Drosophila_melanogaster Locus Rs1
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Rs1
Drosophila_melanogaster
Rs1
2R
snoRNA:MeU6-C68
2066..2164
4885
ATATAATATTCAATTTCAGTTAAACAAACAAAAACAACCAAAAATTGATTGCAAATATC
ACCAAGCCATTAAAAAAGATTAATAAATAATTTACCCTGGTAGAAACATACATCTTCTAG
TTATTAAAAATGTTTAATTTCACTTAACGAAACAAAAACGTACAACAAACCAACCCTACG
ACTACTGGGCGGCCAACTTGGCATCCAACTGGCCCAGATCAACGCCCAGTTCCCTGAGCC
GTCTCTCCTGCTCCTTGGTGTCCAGTCCGTGTTCCTTGTTGTACCTGTAGTTGACAGTCA
GCTGCACCTCCTCCAGACCACTGACATGCTCGTACAAGTTGCCCTCCAACCGGAGATCGA
TGTCGCTCTCCTCGCGCAGCGCACAGAAGTACAGGAGGAAGATGGCCAGGCTGGCGGAGA
TTACGTAGGGTTGGTACCAAAGGGTCTCGTCGCTGCCACCACTGCGGGTGTCCTTGGCGC
GCCAAGTGGCCGCCTGGCTGCCGAAAAACTTGATGGGCTCATCGCTGACCATGTCGTCAT
CCGATTTTTGGCTGGCTGCTCCTTGGTTCTTCGCATAGAAGCGGGATGCAGGTGGAGTGG
CGCCTGTCGCTGGCATCAGTTGGCTACGAAGAGAGCCTATTGTTACTACTGCTGACTAGG
TATTGTATCATTATAATAACTCACCGCAGCACCCTTGTTTTTGTAAGCAAACGCAGCATT
TTCGATGGGAAACTCAAGCAAATTTCATAACAAAATTGGTTAAACAGCTGACGATTTAGA
GATGAGAGCTATCGCCGGCACGCAATTTCGTGATGTATTGATGGCTTGAAAAACAAAGTA
AAATATCAATTATGATGAAAATAATATGTTGATTTTACTTAGTAAACTTATGTTTATGGT
TATTTGAAATTACTTAACATTAAAAGAGCAACAAACTAATATTTCCACAAATTCCACCCA
CGCTTGCAAACGATGATTTGACCACCGGTTCGCCCATCTCTAACACGCCACACGTGTGTT
TTAAATTGTAAACACGCGCTGGTGGAGTTTTGAATAGTTCTTTGCTTCAAAAATGGGTGC
AACCAAGAACCTGGACTTGATAGGCACCATCGAAGACGATGCCGAGGTGGAGAACTTGTC
GGAGGACTCCGATGCGGAGGTCGAGGTAGGTTGCTCACACTTTTAAAAACGATAGCAAAA
CTGAGTTCCGAGTGCCTCCGCAGTACCAACCCACAAAACTGAGACACAAGAAGGTGACGG
AGTTTGAGAAGGGCTTCGAGTTCGTGTCCTCAGTGAAGGAGTACAACCAGGACACTTGGG
ACGACCTGATGAAGTACGTGAAGCGAAAGGCGCGCACAAAGACCGACGACAAGATCGCCG
CCCGGCTGCAAAAGCGGGGTGGCGCCGAAGCTGTGGCCGCGGAGCAGAGCGATGGAAGTG
AGATAGATCTCTCCGAGGACGAATTGAAGCATGACAACCTGCGGCTAAGGGAGAAGAAGG
AATCCAAAAAAAAGAAGAAGAAGGCTGGAGAGGAGGATGAAGAGGACGAGGGCGAGAAGA
TGCAGTTCGCCGACACTGTAGAGGCGAACGAGCAGATCACTTCCTTCTACCAAATGAACC
TTTCACGTCCCCTGATGCGTGCCATCGGTGTGCTGGGGTACATATATCCTACGCCGATCC
AGGCCTCTACGATTCCTGTGGCTTTGCTAGGTCGCGATATCTGCGGCTGTGCTGCCACGG
GAACGGGCAAAACTGCTGCTTATATGTTGCCTACTCTAGAACGTTTGCTGTATCGTCCTC
TTAACAACAAGGCCATCACCAGGGTACTGGTTCTTGTGCCCACTCGTGAGCTGGGCGCCC
AGGTTTACCAGGTGACAAAGCAATTGTGCCAGTTCACCACTATTGATGTGGGTCTGGCAA
TTGGTGGTCTGGATGTGAAGGCTCAGGAGGCAGTACTTCGCCAGAATCCCGACATTGTCA
TTGCAACGCCAGGTCGTCTAATCGATCACATTAAAAATACGCCCAGTTTTACATTGGATT
CCATTGAGGTAAGAAATCGAGGTGAATTTAAGTTGATGATTCTCCATCCTTGCGCTCTGA
GCTCTTTGCGGAGCTAAGAGGATAACCTGGTTCTTGCTTCTGCGCGGCAGATGCAAGCTG
ATTCCACAGGCATTGTGTTTCCTACGTTTACTTTACCTGAATAACTTAAATATCTTTTGA
TATCCCGAACAGGTTCTCATTCTGGACGAGGCCGATCGTATGCTGGACGAGTACTTCGCC
GAACAGATGAAGGAGATCATCAACTCCTGCTGTAAGACACGTCAGACCATGTTGTTCTCC
GCCACAATGAGCGAGCAGGTCAAAGATCTGGCCGCCGTATCGCTGGACAAGCCCATCAAG
GTGTTCGTCAACAACAACCAGCAAGTGGCCTTCAATCTGCGTCAGGAATTTATTCGCATA
CGTGAGGATAAGGAGGGCGACCGTGAACCCATTCTGGCTAGTTTGATTTGCAGGACGTTC
CATGATCATTGCATGGTATTTGTGCAAACCAAAAAGCAGGCCCATCGACTGCACATTTTA
TTGGGTCTCTTGGGCGTCCGGGCCGGCGAACTGCATGGCAATCTCACCCAGCAACAGCGT
CTGGAGTCCCTCAAGAAGTTCAAGGAGGAGCAGATTGATGTGCTTATCGCCACAGATGTA
GCTGCTCGTGGTCTCGATATTGTGGGCGTAAAAACGGTAATCAACTTTGTGATGCCCATC
ACCACAGAGCACTACATCCATCGAGTGGGTCGTACGGCTCGAGCTGGGCGTGCTGGTATA
TCCGTTTCCCTGGCCGGTGAAAAGGAGCGCAAGATCGTTAAGGACATTATCAAGAATGCG
GAGAGTACCATTAAGAATCGTATTATTCCGCCAGAGATTATTGAAAAATATCGCAACAAA
CTTACAAGCTTGGAGCCAGAGATTCGTAAGTTTATATAAATGTAACATTTTCTTAATTTG
CGGATGTAAATGTATTGTTTTGTAGAAAACATTCTGGACGAAGAGCAGGCTGAACGGCAG
CTAGCCAAAACGGAGCAACAGCTCTCCAAAACGGAGCGAAAGCTGCTGGGACAGACCAAC
GAGCGACGTGGTTGGTTCCAGACGAAACAGCAACGCGAGGCGGAGAAGGATCGCTTAGCG
TTGACAACCGGCGACGAGGATAAAGCATCTGGTGGAAAGGGTAAGGGAAAAACGGCCGGA
AAGCGTAAGCGACCCGAGTACGGAGGCGATGGCGAGGATGGACCACCGGTCAAGGATCTC
GAGGCAAAGCGCAACAAGAAGAAGAAGGAGGAGCCTCGAAAGAAGACACCGGAGCAGCTG
GCCAAAGAGCGAGCCATGAAGGAGATCGAGAAGGTGTCCCTTGTGCGCGCCAAGATGGCC
AAGCTGCGCAAACGTCCGGGCAAACTAGGAGCCGCCACCGAAGTTCACAGAAGCGGTGCC
TCCGACGGCAAACCCAAGCGACGCGGCGGTCAGTCGGCATTTACTAACGACTTGACCGAT
GTAAGTCGTGGCGGAGCTCTGCGTCTAAGGTGAGTAGCTCTTTCTCGCTTTTCGTTGATA
GTTGTTCTAATTTTGTACACCCTTTTCCAGGTCCGAGGCCAATCGGCACAAAAAGATGAC
CAAGATCGCTGCTAAGAAAAAGGCGAGCAGTGTGAAGCTGACAAACAAGGCGGGAAAGAA
TAAGTTCAACAAGGGCAAGAACTTCGGAGGACCTCGTCACGCCAAGAAGGATAAAAAGAA
GTAGAGCTGCAAACTACGCTATGTTAAATCGTATACTTGTAAAATAAAACTTTTTCTTCT
TTAAGGCATTTAATTTTTTTAATTTGCTTTAAACATATGACACCTCAAAACAAAATTGCG
AATCTGCATAATCAGAGTGTTAAACTTTCTAATATAACTGCAAATTTACTATTGCTTAAA
TTAGTTTCGGTTATCTTAATTTAGCTTAGTTTAAAAAGCGCGCCATGATATCGATAAAAA
TCGATTGTGCAAACTTTTTCAGAACCTCGCCTCCCCTCACTAGTTTTGTTTGCCATTTTC
CTCCTTTCGCCTTTTTCCTGAATTTGGCCACAATTGTTGTGTGCTTAAACTGCTAAATTA
GGTTTATATAAGTACCTGTATGATGAGCAACCTTTGCAAATACGGACCGCCCCCAGATTC
CGACTCTGATAGCAGCTACGATGGATTCTACTTCTCGGATAAGGTATGTGTTCCTTGTTC
TGTTCCTTCTGGTGTTCCTTGGGTGACTTGAGTAATTTCTGTATAGGTGAAACGCTCGAA
ACCAGCTCCTTACGTGGATCCCGAGCAAAAGCTCTACGATGCAGTCGTCGCTGGGGATCT
CAAGACGATGCAGGAGGAGATGCGCAAACTCGTCCTCCAAGTGGATCAGCCAGTAAAAGG
TGGTCTTAACTTACTGATGCTCGCCTGTCGCGAGGGCCACTACAAAATAGTTGAATGGCT
GCTGGAAAGGGCAGGGGCCAACGTGAATCGGCAGCTGGATTCCTTGATGCCGCTGATGAT
GGCCTGCAATACCACCCACAAGGATCCGTGCCTGGCGGAGAGAATTGTGGGCCTGCTCTT
GCGGCACGGAGCCGTGATCAATGTTTCGGAAAAATATGGAATGACACCCTTTATGTTCGC
CTGCCAAAATGGCTTTGCCGGCGTTGTGCGTCTGCTTATTAAGGATGCTAGTTTCGATGC
TGTGGATAATCAGGGCTGCACTGCCATCTTTCATGCCATCGAGAAAAATCACGTGGAAGT
GGTCAAGCTGTTGGTGGAGGCGGGCGCGAATGCCACGATAGCCAACAACAAAGGCTACAC
GCCCACCCAGGTGGCGGAGTGCCATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1164, 1223..2047, 2232..2964, 3025..3568, 3630..3885
1072..1164, 1223..2047, 2232..2964, 3025..3568, 3630..3780
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved