACAGATCGCGCCAGACGATGACGCAGACGGCAGGCTTGTTGGACGCTGA
AAAAAGGGCAGGGGTATTGCTTTTTGAGTCAATAACCTCGCTCACTCCATAAGAAAAAAA
AAACGAGGAAGAGTCAGAAGCACTCACATTGTCCCCCTCTCTTTTACCCGCTCAATGAAC
ATCTCTTTCGCACACATTCCCACACCGGTGGCCGTCAACGAGAATAGGGGGGAAAAAGAA
GAATCAAAAGTAGAAGAATGCGCAGAAGGCAAGAAGTTAAGTCAGAAAGCCAGAAAAACC
TTTAATCCAGGAAAAAGGCAAGACTATTCAAAAATGCTTCCAATCTTTTGTTTGCGATCA
AGTGCATTACAACAACGGAAAACTCTTTTCCATGGATACAATAATTACTAGATTTCTTAT
CGGAAATCTTCAGTAAAACATCCTGACTCATCTTCGTAATTACGTTTACCTAACAACCTT
TGAAATACATTGACAGTGAAAGATTTATTTATTTGTAATTCTTGCTAAAATATATTTTTT
TAAATATATTTATACTATAAACTGTAGGTAGTAATAAAGCAAAAAAAATAAATTAGCTAT
ATAGAAAATTATAAAAATTTGGGCAGCAAAAGCAACAACCAGATAAAATGCGATTTCGAA
TATATTCGAACTCTTTGAATCTATTTTAGTTGAACAAGAAATTCGGATCCAGTTGTAGTT
CTGTTGTTCGAGCAATTGATTAGCTTTTCGAGCTTATTGACCAAAGAAAACAGCCGTAAA
CTTTTTTAATGGCAAATCAAACGAAACGGCGGCGCTATCTGCATGTGTGTGGGCATAAGA
TATAACACGAAGTCAAGCACACACGCATACACAAGGAAAAGCAACAAAAAAAGGTAGGAA
AAAAACCCAACAAATGAAAAAGAAATATAGGCAACTCATGAGCGATGGACAGCAGACAGT
CGGCCAGCCAATTGAGCTAGAGAGAGAAGATAATCAAGAGCAAACAACAACGGTTATTCC
AGGGGGTGGTGGGTCGTTGGAGGGGCCGGGTGGGATTGGGATGGTGATGGTGTGTAGTGG
AGTGACGCCAGCACAATATGAGAAGAATTTCACATTTGTTCGCTGCTGTCACTCACAAAT
ATTGATGTGAAAAGGCTGTCAGTGTGTGAGGGAGGGTGTGAGAGGCGGCGAGTCGCACAC
AAATACACACAGTGCAAAATGATATAGAAACAACAAGAACAACGCACACACCTTCTCAAT
CGCCGGCGTCGACGTCGGCTGCGCTGCCGCCCCCGCGACGCCGACAGAGGCAACGGCAAA
GGCAGCAAAGTGTGGCGGTGTCAAAGACAAATGCCCGAATCATATTGCTTGCTCCCTCTA
CTTTACCTCCCTTCAACCTTTCACCCTGCCCCCATACCACTTGCGGTGAACCCAAAGGCA
AAAGCCCAAGTTGAAGAAGAAGACAAAAGGCAAAGTTTTACAGTGCTACTTCCGCTTAAA
CATCAAATGCAACTGGGAAAGTGAATAAAAAGGGGATTAAACAATGAAATCAAATGTGCT
AAAATGTGCGGAAGCCTATCTATTCTAAGTACTGATAGTAACCCAATTAAAATGTGCGAA
ATTATATGGACACGTCTTGATTACAGAAAACATATTTTCAAAAAACCCCGTAAAATTCCA
TAATCAGATTCCTTTAAAACGGCTTGCTTTGCTGACTGTCATTAAGCAAGCTTCACTGTA
CCAAGTCGTTCTGTCCGTTTGTTTTATTTCTTGCTTGTTATAAATTGCCAGAGCTCTTTC
GCAGACTCCCCACTCCTCTCACGCATTCTCTCTGCTGGGCTTCCACCTCCCTCCCCATTG
TAAGAGCGCACATCTGTCGCCTGCCGATGCGTGACAACAAAAAAATAAAACCGAATGAAG
GAAAGCAGGAAAAAGAGTGCGCAATTACTGTTATTAGCGAGCCACAGTGGACCCATCTTA
GGCAAACTAAAAGCTGGCTCATTAATGTGATTAATACAGCTAAAACTCCTAAAAATAAAA
CTAAGAAAACATGTAAAGACAAAAAAAAGTGCAATCATCAACCACGGTGCGTGGAAACAA
CAAATGTAAAGCGGGCCTCTCTGTCTCTCTTTCTCTGCCGCCCGCGCTCTCCCTTTTGCG
TTTCGTTTCCGATGGTCCGCCGCCGCCACTTGCGGTTCTTGCGCTCTCCGTACTCTCTAC
ACGCTCATTCGCCGCGAAATCACAAACACAGCCGGACGCGTCGCCAAACGGCGCTTGTAA
ATATTTTTGTTAATTGTACATTTGAATCGCGGAAAATGCAATAGCCAGTGCAAACAACAG
CCGTTAACTGCTGTCGCAGCGCAGTAATAAGAGCAAAGCCCTTAACAGTAAAAAGTAACA
TACAGTTTGTCTTATAAATCTCCAAAGGCCAAAAAAAAAATCAAGAGAACTTTACAAATT
TCATGAATGAATTTACTAAAGTCTTGCAAACAAAAAAGAACACTGCCGAAAAAGAGTGCA
AATTGCTGTAAACGGAATTTTTCTTCTTTTTTCGCTTGTGTATGCATCACTTTTCGCAGT
TGCCGACTGCAGTCTGTAAATGTGTTTGTGTGGGTGACTTGAATTTTCTTTTTTATTTCT
TTCCCTTTTTTCATTAGTGGATGTGGTAAACGTTGCGCATGACTTGTAAAGTTCAAGTTT
TCCTTGAAGGAGGGATATTTTTTTCTTTTATTGTTAAACAAAATGCAATATTGTGCGTAA
TTTGTCAATTCGCCGTCGCCGACGACTTGGCTGAGTGGTAAATTCGCCGCTCCGCCGACG
TGCAGGTGTAGTGGTAAAAGAGAGCAGTCAGCTTCTGCTTCCGTTTTGTGCGTGTACGGC
CTCTCGCTGGCGTGTAGTTTTTTTTAGTTTTGTTTTGCTTTCCATATTTCGGCCGATTCC
GCTTTATGCTTGAGTTTCGCCCAAGCGGTGCGGCATTGCCAACATAGAGAGCGGAGTAAT
AACGAAGATTGAAGTTGAAAAATGAAACCAATTGATGAATGGTATCTTCAAAATACAAGT
GTTGTGTATTCACTTAAGTTACTATTACTGTAAAGATTCTATACATATGGCAACATATGT
AAAAAAAGAATACAAGTAAATATCTTATAAGTATTGCATTTTCTAAATCCTTTGCAGACT
CCCAACGCATGTTACGCACAATAGTTGGTCCTAAGAACTAGGGGATTTTGAACATGAACA
AAAATGCCGGCGATGGCAGCGATGGCAAAAACTCAAACAAAAACTCGAATGCGGGAGGGG
GTGGTGGAGCCGGGGGGCCACACGACCCCACCGGCCTTTTAGATGCAGCTTCCCTGTTCG
GTAAGACATTATATATTTTTTCAGTTGCAAATGATGATCTTAAATGTTTCTTCCATTTTC
AGCTTACTGGGGACGTGATCCAACTGGAGCGGCGGCTGCAGCGGCTTCCAATCCGCTCTT
CAACTCGCAGTTCAATGCCGCCGCTGCTGCCGGATTGGGTTTATTGCCACAAGCTGGAGG
CGCCTCTGCCAATGACCGTTATTCCATGGCAGCAGCAGCGGCGGCTGCGGCGGGAGCCCA
TCACCACCAGAACACGATGGCAGTGGCCGCTTCCCAGGCCGCCAGTTTGGCCGGTTTGCA
TCCAGCAAGTGAGTAAAATGTCGGCACATTCCGTATTTTAGTAGCACTCCTCTAGAAGAC
ATTTGTGACGCCACGAAATTAGCAACTGCTGTGGTGCGGTGTGTTAAGGCGACTTCGTCC
CATGAAGAACCGTAAAAAATCTACGCGAGTTCGAATCCCGCTTGGTGAAAGAAATTTTTA
TCTGCAAAGTAATTTCCCTAAATTGTGCGGAGTATAACAGAAAATGTCTTGTCTATCGCG
CAAGAACGTTTGAAGAAAATACTCCTAGAGCATTTAGTAACTTGCTATTCGCTTTACACT
GGCCACTACGCTTCACCCAGAGCAGGGCAGTGAAAAATGGTCAAGCACAAATATTTTAGT
GTTCTTTTGTATGTTATATCTTGTTCTTTAAAATAGTATTTCCTTCGCTCTTATGCGCCG
TAAATTAACTAAAGTTAAAGTATTTATTTGACTCAACTAAGCATTTGCATCCATTTTTGT
GAAATCACTGTACTAACTCGCTGCTAATCGATTTACAGGCTGGTGGTCAATGGCCCAGTT
AGCTGCCCAGGATTACTTCAGTCGCCTGCAAGCCTCGGGTCTTTCCCCCTTTCCACATCC
CGATCTGGCGGCTGCCTTTGGACCAGCTGGGATGGGAATGGGCGGCGGTGCTGGTGGAGC
GGGTGCTGGAGGTGGTGGAGCAGGTGTACTCGGCCAGGGCGGCGGTGGAAATGGCGGAAG
TGGCAACGGTGGTGGTGGATCCTCATCGGGTTCTTCCGGCAGCAAGTCAAACAAGTCGCG
CAAGGAGAAGCGAGCCGCCCAGCAGCAACAACAGCAACAGCAAAATCTGGCCAACAGTCT
AAATGCGGCAGCTGCGGCGGCAGCAGCAGCAGCAGCCAATAATCCAGCAGCCGCGCTGGC
CAGCATGCATGGTTTTGGTGTAGGAGTTCCGGGCACGAGCATTCCGTCGGTGAGCACAGG
TAGCGGATCAATATCCACAAATAGTGGAGGTCATGGAAGTTACAAGGTAAGTGCAAACGC
GAAATACCTAAATGGAAATTCTTAAATCCCTTTATTTAATACATTAGAGCACGGCCAGCG
CTTATGGTAAGCCCTCGACTATGACGAGCAGCAGCATGGCTAATAATCCGGGCTCTGCCT
ACGATCCGGTGACCCTGCACAAGGAGCTGCTGGCCATGCAGGCCGTGGCAGCCGCTGCTT
CCGGCTCAGGATCAAGCGGTTCCTCAGGCAAGAAGTCCGGTGGGGGTGGCTCCTCATCCT
CCTCGATGCACAGCCTTGGAATGGGAATTGGTGGCAGCGGTGGCATGATGTCCAGTGGCA
AAGCTTCGACCAGTGTGAGCGCAAGCAATTCATCATTGGGAGGAATGCACCCCAGTTTGA
CTAGCAGCAATCCGCTGATGTCGCCCCATGCGGGCATGGGCTCCTCGTCGTCATCATCGA
GCAAGGATCGTGACAAAAACAATCCCTCGCTCAACGCTCTTAACTCGCTCTCACAGTTTG
GAGCCCTGGGAATGACGCCACAGCAGAGCATGCAGGCGGCAATGAATGCTTTTGCAGCCA
GCACAGGAGTTTCGCCATCCGCCACGGTAACGTCCTCGCCGCACCACTCTTCCCAGCAGC
AACAGCAAATGGGAGGGAACAGTTCCACGTCGGGATCGGGCAAGTCCAGTTCCAAGGATT
ACATGATGGGGTAATTTAGGCTTGAGAATCGCACTGTTTTACATTATTACTAAATATATT
GCCCCCTTACAGTACTGGAAGTGAGCACCCATCTCTGCTTGGAGTTCGTTTACCACCGGA
CACGGAGATAATCAAGTACACGTCCTCGATTGTGGGACCCAAGATTCCTGGTACTACCTC
GCGCGGTCGCAAAAAGACTATTTCCGAAACAGAACAGCAAACAACACAACAACAACAGAA
ACAACAACACCAAGCAGAACAACACCTACTCCAACAACAGCAACAAGCACAAAAAGAGCT
CGACAGCACCAAAAATGCCATTTCCTCTCTGCTTGCATTTCCAGGTCTCAGTCCCGCGAA
GCGGGCTAGACTCGAAATGGAGTACGCGGCGATGGCTGCGGCCGCTCAACAGCAGCATCA
GCAGGCACAGCAGCAACACCAGGCGCAGCAGCAACTCCACGGGATGCTCGGAGCAGCCGG
TATCCCGGGAATGGCTGGACTGGTCGGTCTGCCTGGCATGAGTGGCAATCCCCTCGATCA
GTTGAGTGTAAGCAAGGCCAGTTCTTCAACGGCGCCCACAACCAGTACCAGTTCCTCCTC
AGCAGGGAGCAACCTGCTCAACCAGAGCAATAGTGATCGCGTGGAGGTAATCAAACTGCC
ACCAACAATTACTTCAAACGGAGCCTATAATCTCTCAAGTAAGGGAAAAGAGGTGCACGA
CCTCACCACCGACATGGCCACCAACTCTGGCGGTGTGAATCTCAGCCTAAAGTCCAATGC
TGGCTCCAGCGCCTTGACGCCCAGCGGTGCCGTCGGATCGGCCAGCAATCCCATTACCAT
CGATGACTTTGACGCACCACTTAATCTTTCCATGAAGCCCTCGGATAAGAGCAATAGTAG
CTCGTCAAATGCAGCAGCAGGGGGCTCCTCCTCTTCCAGCGCAGCGTTGGCTAACTTGGC
GAGCGATTATCAGGCAGCGTCCAGTGGGCAAAGCGGTAATAGTCTGCAGAGTTTGAGCTC
TATTACAGCTGCTTTGGGTGGAACAGGAGGTATGCCTGGTGGTTCCATTTCCGGCAGCGG
AGGAACCTCTCCAGCTCCAGCTGGTGCCGGATCAGGAGCCACGGGTGGTGGTTCGGGATC
TGGTGGATCCGGCGGTGGATCGTCCTCTTACAAAGAGGGAAGACCTCGTAACCTGGGACG
CGGCGTATCCAAGCCCAAGAAGAACACGGTAGCTTCGCTGTTGGCTCAATCCCGAGCTGT
GGGCCTTAAACCTATGCTGGCCACGCAACAACTTCTTCAACAGGGTGCTGATATTGTGAG
TTAATCAATGCATAAAGTCATGACATACCATCAAACTAAATACTTACGACTTTTCAGGAG
AAAATCCGCCTGGCACTGAGCGAAGCGAATGCCCATATGGAAACTTCTACAGATTCCGAA
AGCGTGGCAGCCGAAAGTGGTCTTTCGGAGTCTGAGAGTGAGGATGCCAACATTCTGAAT
GTAGCGGAGCTAAGGGTGCCACTTGAATTGGGCTGGAAACGGGAGACGGTGATTCGTGGA
CTGACTAAGCAAGGGCAGATCCGTGGAGAGGTCACATATTATGCACCAGGAAGCACGACG
CCGCTAAAGAGCAACGGACAGGTTTTTGCTGTGAGTTTGTAGGGCGACTTTTTTGAATAT
ATTAAAGCAAATTCTATAACACACAGTAATAACTCTAAACCACTAAAAATGTATAATTGG
AGTTTTGATATGTAATCAGAATAGCTTTAATTTATGGTTTTCTTAATTTTAACTTTTCAC
AAGCATAAAATTATCAAATTGGCTACAATGCACACAAGGATATTCACTTTCTAAGAACTT
AGCTAATTTATTGAACTCTTCACAGATCCTGGAGCAGCAGCCATCGAATCTAAGTCGTGA
AAACTTTAGTTTTTCCGCGCGAGCCATTGTTGGTTCATTCCTGCAGCCTGCACCACCGCC
GTACGCCAATGATGGCGAGTACATACGGATGACGGACGAGGACGTGGCCAAGCGGTTAGA
GGATCTGAAGGTCTTCACCCGCCAGACTCTTAACGTGGAACAGCGAATTGAGATCGCCAA
GCAACAGCAGGCGATGCGTGATGCTAAGAAGCTGCAAAAGGAAGAATTGGCCAGAAATAA
GGAGAAGGCGCGACAGGAGAAGAACTCCAAGTTGGAGCAGCAGCGCAAGGACAAGGAGCT
CAAGAATCAGCAGGCTGTTGAGGTAATTTGAATTTGTAAGACTTGCGAAGATTATCTGCT
CATGCGAACTCGTATTTTTAGGAGCGCAAAAAGCGTCAGGAGGAGCTAGATCGCCTTAAG
CAAGAGGAATTGCTTAAGAAGCAACAGGTTAGTCTAGATTAATTAAGCTTTGCTGAAATC
AGTGCATAATTCTGTTTTGTTTTGCAATAGGAGAAAGAAAAGCGTCGTCAGGAGGCCATT
TTAGCTAAGGAACAGGTACTTAATGCCTCACCTTATGTCTTGTGCTTGATACCAATCCGA
CTACTTTCCGTTTAATATTTGGGAGAAAAGAAACTAGTTCTAGCTTTTCAAAGAGAGATT
TATTTATTTTATTTCAAGACTTGTTTGCTTTGCCTTTAATTCCTATTTCTTTCTGTTGCC
TATACTTTAAACTGTATTTACTGTTGCCAGGCTGGTGATTTGGGCTATTGAATGAGATAT
ATTCCAAATTGGTTGTTCAACTTTTAATCGTGTTTCGGCGTTATTATTTGAAGTGTCCGA
TCTATCCGCTTGTTGGTTTTTTGTTTAGTAGGGGTCGTAAAAGACCAACTTTGCCATTTC
GGTATCAGTTACTACTCTCATGTTATTAACCAAAACCAATCTTATTTTATCTAGGAACTA
CAGAAACAAAAAGAGATGCTGTTGGCTGCCGAAATGGTAAGAGGACTAACCCCTTCTTCG
GTTATGTAATAAAATGCATTAAATTTTGTTATTTTCTCTTCATAAAGGAACGAGAACGTC
GCCGCCAACACATGAGCCTCATTCGAATGTTGGAGCTTCGTCGGAAATTCGAGGATCGTG
AAAAGAAGAAACACCAGCTGGTTCTAGACCGTTTGCTTCTGCGTGAGCGTCGTATGGCGG
AGCGAAAACGAGATGCGGAGATTCTGCAGTTGATAAGGCGTCCCAATGAGGACTCCGAAA
TGCCACAAGAATTGGTAATCCCTGAACTGGATAGGATTGCCGGCAACCGACTTCCCGGCC
AGGCAATGGCCGATTTGCTCATGGTCTTTGAATTCCTACATAACTTTGGGGAGACTCTAG
GCTTTGACATGGAATCACTGCCGTCGCTTCAGAACCTGCACGATGCTTTAATGAGCGATA
GCAACGCGGATGCGGAAGAGGAGTTGTTGTCGGTGATGACGCATCTATTGGTTTGTGCCA
TTGAGGATCCAGGTGTTCCCAATCCCGGCAGACACACCACTTTACTGGGACAATCGCTAC
GCAATGCGGACATCACCAACTCGAATGTATCCGAAATCTTGAGGATTTATCTGTATGCTA
CGGCCACAGGTGAAGTGCGTCAAATGCACGGAATCACTGTGGATCGTGAGCGAGAGAGAA
GGGTGCCGGATCATCATCAACTAGATAGCGATACCACAACCCACTCACATTCGGTAAAGA
ACCAGGAGTACTATAAGCTTCTCCATGAAAACGACACCTGGAAGTTGTCGCAATCGCTGA
AAGATCGCCCCTTCGTTGCGTTAAATCCCACCCGTAAAGCCCAAATGTTGGCCCATCTAT
GCAACGACCTGCTCATGAACAAGGCCGTGCTCCGCCAGATTGATGGAAGTCTAGAAACGT
GCGCCCAGATGCGAAAGGAGAAATACATGACGGACATGAAGGTGCGCAAGTACAAGGCTC
TCCACATGCGCAAGGCTCGAATTGAGGCCTATGAACGAGCACAGGCGGAGCGTGAGGCGG
CTATGCAGGCGTTGATGGCACAGCAGAAGCTGGATGCAGAACGTCTTAAGGCGGAGGAGG
AAGCCAAGGCCGCGGCGGCAGAGGAAGCAGCAGCTGCAGCGGGCACAGATGGAGAGGCAA
CCAAAGGTGGCTCACCCAATGGCGAGAAGCCGGAAGACGGCGATCAGAATGAAGAGGGAG
CCGCCAAGGAACCCCAGCAGCAGCAACAGCAGCCAATGGAAGTGGATGGCGTGGTCGATG
AGGCATCTCTTGTAAGTCCGGCCAAAACCATCATTCAAACGGACAATAGTCTGACGCCCA
GTAAACAGGACATGCCCACACCCACCTACCAAATTAATGGATCCAGCACACCTACCACAA
GTGGTGTCACTGGAGGCGACATGAATGTTCTGCTGCAGGCCAAGAAAAGCGGGGCCCGAA
ACTCCATCAACGATGAACACCACCATGATGTTAGTATTATCGACGATGATCTTTCCGACT
TGGATTCGGAGATCACGAATGTCGAGGAGGACGAGGACAATCGCTTGAGTGCCGATGAGT
TGCAAAAGAAGCTCGACAAGATTGTCAGAGCTTCCCTAAACTGCAAGGAGGCACTGGAGA
AGAGCACAAATCAGTTGAGAGCTGCGTGCTTTGGGCAGGATCGCTTCTGGCGTCGCTACT
GGAAGTTGCCCAAGGCTGGAGGTATTTTCATTGAAGCACTTGAGTCGGCCCAAAATGATA
TTTGCGATTATCATGAGGCATTGGAGGCCATGGATGACAAAAAGGATGCAAACGACGAGA
AAGAGAACTCCGAAAATGAGAAGGATGTTGCAGCGGAGTCCAGTGAGCAGCCAATGGAAG
TGGATGAGTCCATTACAAAACTGGAAGATGGTGTACCAGCTTCGGACGTCGGGATGCCTG
AAAGTAATCAACAGAACGCACATCAAGATGAGGAAGATGACGATGATGATGTGACAGAAA
TCAACAAGGTGGAACCGGAAATTGTTGATTTGGGTGATGATGACGATGATGCAGCTCCCC
CGCTGCCCAAGATAGAACCTCCCAGGCCAGAGATTAAAGTTAAATCAGAGATGGAGCTGA
TGGGTCCACCACCCACGACTATGATATCCACTAAGACAGACTTTGAAGCTGAAATTAAAA
TACCCTCTATGCCTGGCATCTTGATGCCGCCTACCCTCAACAACAACAACACCAATAATA
ACAATAACAACAATGGAAGCGACAACTGTGATAAGTTGGAAACTGGTTTGGGACTAGGAC
AGCAGCAGCAGAACTTTAGCCAGTCTGTGATCAAGACGGAGGATGTGAAAAAAGAGGATG
ATTGCATAATAGTTTCTACATCCAGTGTTGACGATACACCAAAGTGGTTCTCCATTGTCC
GGCGGGAGGTTCCATTGATCAGCGAACTGCCAGCGGAGGAGGGAGGCGTGGTGGGCCAGG
AACTTCAGATCAGCTATGCAAATCAGAACTGCTCCGCTCAGCTGCAGCTGCAAGGTCATC
CGTGGGATCTGATCAACAACATGCAGTACTACTCGATTCCGATGGACGAATGCAAGGTGG
ACACCAGCAAGCTGGGCAACGAGTGCATCTTCTCGCTGAGTGGCCTCGATGAAAAGCAAA
TGCTAGCCAAGGTGGAGGAGTACAAGGCCCACAAGGTGGAGTCAAAAAACGGTCTGGGCT
CTCCTCATCGCCACCACGAGACTAAAGATGATGAGGAGCAGGCCAAGCTGAAGTTGGACA
AGGAGATTGACACCGAAATGGAAACAGATGCAGATGACCTAGCTGGCAAGGAAAAGTTTT
TTCGCTTGCGCTCTGATGTACCCCCGGATACGGGAGGAGGGGTCAGCGAGGGAACCGATG
TAAAGCCCAAGATTGAGCTTCGTTTGGATGAGGCGTTGTCACAGGCATATTACCACAACA
TAGCCAACATGTCATTGAGCAGTGTTCAAACGTATATACCCATCGATATCCCTCTGCCGC
TTTCCATGACCCCCGATGAGCATCGTCTGCTGGAGCAGGTCAAGCTGGCAGGTTTTCCGG
AACGAGTTCACGGAGTTTACGTGCCCCGCAGACAGCGCTACGGCTGGTGGCAGTTGGACG
ATGAACAGAAGCTGCGCCAGCTGCTCAAAACTCTCAATCCGTCGGGATTGAGGGAGCGTG
AACTGCAGGAGAATCTTCAACGATTCCTCGGACTGGAACAGCCATTGGGTGTGAATTATA
AGCTGAAATCGGACATCGATTTTCCAGAGGAATTCCTAATGCCTGACAAGAAGGGCGATT
GGAATCCCAAGGTGGCCAAACGTGTGGAGCTTGCCCTTATCGAACAACTAGAATCACTGG
AGGACAAGGTGGCCAGCGCTTCTATGCAATTAAAGAACTGGCAATTGCCCAACCGCGTGG
AGAGTGAACTCACCTTGGACTCGCAGGAGGATGTCACCGAAGAGGACTTCGTCAGCATCA
TACCCATGATCCGAGAGAGAATCATCGACTTGGAGGCAAATATCGAAAGACGTTACTTGA
AGCCGCCTTTGGGCTCGCAGACAGGCGATGCCCATTTGGCGGTTATTGCTCAGAACCAGC
ATACCACCACCCAGACGCAGAACTCTGCATCGGCAGCAGCATATCTCCTGCAGATGCAAC
AGCAGCAGCAGCAACAGCAGTTGGCCCAGCAGCAGCAGCAACAGCAACAGGGTTCGGGTG
CGGGAAATAGCCTGAATCCCTCATCCTTCAACGAGCGTACTATGGCATTGGCGGCGGCAG
CAGCTGCTTCGGGGCCAGGAAACGCAACCGGAGTAGCCAACTCGGCAGTCGTGGCAGGAG
CCACGCCCTGCGAATCGGGCAGCGGAGAACCGAATTCCGGCAACGCGTCACCGGCCAGCA
ACTGTGACAGCGATCGGGACGAGAAGGTGGAGCAGATACCCAAGGGATTGGTGCAGTGGC
GGGACGCAGTATCCCGATCGCACACCACCGCCCAGCTGGCGATGGCCCTGTACGTTCTGG
AATCCTGCGTGGCTTGGGACAAGAGCATTATGAAAGCGGTAAGATTAGGAGGATTTTGAA
TACCTTTAAAATTTCCCGATTTGAAAACGATAACCTGCTTGGCACCCGCCTATATTTGTG
GTCCATTTCATTGTTGTTTTGGCTGCACACACACTAACACCCACTACTCACAACCCACAT
ACATAATTGTACACACATGCATAGCATTACCATCTAATATTTCGACACACTAACCGGTAT
TCACCACAGCTGAAACGGAGGTTTTGAAACTTTAATGAAGAGAGCTTGTATCACGGTTGT
TTTACGAATTTAATATTTTCGAACTTTTACTTTTCAATATAACGTTATGCTTTTTAATCA
AATTATCTTATATTGAAGTAGATTTAAAAAATAGTAATATAAGAATAATAAGTCACTTGG
AGTTATATTTTTATATAGTATTAGTAACTTTTGTTTAAATCACTTAAAGAATGCGGTTTT
TTAAAAGCAACTGTGATTACACTGCTCATTCGATTTATTTTGTATGTAGTCGAGTAGTTT
TTAGAAACCCCCTCTGCATACAGATACGTGGAAATTGCCTGTGAAATTAATTCGAATTTT
GTTTTGTTTCTTCTTCCGATTTTGTTTTTTCTTCTTAACTGTCTCTTGCTGAATGTTTGA
CTTGTTTGTTGCTTGTGGTGTTTCATGGTGTTCTTTAAACAAAATACAACAAATTTAACG
CTTTCATACTCACACACACACACAAATACATTATCCACCACTCACACAAACATGTACATG
AATGCTTTGGTTGCCCATTACCGTTTACCGATAACCGTTAAACCCCTTACAAACGAAACC
CACCGAACCCACCACGACTGTTAATCCCACCCCTCAAACGAACCGTTTCGAACTGCCATC
CGAAAAGTATGCAACAAAAAACAAGTCCAGCAAAAAGAAGAGCAGCGCCAAAAAGCAGGC
AACTCCCTCGAAGAAACAGCAGCAGAAGAAAAACAAAAAGGAGCAGCAGTTGACCCCCAA
TGGAAAAGAGAGCAAGAGCAAGAGCGCAATCAATAAGCCAGAAAACCAGGCTCCGCTGAG
CATCAAAATCAACCTTAAGGCTCTGGCCCAAAACGGGCAGTGTTTGCTGAAAACTAAAAC
ACCACCAATCCTAACCAAATCCCCAACCGCATCCCCATCCTCCCATCCAAACACTAGCGA
CTCCGACTCGGACTTTGGCAAACGGACGAAGAAGAAGAGCGGCGGCAAACGCAGACGCTC
GGCCAACAATACAAACTCTAGCAAATATTCCAATTCCTTACAGAATTGCCAGTTCTGCAC
GTCCGGCGAAAACGAGGACAAGTTGCTACTGTGCGACGGCTGTGACAAGGGCTATCACAC
CTATTGCTTCAAGCCCAAGATGGACAACATTCCCGATGGCGATTGGTGAGTACCAGTACC
AGTACCAGTCCTGTATCTCTAAACATCCTCATTCCTCACATGTCACTGTCATAGATTACA
AAAAAGAAAACACATTAATCCGCGTTGTCTTGTTGAGCGTTGATCGTTAACCTTTGAGAA
ACTGTGGCACTGTTCCTCTCTCTCTGTTCCCAACGCCAATCCCTAAACTGCTCAACATTT
AGTAACTTCAAATCCTTTCCTTCTGCTATTTCAGGTACTGCTACGAGTGCGTGAACAAGG
CCACCAATGAGCGCAAGTGCATCGTTTGCGGCGGTCATCGTCCGTCGCCCGTGGGGAAGA
TGATCTACTGTGACTTGTGTCCTCGTGCCTACCACGCCGATTGCTATATACCGCCGCTGC
TAAAGGTACCGCGTGGCAAGTGGTACTGCCACGGTTGCATCTCCCGGGCGCCTCCGCCGA
AGAAAAGAAGTGCAGGTGGAACATCCGGCAGCAGCAGCAAATCTAGGAGGGACAGGGATA
GGGAGTCGGGCGGATCGGCCAAGCGGCGTAGCGACAACAGCAAGACACCAGCCATGGAGC
ACATGCAGCAGCAGCAGATGCCACTGGCAGGCGGGGATTCCCACCATCATCATCATCAGC
AGCCGCCGTCGCTGAACTCCTCGCACGATGAGTCGATGAATTCTCTGCCGGCGGCTCCTC
TGAGGTGAGTGTGGGGGCCTGCGGGCGGCTGAATGGGCGGCGGAGTACACGGTCCGGGTT
CCAGTTAAATAATGCCTCTGCTCTCTGCAGTCCGGCGCACTCGGTGGTCTCGGCCACGAA
CTACGATGACCAGCACCATGCCAACAACTCGGTCGATGGCAGCAGTCGCTTCCACGCGCA
TCTCATTCCCCCGTCAAATAATGGCACTGCGGCTCTGCTGGAAGATGTGCCGGGTGGCGC
CAATGTGATGCCCGGCGTCTATCCAGTTTATACGCCAGTTGCGGCTGGCAACTTCTCAGC
CGGATTGATTAACCAAGCGCCGGTGCAGCCAGCGATGCCGTTTGCCAACGTGGTCGCCAT
GTCGCCACGGGCTGTCACGCCCACCCGCACCCGAACGCCCACACCGACGCCAGCACCCAC
TCCGCCACCACCACCGCCGACACCGCTGCTAATGCAGGCCTCGCCCACAGCCACCGCCCT
CCATGTAAACGCCTGCCAGTCACCGCCCCAACAACAGCATGCGCAGCTGATGACCATGCC
CTCGCCACCAGCCATTGGAGTCGGAACGGCCACTAACCAAATGTCGCCACCGCCCATCAA
CATACATGCCATTCAGGAAGCCAAGGAGAAGCTGAAGCAGGAGAAGAAGGAGAAGCACGC
CACCAAGAAGCTCATGAAGGAGCTGGCTGTCTGCAAGACGCTATTGGGGGAAATGGAGGT
GGGAACTAAAAGAACTCTTCAATAAGTAGGTTACCTAACGTTCTTTGCATTACTTCTTGC
AGCTTCATGAGGACTCGTGGCCATTTCTTTTGCCAGTAAACACCAAGCAGTTTCCCACAT
ATCGAAAAATAATCAAAACTCCCATGGACTTGTCCACAATCAAAAAGAAATTGCAAGATT
TGAGGTTAGTAACGCAGCTTAACTTCTATAAAATCATAAACTCACTAGTTGAACATTTTT
TTTGAATAGCTACAAAACCCGTGAGGACTTCTGCGTGGACGTGCGTCAGATCTTCGATAA
TTGCGAGATGTTTAACGAGGACGATTCGCCCGTTGGCAAGGCAGGCCACGGCATGCGCAA
GTTCTTCGAGTCCCGCTGGGGTGAACTGACTGACAAGCACTCCTGATCCTGCACCACTAG
CCAGCCACAGATCCAGATGGCTACCAGCACCAGCAGCACGATCACCATTGGCACCACCGT
CACACCGAACAACATGGCCGTCACAGCAACGCATCCCATTGAAATGGTCACCCTGGTCGC
GGCAACGCAGGAGGATGAGGAGGCAGCCGTGGAGACGACAACAGCATTAACTGAAGCAGC
ACAATTTTGGTCAAGAGATTAGTTTAGATTAAGCAGAGATTGTACATAAATGGGAGGAAT
GAGGAGAGGGTCGAGAAGCACAGCATACACATTAATATATATATATATATATTTATATAT
AGTAGATATATAAACACACACGCGAGAGTATTCAACGTCCTACGTCGGTAAAGACCTTGG
AAAGGGGTAGCTTTGATTAAATTAAATCACCAGCCAAGGCGAACAACAGCGCAAGTATGC
AAGTGAAAAAGTGTATTCAGATTTTAAGTATCCAAGGCGGCAGCGGCAGCAGCAGTATAT
AAACAATAACTATTAGCCGACATAAACTAGCAGTTAGAAATCGTATCGCATAAGAAGCCA
TCTACAGTAGACGCCCGGACTGGATGAACGCTGACAAATGACAAATGAACACGTACAAAA
ACTGTCTACCAATTTCCGATCCGATCGATCGATCCATCGTTTGAACAGTATTTTGTGCAC
AAAGCCGCGTCGCTTTATTTTCTACACTTACAATTCGAACCCTAATTTTAACAACTATTT
TTTAAGCACCAACGAAGCGCTCATTTAAGTTTTAAAGTGTATTTTGTACTTATAGCAACT
CCGAAATCTGTATTTAAACGTATTATAACAAGTGCTAACAGTTGCCCAGGCAAAAATGCG
AACAATTATACTCAAAAAGGCGGTGCGAGGAGGACTTGTAAATGTAAATGAAAGCAAATT
AAAATTAAATGTATTAAATTATTTATTCTGTGTAAATTTTCCACACTGTAGTTGGTACTT
TGAATCGTAACTTTGGCAAATCGCAAATACAACTCGAAATCAAATCAAATCGAAACTGAG
AATAAACTTAAATTAAATTATCGAGAAAAGATAGAAGCAGCCGAAGGAAGGAAGAAAGAA
GGCAGTGCAGTGAGGCAAGGTGGACATATCCTAGCGGGATCTAAGCGCAACTCCAGGACA
GTATTAGAGGCAGTGGAATCCGGATCCGGATCCGGCAAGCAAGGCATCTGACATTTTAGC
TGTACATATATAGGAAGTAGCCCGCACACAAAATTCAAGCCGATGCAAGCAATACAGATT
AGCCTATATAGACGGTGAAATTGTTTGGGGTGGGAGACTTACAAATGTTACATATAAATT
ACTATATACACAGAATACGAATTAGCAAAGCAATGATATTTACACGAACTACATTTTTGA
ATAAATCGAAACTCATTTGCAGTGCAGCACAATAATTGAATGAAATTGAAACTGAAACAG
AAACTGAAAAAGAAATCGCAAACGAAACAGAAACCTAGAGCGAAGAATGATTTTAGAGCG
TGTTAATATCTTTTGCAACAAGACGATAATAGTTTAGAACACCAGACCAGAACTACCTAC
CTACAACCCACAGATAGCAGCCAATCACCACCAGCCAGTTGAACACAGAATGTATTTTTT
TTAGCGCAGCCATTATAGTTTGTAAAGATATTCAATGCATTCAGGTGATTATTTGAACTC
GTGTGTTTAGCAGAATGTGAGAGAGATGCATTCGCAATGAGTTGCTTGTGTAAATAGGAA
GCGAAAGCCCCCTGAACCCATGCATGTACATTGTATATAGAGGATAACGATACGCATTAT
ATGGCATAAGCCCCAAGTTCAGTACCCCAAGACGCATTATCCATCTGCTACGAGCATGTT
ATTGGCATTCATACAGTTGTGTCACTTCACTATAATCGATTCGCAATAATTGAGAAAAGC
AGTCGGCAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1253, 24657..24839, 24902..25147, 25658..26145, 26207..26829, 26892..28134, 28197..28469, 28705..29061, 29121..29186, 29250..29294, 29694..29735, 29807..33817, 35083..35204, 35434..35883, 35970..36597, 36662..36783, 36849..37950
24713..24839, 24902..25147, 25658..26145, 26207..26829, 26892..28134, 28197..28469, 28705..29061, 29121..29186, 29250..29294, 29694..29735, 29807..33817, 35083..35204, 35434..35883, 35970..36597, 36662..36783, 36849..37002
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved