Drosophila_melanogaster Locus CG1518
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG1518
Drosophila_melanogaster
CG1518
X
snoRNA:Me28S-U3344a, snoRNA:MeU2-C28, snoRNA:Me28S-U3344b
2756..2834, 3383..3431, 4139..4219
6153
ATATACACATACATAACACATGCATTTTTAAAAGCGTGTTGATGTTCGATTTTTCACCA
TTCTTGCTGCACTTTACACACAAACAAACACTCGCCATCGTTATTATTTAATTACTTTTG
GCGCGGCTTCAATTAAAAAAAAAACAGCAACAACAACGCTGCAAGTAAATACACACACAC
ACAATACATATGCAAATATCTATGTATATATTGCACATAACAAAGCTGCCACTAAAAAAA
ATCAACGATTTGAACTAGCAAATCTCATACACGCAAATAGGAATGGGCTTGCCCATGTAT
TAGTGAGAACAATTTCTTAAATATTTGACACGTGAGTTTTTCATTGTTTTAGGTACAAAT
TTTTCTTCTATTTACCAGCAGAAGTCAACTTGTATTTACTCCGATTCGCGTTTTTTCGGG
GATTTGGTTCTCGTTTCGATTGAAAATACATATATTTCGGATATGTGATAACTATCAGTA
GTTTTTCAGTGGAAACCGTGATTTTCCTGCCCGGCGATTCATCCGATGTTTTCTTGTCAT
ATTTTGTTCGAGATTTTTTTAAAAGGCAATGAAAACACGAAGCAGCGGTGCTTTTATATG
GGAAATATATGGCAATTTAAACGGCTGTAGCTCGCTCTCTCTCGCCCTCTCTCTCACTCG
CTCTCCCGCAATGAAAACGAATTTCGTGGTGCACAGTGGTCGCAATTGCATACTAGCTGA
CAACTTTTTAAGATTGTTTACATTTCCTTGATTTATCTGAAAATTGTTACATTTTTCTTT
TTTATTTGTGCTTACGGTTGCTTTGGCGTAGTTGACATCTTTGGTCTAAACGTATTTAGA
CAACTTTTGGTAACTTTCTAAAAAATAATAATCGTACCCCACTGTGTGGTGGTTGAAATG
TGTTTTTCGCTCTCTGCTCACTACTCGTGCTCGCTCCCACGGAGAGTCGAAAACAGCTGG
GATATAAGCCCAGGAACAGCCGGTTATGAATTGCCGATTCGAATACCAGCCGTGCTTTTG
ATGACTCACTAATAGTAACTAATCATAAATCGAGAATTAACTGCCGAATAAACCGCAAAT
AGCAGCCAAAAGAAGTGGTTAAAAGGGAAACAATAAAACCCGCCAGCGGTCAGAGTTGTC
ACCCCTATTACCGATAGACCGGCGATAGCACGCGATAATCGATAGCACTCTCCGCTCTTT
GCCACGAATTGCAAGTTTGCGATCCCGTCGCATTCAAGTTTCAGCCATTGTTTTGTGCAA
AAAGCTAAGTAATAGTGCTTCGGTGGGGCAAAACAAGTAATCCTGGACATCCGGAATTCA
GTCAACAACTCGCACCGGTGACTTAGGGACTCTTGCATCGAATTAAGCAGCGCCGAAAAA
AAGCCGGCAGGCGGAAGAGCAAGGAAAATGACGCTGGACGTGGGCGGCGTCGCCAGGGGA
CTGCTCACCTGGGACAAACAGGAGCACCTGGTCAAGCTGGCCATTCTCATCCTGGCAGCG
GTTTTATGTGAGTAAACAGCGCTTATTCGGCATTAGCCGAGTGGGCGTTGTGAAAAGGTC
AAACATTCGCATCTGCTGCGAGCTTCTTCGCTATCGATAGCTTGATGTGCCGCCGGCACT
TTATGGTGAAATTACCCAGAGCATATAATGGCTTAGTTACGCAATGCAGCACTATTATTC
CTTATTTCCTAGCTTATAAATTCCTTGATTTGCATTTGAACAAATGCATAGCTATAAACA
TCTTCCGATTGCCATGTTGTAGAATATCAACTTGCCAGCCCTGCTAGAATATCGATAGCT
TGATACACGCTGGCATGTGCCATCACTAGCTGCTGGTCTTCCTCTTGCCATCGCCGATTA
AACTTCCTTTTCCTCTTGCATTTCTGGACAGCATTTGCCACACGCTTGTTCTCTGTGCTG
CGATTCGAAAGCGTAATCCATGAGTTCGATCCGTACTTCAACTACCGCACCACGCGGTTT
CTGGCGGAGCAGGGCTTTTACAAGTTCCACAACTGGTTCGATGACCGCGCCTGGTATCCC
CTGGGCCGCATCATCGGCGGCACCATCTATCCCGGGCTGATGCTCACCTCGGCGGCCCTG
TACCGCCTGATGTGGCTGCTCAATGTGACCATCGACATACGGAACGTGTGCGTCTTCCTG
GCGCCCTTCTTCTCCTCGCTGACCACGCTGGTGACCTACGCCCTCACAAAGGAGATACAC
GTAAGCCACCGTCCCACCGTTCTTTACTTTTTTTTTTATATCCTTTCGAGGTTAAAATTC
GCACGTGGTTCTTATGATCCCCCTTTACCCCTTTTTAGAGCACTGGAGCTGGACTGGTGG
CCGCCGCTTTGATATCCATCGTTCCCGGGTATATCTCTCGATCCGTGGCGGGATCGTACG
ACAATGAAGGCATCGCCATTTTCTGCATGCTCTTCACCTACTATTTGTGGATCAAGGCGG
TAAAGACGGGCACGATCTTTTGGTCGGCTATGTCGGCATTGGCCTACTTCTATATGGTCT
CCTCGTGGGGTGGCTATGTCTTCCTGATTAACCTAATCCCGCTGCACGTGCTGGCGCTGA
TGATCACCGGACGTTTCTCGCACAGGATCTACATAGCATACAGCACGCTATACTGCGTCG
GCACCATTCTGTCGATGCAGATCTCGTTTGTGGGATTCCAACCCATCCAGAGCTCCGAAC
ACATGCTGGTGAGTGTAACTACTTTGTGTAATGCTGTGCAGTGTAGCGATGTGTGATCTG
TTGTGATGAATACATTTTAAATTCTTGATAGGAAGAGTATGAAACATAATGAGTACCAAA
AACCTAGCTGAATTGGTCACTAAAAGAACTCTAATTAAAGAATTACTCGCTATATCGAAA
AGAAGGGAGTGTAAATCGTATTTTTCTCTTGCAGGCACTGGGAACCTTTGGCCTGTGCCA
GATTCACGCTTTCGTCGACTATCTGCGCTCGCGCATTCCCAAGGATCACTTCGATCTGCT
CTTCAAGACGTTGGTTTCCAGTGTTTTGACTGTGGTGTTCGTCGTGGGTACCCTGCTCAC
GCTTACCGGGAAAGTCTCCCCCTGGACCGGCAGATTTTACTCGCTACTAGATCCATCCTA
TGCCAAGAATCACATTCCAATCATCGCCTCCGTATCGGAGCATCAGCCTACATCCTGGTC
GTCTTTCTATTTTGATCTGCAGGTAGGTAAACCACTATCTTCGTAGGAATCTGTAGATGT
GCTCTCAACTTAACAGTGTCGTCTTATCATATCTATTTTTGTTTAATAAATCCTTACTAC
AACAAAATTCGGTTTATTTTAAACCTATCCTAATTACACATGTTCTGCCGAGGATGAGAA
CTTAACAACGATGCGAATGATATGCGCCTTAATGCATTGAGTGATTACCTTGCACTTTGA
TCGCTGAGGCAGTTAAATAAACATGACCCCTTTTCACATAACAATCCAATATATAGTTAA
TTCATTGGCTTTTTTTCAAATTTCTTTTGCAGATCCTGGTCTTCCTCTTTCCCGCTGGCC
TTTATTTCTGCTTTTCCAAGCTGACGGACTCGAACATCTTTATTATTTTGTATGGCGTCA
CCAGTATTTATTTCGCCGGAGTGATGGTGCGTCTAATGCTGGTCCTGGCGCCCGTGATGT
GTGTGCTATCCGGAATTGCCATTTCGCATCTGCTGGCCAAGTATATCAAGAGCGTTGATG
CCGGAAGCTCATCGAAGCAGGGAGTAGAAAGCAAGCGGCAGCACAAGAAGCTGGAACAGC
AGACGGGAGGCGTGAAGAGCGAGGTGGCCATTGGATTCGTGGGTGTCATCACTCTGATGC
TTATAGTGTACACGCTGCACTGCACCTGGGTCACCTCGGAGGCCTACTCCTCGCCCAGTA
TTGTGTTGAGTGCCAGGTCGCACGATGGCGGCCGCATCATTTTCGATGACTTCCGCGAGG
CCTACTACTGGCTGCAGATGAACACTCCGGAGGTGAATATGAAGTTTTGATTGCCCATTT
GTCGAGTGCTCTGCCGAGTTAGCCATAGAAAATCAGAAACAGATTGTCGTAATGGAATAA
TTGTGGGCTTTTAAGATCGGAATTTTCATCTGGCTAAGTCGGCAACACAAGAGTTTCGCA
TCTTAATGATGACTACATTGTAAATTCTTGATAGGAAGAGTATGAAACATAATGAGTACT
AAAACAACCAAGCTGACAAAACAGAATATCCCTTTTAGTTTGCAAACTTTTGTTAAATGC
TCGCACTGACCGTTTCGTAATGTATTTTTCAGGACGCTCGCATAATGTCCTGGTGGGACT
ACGGCTACCAGATAACGGCCATGGCCAATCGGACGATATTGGTGGATAACAATACTTGGA
ACAACACACATATATCGCGCGTTGGCCAGGCGATGGCCTCTTCGGAGGAGAAAGCCTACG
AGATAATGAGGGAACTGGATGTGGACTACGTTCTCGTGATTTTCGGAGGGCTCACTGGCT
ACTCATCGGACGATATCAACAAGTTCCTGTGGATGGTGCGCATTGGCGGCAGCACGGATC
GTGGTGCGCACATCCGCGAAAAGGACTACTATGCGGCCAACGGAGAGTTCCGAGTGGACA
AGGAGGGCTCACCCACACTGCTCAATTGTTTGATGTACAAGATGTGCTACTATCGCTTTG
GGCAAATGTACACGGAAGGTGGCAAAGCCCAGGGCTACGATCGAGTTCGTGCCGCCGAGA
TCGGCAACAAGGACTTTGAACTGGATGTCATGGAGGAGGCGTACACCACGGAGCACTGGC
TGGTGCGCATCTACAAGGTTAAGGATCTGCCGAATCGTGGAGTCTGAGAAATAAGTGTCG
CAGTCATTCCGCTCTATTCTGTGTTCTGTACATTAGCTAACTCTGCCCGTCTCCCTCTAT
CTCGAATATTTGGCAATCTCTCTCGCTCTATGAGCACCAATTGCTGCATTCTCCTGCTTT
GCCCATCATGCATTTAGTTCTACACTGGCACAAAACCACAAAAACCAAGTATTTTTTTTG
TTTTTATATTTTTACAAATGTCTCAAGTGTACCAGATGCGTCTGGCTTCTTAAGCAAGAA
AGGAGCATGTAAGCGAATCGAACGAAATATATATATGTGGAGAAAAACTATCATAATCAT
TGAAGTTTTATTGGCGTTGCAAGTGGGGAGCACAGTTCACGTAGTAACGAATTCACATAG
TATCTACTCGTACAAAACTAAATAAAAATAAATGCGATAAAAGTAATTATATAAACGAAT
TGTAACTTTTTGTTAAAAGAGAATTAAAAGAAATTAAGAGAATTAAAGAAATTAAAAGAA
ACTTATTGCATTGCCACTGGCTTGAAGGAATCATCTCGAGAGCTATAAGAGCTGGTGATT
TGGAATATTAGTTAATTTCAAACTGTTCTGACATTTTTATGTTAAATTTCTACTTATTGA
AGTTGCAAATACTTACCATAGTACATGTAGAATTGTATACTTACTTGCATTTATAAACTA
ATACAAAATTCTTTCAAAAGATGTCTCCTAAGGATAACCGAATAATATATTAGTATTTTC
GGGAAAGCTAACAATAAAATCTTCAGTGGATAGATATTTTCCTTGAACAGCTTATAAGAA
AGTTAATATCTTACACAGATATAAAGATTGTATATACAGTATAAAATTCTTTTGCGTAAT
AATGGGTTGGTTAATCTATAAGTTTTTACAAATAAGCTTTTTATGGCCAGGAGAGAATGC
GTCAGGTAGCAAATTAGATAAATTAAATACGAATTAAAACGAAAATCCCAGAGACCTTTA
GCCCTTTAAGCATTTTTTAACTTCGACGTTTACAGACTATATGTATTTATAATTAATTTA
ATTATAAATATCAAAAGTTTAAAATACTTTTAATACAATCGTTCAGCAACGTAGGATGTT
TCTTCAGTTCAGTTCTAGCCATATCATACCATTTTGGACATATAAATACATATGTATAAC
AAAGCGTGAAATCGATACTTTGATACTTTAGGATAAAACTTTATTTGATATAATCAAAAT
GCATGCGGGTATAAGTTAAAAATGCGTAACATAGTCTGTAGGTGGTTGGATTTTTAGGAC
ACAGATCAGGAACTGGAGAACGCTCCAGTTTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1506, 1891..2219, 2318..2707, 2914..3201, 3512..3991, 4292..5153
1407..1506, 1891..2219, 2318..2707, 2914..3201, 3512..3991, 4292..4843
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved