Drosophila_melanogaster Locus RpS5a
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpS5a
Drosophila_melanogaster
RpS5a
X
snoRNA:Psi28S-1135a, snoRNA:Psi28S-1135b, snoRNA:Psi28S-1135c, snoRNA:Psi28S-1135d, snoRNA:Psi18S-1854a, snoRNA:Psi28S-1135e, snoRNA:Psi18S-1854b, snoRNA:Psi28S-1135f, snoRNA:Psi18S-1854c, snoRNA:Psi28S-2876, snoRNA:Psi28S-1192a, snoRNA:Psi28S-1192b, snoRNA:Psi28S-1192c, snoRNA:Psi28S-1192d
2496..2643, 2710..2854, 2865..3007, 3040..3181, 3214..3352, 3375..3525, 3560..3698, 3721..3871, 3906..4045, 4285..4424, 4681..4820, 4835..4972, 5015..5148, 5187..5321
6668
CGAAATGAATTTCCTGCCGGCGCTTTATCCAATTTCCCCCGAATTTTCTTTGTTTTTCG
CGACTGTCTTACCGACGAGTGGAGGGCGGGGGACTGGCTGAACGTCCACGGCGAACCATT
TTGTTTGTTTTATTTGTTTTTCTATTGATTCGGTTTCACGCAAGAATTTTATTCTCAACA
GTTGTTGCTGTTTTGATGACGAGCTAGTAACTGAAATTCCGAAATAATCCCAATTGGACG
AGAAACTTCGGCCTGCTGCCAGTGTGGCCGGAGAAAATACCGAAAAATACTAAGGCATAA
GGTGTAAACTATCGGATATAGAATGTGCCAGAAAAGTTAATAATATGGGTAAATTCTTAT
GATTAAAAATATATTTTACTAAAGTATTTGGATATTGTATTCGTGTAAAAACGTTTTACC
ACCCTTAAATTTACTATGTAATATAGTAAAATTTTTGTGTATTTTATATATCCCATATAT
ATAATCTTTACATACCACATATTTTTTTCCACTTACAAAATCAAATAAAGAACTATATGT
TATAAATATATATGCATTACGATTTAAATAACTTTTTATTTTACAGTCAGTGAAATAATA
ACATTTAATACTCAAGCATATCAAAATTTCTATAAGGTGACCGTAATAAAGAAAATTTGG
CATGCGAATTTCAACTATCGCCACCCGTTGTGACTGGCAAAACCGCGAAATGCCGCATAT
CGATAGAAAGTTCGAAATTTGTCATTAAAAAAGTGGCTTAAAACTAATAGTATGCCTGAA
AGCAGGGTATATTTCTATGAAGTACATATAAATGTGCAACTCAAGTAGCAAACGCGTTCG
AAAAAGTGATTAAGTCGAGGAATAATCCCCACTCATGGCCGCCTATCTCCGTTCGATAGT
TCACTTGTTGCGCAGCCCTGGCAGCCGGAATGCAACCGTGTGCGTGTCGGCGGAAGCGGA
CTCTCTGGCGTTGCTGCACACTGCCGTAACATGTTCTTTTTCAGGCGTTTGCCTTTGCGC
TGACATCGTATCTCGATTTCTTCTGTGACAAAGTAAGGGATTTTCAACGTTTAATTGTGT
GGATTGTGGCCAGAGGATGGCCAAAAGACGGCTAAACGCTGGCAACTAGTGTGGATACTA
AGGGTTTTGTGAATTTACTGCGGCAAACTGCGGAATATTGCCATTTCCACCGAAATGAGG
TTAAAAACGGGCGGCTTTTTGTTTGTGTGTGTGCGCGCGAGTGCAACTGTGTGTGTGCGT
CACACGTGTTTGTTTCCCCTTTTTTTTTGTATATTTTTTTTATCTGCTTGCAGCGCAAGA
ATATGTTTAATACAATATACATCCACGTATATTGAGCCAATTATCCAAAAGGATAACCTT
CAAGAAAGTATAAACCCTTAAAAACTCGCAATTCAACAACAACAACGCGCGTGTGTTTTT
TACGGTGCTTATGCGTGTGTGTGTGTGCGTATAGCGCCCATCTACAGTTTAAAAAAAACG
TGTTAACGCAGGAAAACTACTTAAATATGTATTTAAAAGTTATTGTGACCCTTTTTGTAT
ACTTAAACGTAATCTTCACTGAAACTTCCGTCTTTCATAAACCTTGGAACTTTTTTTGTA
GTTTATTTTTGTTTTAAGACGTTTTTAAGATTTAAAAACGAATGTTAAGGCTCTAAAAAT
TATTCGTATCAGTTTATCACAGCCTTTTCTTGGGTTTTGTATTTGTAAAAGAATTTTTCA
AACGAAATCTAGTTAAAGTTATAAACAATTTGTATGTGTATAAAATTTGTACAAAAGGGA
CGATGTTTCCATAAACAAATACTGAAAAACACGTTTCTGTAAAACTTCTAGGTGATGTTC
AAGCCATACAATGATGTTCAATAATAGAAGTTAGCTTATTAAAATCAACGAACAAATACC
ATTAACCAACCATTAATGAATGTCTGTGATAGTAATAGATCGCAAAGCCCTCAAGTATCC
CATCCCACAGTAGAATTACCAATACCGATTTGCAGACACGTGACTAACTTATTTGCCTTC
CAAAAACTATTGCAGCATGGCCGAAGTTGCTGAAAACGTGGTGGAGACCTTCGAGGAGCC
AGCGGCACCTATGGAAGCCGAGGTGGCCGAGACGATCCTGGAGACAAATGTGGTGTCCAC
CACTGAGCTGCCGGAGATCAAGCTGTTCGGCCGCTGGTCTTGCGACGATGTCACCGTTAA
CGACATCTCTCTGCAGGATTACATCTCGGTGAAGGAGAAGTTTGCCCGCTATCTTCCCCA
TTCCGCCGGACGTTATGCCGCCAAGCGTTTCCGCAAGGCCCAGTGCCCCATTGTGGAGCG
TTTGACCTGCTCCCTGATGATGAAGGGTCGCAACAACGGCAAGAAGCTGATGGCCTGCCG
CATCGTCAAGCACTCGTTCGAGATCATTCATCTGCTCACCGGGGAGAACCCTCTGCAGGT
AAACATGCCCATCCCGTCCAAATGTTCCCAATTCCACCGCGTCCCATGCTAAACTGTGGC
CAGAGAACGTTGCCACTCGGTCATGGGTAGAATGGGCACGCAGAGCGAACACAAGGTTTT
AATGTCCTAGTGCTTGAAGATATCAAAGCCTCTTCTTGTTCTCCGGGAACTTAAAACCAC
ATTACAAAACCATTATAAAGCATATGCGGTACCTTGGTTTAAACTGATTTAAAGGGAATC
TTCACTGATTTCTAGTCCTCCTCAATGCTGGCTATGTTCTACATACTTTCCGAAGCATAA
CTCTCAAAGGGACTAATAGTGAACCAAAGATTTAATTATCCTAGTGCTAGAATAGAAAGC
AAATTCTGGTTCTCCTGGAACTTAAAGCTACAATAGTATTATAGAGGAGTCCTCCTCAAT
GCCAGTTGATGGTAATTTTCAGCCGAACTGAGCATAACTCTTAATGGACTCATAGGAAAA
GGTATTAACTATCCTTGTGCTTGAAGATAAAACCACTTCCCGCTCTCCTGGAACTTAATT
CGACATTTAAGACAATAGCATATTAGTGGATCTTTCACAATGAGTCTACCTCAATGCTAG
TTGAAGGAAATTCCATCCCAGCTAAGGCATATATTAAATAGACTCAGAGGAATAAGTGTT
AATTATCCTAGTGCTTGAAGATTAAGCCACTTCCCGCTCTCCTGGAATTTAAGACTACAT
TAGAAAGAAAGCATTCATTACAGAGATCAGTGTCCGTCCAAAACTAAAACTGCAGCGTTG
ATCTCTGCAGCGTTGTGGCATTCAATTGGACCACAGGAAATCCCATGGTTAGCTATTCCT
CTTAAGGGCATGGCCTCAAAAATGCAATCTTAATAAAGCATAAATCAACAAAATCCTATT
CTCAGAAACCGCGTGTCAGTCCACCTCAATGCCAGATGGCTTAAAAATACGATGCCATAC
TGAGCATAACCAAAAATGGACTAATATCAATTGAAATTGTTTTAACTATCCTTGTGCTTG
AAGATATAAGCCACTTCCTGCTCTCCTGGAAATTAAAACAACACTAAAGTTAAGCATTAT
TCACCAAGGGTATCATTATCCGTCCAAAACTAAAACTGCAGCGTTGATCCTTACAGGGTT
GTGGTATTCAACTGGACCATAATAAACCCCATGATTAGCTATTCCTCTTAAGGGCATGGC
CTCAAAAATGCAACCTTAATAAAGCATAAATCAACAAAAACCTATTCTCAGAAACCGCGT
GTCAGTCCACCTCAATGCCAGATGGCTTAAAAATACGATGCCATACTGAGCATAACCAAA
AATGGACTAATATCAATTGAAATTGTTTTAACTATCCTTGTGCCTGAAGATATAAGCCAC
TTCCTGCTCTCCTGGAAATTAAAACAACACTAAAGTTAAGCATTATTCACCAAGGGTATC
ATTATCCGTCCAAAACTAAAACTGCAGCGTTGATCCCTACAGCGTTGTGGTATTCAATTG
GACCACAATAAACCCCATGATTAGCTATTCCTCTTAAGGGCATGGCCTCAAAAATGCAAC
CTTAATAAAGCAATAAATCAACAGCAAAAATTCTACTTTGGTGCTTCGAGTGGATCAAGT
GATAGCTTACTCATTTCGATTTTTTTTTGTGACCTCTTTGCAGATCCTGGTCAGCGCCAT
CATCAACTCGGGACCCCGTGAGGACTCCACCCGTATTGGACGTGCCGGTACCGTCCGTCG
CCAGGCCGTCGATGTGTCGCCCCTGCGTCGCGTCAACCAGGTGGGTTTCTTCTGAAGATT
TGCCTTCCAGATGCATGTGCTCACGGTGGCCGGTAGCAATGGCTTGTGGTTCGTTTAGAG
ACTGCTTGCTTATAACACTTGGCCAGAACGAAAATCTATCTAATATCCGTAGCGTCATAA
TGTGTAGTATAGCCGACATTTGGCGTATGAAACGAAGAGACATTATCAATTGCATAACAC
ACTTTCATTTTACTAACGATAAGAACCCCAAATTCTTACGCTGCTGTGATTGCGTTCATA
AAGTTACTTAATTAATTTTTTTCCGTATATTTCCTTTAGGCTATCTGGCTGCTGTGCACT
GGAGCTCGTGAGGCTGCCTTCAGGAACATCAAGACCATCGCCGAGTGCCTGGCTGATGAG
CTGATCAACGCTGCTAAGGTGGGTAAATTGGGCTTGTGGCGAGATCAAAGTGGGAATGGG
GTGGTCTACTCTAATGCTTGGCATTGTACTACCAAAATGCCTGGCCTCGCTTGTAGACCA
GATCGAGAACCACGTTCGGCACTCGGATTAACCCAAGAATTGAGCTTCGAAATAGCTCTT
TTCTTCCTTCTAGTGACACAGCTAGTCATTTCAACTAGTCCAATCTAATTCTGCATCATG
GTTTATTTATGTAGTCTCGCTTTTGGACCAGATCAAACTCCAAATCTCTTATTATCCTTG
TGCTAGTGACCACTTAACTGTCCTATGCACACGAGAAACGTAAAAGAACACTTTTATGAA
TTAGCATTTAGGAACTGATTCGATTAGGATAGCGGGGGTCCAATCTAATTCTGCATAGTG
GTTTAATTATGTAGTCTCGCTTTTGGACCAGAACAATCACCATCCTTTATTATCCTTGTG
CTTGTGACAATATCAGTCTAATGCACACGAGAAACGTAAAAGAACATTAGCAAACTATTT
AAGAGTTGGTATATAGAGCTTAATAATAGGTCCAATCTAATTCTGCATGGTGGTTTAATT
ATGTAGTCTCGCTTTTGGACCAGATTAATTTCCATCCTTTATTATCCTTGTGCTTGTAAT
ATTGCTTAGTTCAATGCACATGAGAAACGTAAAGGAACACTAGCTTTAAATAAGTTAGGG
ACTTGTTTTTTTATATTTATTTATTTAGAAGCGATGAATCCATACAATGCAGTAACAGTA
ACATAACAGCGCAATTAACATATAAAAGATCTAGAAAAACATTGATAGCCAATACTAATA
ACTTGTGTTTAAATGTATTTCCAGGGATCTTCCAACTCGTACGCCATCAAGAAGAAGGAT
GAGTTGGAGCGTGTCGCCAAGTCCAACCGTTAAGGAGACATCATCACCAGCAAAAACAAA
CTTCTGTCTGTTTTTTTTTATACAAATAACGTGTGTACACTGAGAAATGATACACTAAAA
CTAAAATAAACAACAAGATGAAAAATTCACTTCAGACCATTCTTTTTTTATAGTTTTTAG
TTTATAATAAACTTGGTTGTCAGAGAAGAACGGATATTTTAGCTATTTTCTATCGGGCTG
CTGGTGTCAGAAATATGTGAGGTTAAGCGTGAGTAAAACGTGAAATTGTCTTGCTTGGAA
TAGCTAAAAATATTGAAATGAAATTTAGCTAAAAAATTAAAGTAAATTACATGGTTTAAA
CAAATTGAAACTTTAAAAAGTTTTTTTTATCGATATTGATACAATTTCTTTCATAGATAT
TTCTCTAACTACTCACGATAGATCACTAAAATACGGTTTTTTTAGTGTATAAAATCTATA
GATAGTTGCGATACTCCATCGATCTGGCATCACTTTTCTAAAATAAATGTATTGGAAAGC
TGGCAACAGTTTACAATACTCCGATTGTTTTAAGCCCTTAAATTCTACATTTATATATTC
TATTCTTCGCTTTTGAAGAACTCTATGCCAAAGCAACAAAAGATCCATTTATTGTAGGAG
GCTAGTCATTAGTCATTTAACGACATTTAAAATCTAAGTCACACATTACCCGATCGAAAA
ACTTCAGTATCGATTTAAATCAGGGCTCGATAGGTACACTTCATATCGCAATCGGTTTTA
ATTCCAATTTTTCCTTAGTCAAACACTTCATTTTAAAATTCTTTGGTAGTAGGTCGGATT
GAAATAAGTTCACATTTCTGGATTAGTGTATAATGTTCACAGTGGATGCAAGCGAAGGAT
CATCAGTTGTAAACGAGACTCCATTAAAAAGCCAGTAAGTGCACGGTAATCCTGGTTAAA
AAACAGGGCGCATTTATTTTCGCAGGCTCCTAAAGACATAAAACACGAAATGCTAATATA
CAATACAGATTCCACGATCAGAAGTTGGTTGAGCACTTTTGCCGGCAGACGCAGCTGCTC
AAGCTGGTCCAGGTCTCCTCTGGCCGCTTTGTGGCGAACTATATGAGCTCCCGGCGGCCA
GAGGACCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 2055..2457, 4123..4239, 4539..4637, 5484..5668
2056..2457, 4123..4239, 4539..4637, 5484..5549
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved