Drosophila_melanogaster Locus Hlc
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Hlc
Drosophila_melanogaster
Hlc
X
snoRNA:MeU6-A47
2006..2096
4426
ATCGATAGCTGTGTGCGGTAATAAGCGTTCTTAATTTCGTTGATTGGATACTCTGTATT
AAAAATAAATATATTTAAAAATATTATTTATAACTGCAAAAAAGATTTATATATTTTGAA
AGTTTTATAGGAATATGTTATGTTTATTAATTTTACTTATGTATGTAAATATATCGATAT
GACCTTAATGTCTATCACATTGAGAAAAAAAACATAAGAAATACGAGGAATTTTTACAAT
AGAGCATAACAACCTTAATATGTAACCCGCAAAAGCCGATTGCAAACTTATCAAGTCATA
CGGTAAAATCTCAAAAAAGAACGGTAGCGTTTGTGGCTCCAATTGTTTAGTTATTGGATT
GCAACGGATTTTATTTTCGGTCGATACGGTGAAACCTTATAAATAGGATCTCCGAAAGAA
GAAGCTATAAGTCGGCTTAAACGTATTTTTAAAGAAATTGTCGATTCCCATAGATTCACA
TATCCATTCAGACGGAGGATAAATAAGTCAGAAAAGAGCGAATTATGAGATTTCTCTAAT
AAACTAGAAAAGAAGTTAAGGTGCTATACAATGTTAAGTTAAAATATTTAATTGCTGATT
TTTACACACGTTACTCGTAGAATAAAAGGGTATACTAGATTGTGTAACAGGCAGAAGGAA
GCATTTCCGACTATTTAAAGTATATATATTCTTGATCAGGATTAAGGATTAGGAGCCGAG
TCGATCTAGCCAAACTTTATAAATTTTTTCTAATTTTATTCCCCAATTAGCTATTGATAT
CCCAGAAAAATGATGAAATTTCGCGTTCGCATTCACACTAGCTGAGTAACGGGTATCTAA
TAGTCGGGGAACTCGACTATGGCATTCTCTCTTTTTATTTATTTAATTTAATAAATGGAA
TATATTAAATTTTTTTTAAAGGTATTTGCTTACCTTTAAAAGTAGATTTCAATAACTGTT
TAATTCAACTATCGATAAGCCGATAAAGTCGCCGATAATTCAATGGACCGATGCCTCGCT
CTTTTTCTTGTTGGGCCAGAAAACGTGCGCTGCGCATTTTCCAGCGTTTTTTTTTATACC
GTCGCCCACCATGAGCCAGATGACCCAGAAAACGGTGCAATTCCACGAGCTGGAGCTGGA
TCAGCGCATCCTTAAGGTGAGTGCCCGGCTTGCGACCGACAGTTCCAGATTTTAAAGTGT
TGCGCTCATCTTTCAGGCGGTGGCCCAGCTGGGTTGGCAGCAGCCCACACTTATCCAGTC
GACGGCGATACCGCTGCTTCTGGAGGGCAAGGATGTGGTGGTGCGCGCCCGCACCGGATC
CGGCAAGACTGCCACCTACGCCCTGCCACTGATTCAGAAGATCCTTAACTCCAAACTGAA
CGCCAGCGAGCAGTATGTGAGCGCTGTGGTCCTGGCGCCCACCAAGGAGCTATGCCGGCA
GTCCCGTAAGGTGATCGAGCAGCTGGTCGAGTCCTGCGGCAAGGTTGTACGCGTGGCGGA
CATTGCCGATAGCTCCAACGACACGGTGACCCAGCGGCACGCCTTGTCTGAAAGTCCCGA
CATTGTGGTTGCCACACCCGCCAATTTGCTGGCCTACGCCGAGGCTGGTAGCGTGGTGGA
TCTGAAGCATGTGGAGACCTTGGTGGTGGACGAGGCGGATCTGGTGTTTGCCTATGGCTA
CGAAAAGGACTTCAAGCGGTTGATTAAGCACCTGCCTCCCATCTACCAGGCTGTCCTAGT
CTCCGCTACTCTAACCGACGATGTGGTGCGCATGAAAGGCCTGTGCCTGAACAACCCGGT
TACGCTTAAACTCGAGGAGCCGGAGTTGGTGCCGCAAGATCAGTTGTCGCACCAGCGCAT
TCTGGCTGAGGAAAACGATAAACCGGCTATCTTGTACGCCTTATTGAAGCTGAGACTCAT
ACGCGGCAAGAGCATAATCTTTGTGAACAGCATCGATCGGTGTTACAAGTGAGTAAACCA
TACGAATCCCGCCTTAGATGCACAGGAGCCAATGATGATTAAACCACAAATGCAGGGAGT
GGGCAGCTGGCAACAGTTGGCGCACGCATGACCAGCAACTAATCTTCTCGCTGACGGCAT
TCCCATCCGCCCCTAAATACTTACTATAATTCGTTCTAATTATTACCCATTTAAATGTTT
CAGGGTTCGATTGTTCCTAGAGCAGTTCGGCATCCGTGCCTGTGTCTTGAACTCCGAGCT
GCCTGCCAACATTCGCATCCACACAATTAGCCAGTTCAACAAGGGCACCTACGACATAAT
CATTGCCTCCGACGAACATCATATGGAAAAGCCAGGAGGCAAATCAGCGACTAACCGAAA
ATCTCCTCGAAGCGGCGACATGGAGTCGAGTGCTTCCCGCGGCATTGACTTTCAGTGCGT
GAACAACGTAATCAACTTCGACTTCCCCAGGGATGTCACGTCTTATATCCATCGGGCTGG
CAGGACGGCTAGAGGAAATAACAAGGGCTCCGTCTTGTCCTTTGTCAGCATGAAGGAGTC
CAAGGTAAACGATTCAGTTGAGAAGAAACTGTGCGATAGTTTTGCAGCCCAAGAGGGCGA
ACAGATCATCAAGTGAGTATAGAATAACATCTTCAAAATTGTAATATTGCTAAGTGTGCC
ATCACTTCAGGAACTACCAGTTTAAAATGGAAGAAGTTGAGTCCTTCCGTTATCGTGCTC
AGGATTGCTGGCGGGCCGCAACTCGCGTAGCTGTTCACGACACTCGAATTCGAGAGATAA
AGATAGAGATCCTCAACTGCGAGAAACTAAAGGCATTTTTCGAGGAGAACAAACGCGATC
TGCAAGCGCTTCGGCACGACAAGCCTCTGCGCGCCATCAAGGTACAGAGTCATCTCTCTG
ACATGCCCGAGTACATAGTGCCAAAGGCCCTGAAGCGAGTGGTTGGAACGTCCTCTTCCC
CTGTCGGAGCCTCGGAAGCCAAACAGCCACGACAGTCGGCCGCCAAGGCTGCCTTCGAGC
GGCAGGTCAATGATCCTCTGATGGCTAGCCAGGTGGACTTCGGGAAACGGCGTCCTGCCC
ACCGGAGAAAAAAGAAGGCGTTGTAGGGTAGCAAATGGTATCTATAGTCGCATTAGTCAA
TAAGGAAATAAAGTTAATATTGTTAATGTAAGCCAAACATAAAAGCGGCCGTTGAAGATG
TTTGGAATTTTAAAAATGTTATTTTACCCTAAATTAGAAATGAGTAAAATTAAACGAAAA
ATATACCTATGTTGGAGATAGCTGCAGATTGACAAACCCAGGTTATTTTCTTTATATATA
TGAAAATTCTGTTAATTTAGAATTTTGTAATAGGGCTGTAAAAATAACCAATTGCACATG
CACATTAACAATGTAGTTTGTTAACTCTATCGATGATATATATATATTTATTTGCATGCC
CGCCAAATGTGTATGTTTGTACTTATCCAGCCGATAAGCAAGTAAGTGAATGTCTTTTTA
AACTCAGAAACTTGACAAGTATATGCTTAAAACGGCCGCTGTTCGGGTGGCGGTAAGTGG
TAACCACTTACCCAAATAGAGGCAGAAGGCACTATATCATTTGCTCAACTTTTCTGACAG
CGGACGGAAAATGAAAATAAAAAATATCTACGAGTCAGTCACATTACCCAAAGTGCCAGT
AGTTCCGTAGGTCACAGCGACGATTATGCAGCAGCTGGATACCATTTAAAGTCCATTACA
CCGAGAGTCCCAGGAAAAATAGATCACCATTAGGGGCGAAATATAAGCGATGCATGCGTA
TTCGTTTTTAACATTTTATTATTGTCATTGAAATAGTTAACATTCATACAATTATTTATT
CATTTATTTATAGCGTTTATGCAATACAATAATAATCATGAGGGTAATAATGAAAAACTA
GTCGGTTCGATCTGCGCGGCTTAGTATATGGCCAAGTCTGACTGTCTATATCTGTTGTTG
TCTGAGAAATCGAAACGCGAAATCAGATATGGATATTGAAACGTATTGAAAATAGGGGGA
GAGTTTTTGTAGCGGGCTCTAATCCATCGACTATCATAGTAATGACTTTTATAATATCGC
TCCGTTAAGTGCTAAATTAAACGTAAACATTTAAGTTAATTTAGCATAATCGTAATAAAA
CTCGCTAGGTTTAGGTATAGGTATGCGCGGTTGGCTATCCCAGGCTCCTATGAACAGTAT
TATTTGACTATTTTAGATCGGATGGCCACGAGATGGAGGAACAAATGCTCTGCACACTCC
ATAACTCGCTGCCATTGCTCTATATAAATATATAGTTTATGGTATAACTTAGGGAAAACG
AACATGAAATCACATTGCAAATGAAGAATGGACAACTAACAACTGATAAACTGATACTGA
GGAACAGGCACAATCACGAAGTTAATGAATCTAGACTAAAATGCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1155, 1216..1967, 2163..2591, 2650..3426
1090..1155, 1216..1967, 2163..2591, 2650..3082
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved