Drosophila_melanogaster Locus CG2556
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG2556
Drosophila_melanogaster
CG2556
X
snoRNA:Me18S-G894
1541..1648
21387
ATGCTCCACGACCGATTACTTTGGGACTCCAGATCCGTTATTTCTCCCTCGTTCTTATC
CTTTTCCATTTCCCCCTCATGCTGAGATATTGGACTCCTTCGTCTCCTGCCGGTGTAACC
AATTCCCACATTATAATAACTGCAGTTGTAGCCCAAGCCAGTCTTCCCTCCACACGAATC
ATCGCCCTGGGGGACATGAATATAGCAATCCTGCCAGATATCTTCCTCCGATCCGGGATA
GTGGTCACCATATGCGTTCGTCGATTGCGCTCCCGCGTATTCAAATTTGGGGACCGGCAG
CCATTCACTGATGTGTCGCAGCTTCAGTTCCAATTGCAGATCTCCTATGTTTCCGCTCAC
GCGATAAACTCCAGTGCGCTTTATGTCTCTGCTTTTTTGCATGATTCGCCGATGATTATT
TTGCCCAGTAAATTTTTAGTTTCTTTATTCAAACCTCAAAGAATGTAAATGACTGGCCTT
CTTTGTTTGTTTTCCATTTTGTTATGTTTTGTTTATGGTTTTTGAATTACCGTTGCCCAG
GTAACCAATCGATTATATACCGAAAACCAACTATTGTTGCCGTGACAACCATGAAGGCCG
ATAACTGTCTTTGAAATATGATAGCTAGAAAATAGCCGAAATTATATTAGCTGCTCAATA
AGATTTTTATAAATTTAAATTGTACAAACTGTAATTTATTCATTTATTTTATTATAGCCA
CAAATACAATGTCAATTAGATTGGAAATAATAAACATACATTACACAGCTAGCACTGAAC
ATTTTTAAGTTGTATATTTTTTATTTAATAACTTACAAATAATAATTAATGCTTTGTTTC
CAAACGAAATAATTCAGAATGGTGAATGGATTCAAATCCAATTTCAAGCGAGATAGCTAA
ATCTAGCTAGATAGCTGCACTGTCGCCAGCCCTGGAACATACCAACTCCGCTTCGGTATA
TTCGATAGGCTTATCGATTGCTCGCGAAGCTTTGCCGCTGTGTTTGTGTTATCGTCGGCC
GCTTTATGCACTCCACATTCCTCGTTTCATTTTGGCCGCCAGTTGTGTTTTCGATTGCTC
TGCGTGCTGGTCGTTCCTCCAAGTCTGCAATTCTGCACAATTTTACAATTATTCTTCGCG
CGTACTCCAACTCCCCATTCATCCGTCTGTTTGTTTGGTTGTTTCCTTTCTTCGTTGCAC
CTTTTGCGCGCGCGCAACCGCCGATAAACAGAGAAAAGAAGAAAAGGAGAAATTCTGCAA
CAAACACTGGAAGTGCAATTTTAAGTAGACGATCCCGTGAATGTTTTCCAGTTGAAACAT
TTACTATCGTTTCATTTTTTTTTTAAATTTTGTTCTGTTAAGTGTTGAAAAAAAAGTTTT
TGCAGCCACAGCAAACTAAAACTTTTCATCAAAATGCAGCAGAAAGTCGAAGAGGTTAGT
AAATAATAAAAACATAATAATAAGTTAATAATATCTAAGATCTTGGTGTATATGAAATCA
AGACAGACTGTTGAAAATACATGCTATGTTTGTTTGTTCTTCACCAAATGAAGAAAGTTT
TAGGTAATTTCAGAAGCATTAAAAAGACATTAAGTAGGAACCTAAAAGTAAGCAAAAACT
AGTGCATTTTATATTTCATTACTGAGGAAAAGTCTTATTACATATATTCGTTAATGTTAA
ACAATAACATTTTACGATTATAGTTTACGAAATAATCGTTAATTTCCAGCAGATGATTAC
ATTAGATTTGCAGTTTATGAAGTTGTTCTTGTATTTTCTCTTACTTTTTTTTTTTGGTTT
TTGATTTTACTCCACCCATTACCCATTCTCCTATCTCCTTTGCTTCCCTGCATTCTCCTG
TATTTCATTGAACTTAGTACGCCCCCGATGCTGCGCTGCTTCTGCTGGCGTCGCTGCCGG
CGTCGCTGTCGCTGCTCTGCCGTGACGTTCCATTGACTGATTTTCCCGACTTTCCGCAGA
AAAAAAAGAGAAAAAAAAGAGAAAAAAAAAAACGAACAACAATAATGCTTTGGCCACAAT
TGTAAAATGGTTTTGTTTGGTTTTTCATTTACATGTTGTTCTTGTTTTGTTTTTCTTCTT
CTGTTGCCCACAGGTGTGCATGTGTGTGTGTCCCCCATTGTTGTTGTTATTGTTGCTGGC
GCTTTATTTGCACAGTTGGCCGCTGTTTTTTTTTTGCGTGTGTTTTATTGTGTTTAATAT
ATTTTTGGACCCGTCTTGATCTTTTTTCTTGAGGGCCAAAACCAAAGTCATGGTAAGAGC
TGTGAAATTTGTGATCGCCATTGTTTTGGTCTACAATTCTCGTGGTGCTCCTCCTTCTCT
TTCTCTGGCTGTCTTTCTTCGCTTCCTTCTCTTGTCCACCTCTTTCGACGATGGAGAATT
TAGGCCTTAAGTCCAAAAGTGTGCCACAAATGTCATTTTCGATAAGAAATCTCTTTTAAA
ATCATCCACATCATGACACACAAAAATTTAATATATAATATAGATCTGCAGACCAGCACA
GAGTTGAACTAAAAAACTGCAAATGACACAGAATTTAGTATCAATTTGAAAAATTATAAA
GTTGACCGGTAGTAAGAATTTGACTAATAACTTTATTATTTGGTTGCATTATATTCAAAA
TCTTCAAAAATAAAATTACGCTATGTTTAAAAGCTTTAAAATCCATATAAAGACAGTCTA
TAAACAACGCATGTTTTTCAATGTATAGCTGTCAAAAATATGAAATATGGTTACCTTTAA
GAAGTGCCATAACAGCTGTTTAAGCAGCTTACTTAACAGCCCAGAACCCCCCACAAAAAA
AAAAAAAACAGAATGTTTCATATTGAAAACCTAAACGAGATGAGACACGGAACCGCAGAG
CCAGAAAAATGCCTTTTTCGGCCCGGCCAATGCCAGTTGCAAGTAAAAGTCGAAAAACCT
GTAGACACAAGACATCGCAGAGGGGACCATTGAGCCAGATGACTGTCCATGACCCAAATA
AAATGCCTCGAGAATCGCAATGAACATGTCGACAAATGATCGAGATGGGTGAAGGGGGGC
GGCCGATGCAAGGGGGAGAGGGGCGGTGAACGGGGGCAGTGGGAGCTCCATGGTCAAGTG
ATTGAGACTGGCCGATTGGCCATGGCAGCGGATTGAGCTCGAGGATCTCCATCTAACCGA
TGGATGCGATTCGATTCAGGCCAAGCTGAAGATCTCCACTCCATCACCAGCCGAAAGCAA
AAATCTAAAATCCGTTAAAAGACGACTCCAATTCCTGATTATCTTCAATACACTCAGTTT
TACAATAGATATTTGCATCTTTACTATTGAAAGTTCAGTTAAGAACGAATAAAGATTCGA
ATAAACGAATAAGTAATAGGTAACCAAAGAGAGGATCTTGTAATCTTATAATTGAAATCT
ACCTAACGAATATATTAATTAATATATAGTCAAAAATGTATATACGAACAAGCTGGCTTA
CTCCTTCTTTAACCATAAATTTCTTAATAATTGCCTTTTGACCGAACATCTCCATTTGTT
TTCCCCCTCATTTTCTTGAAAAAAAAAAAAACTTTTTCCCAATATGAGTAGAAGAAAAAG
CCCCAAAAACCGGTTAGAATTTGATGCATCATTTCTGGTCGTTGCTGGTCTATTAAAATT
TCGCTTTTTTTGCGCATTGCGGACGCAGACGGCGGTAGTAAGATTTTCACGTCGATTTTT
CCCGTTTGCCAATTGAAAGTAAAAATGCCCGAAAACCGGTCAGCCAAATAACGAAAAACC
GTGAGATCCTGACAGCAACTTTATGATAAATGCCTAATGAATGTTTTAATGCAGCTTCGC
AGTCAATACAAAGTTTGTAATAGAAAATGGAAATTACCCAAGTCGAAAAACATAAAGATA
ATGACTGAGGGGCGAGGAGAAAAGATGAGATGGGCTAACTGCTCTTTTCAAAATTATCCA
AAGTGGCTAGAAGAAAATTGGTCTAGTGGACAGAAGGCAGAAGGCGTATCGGAATGAAAT
GCAAAGAACATCAAAAAATCTAAAAACTCAAATCTTGGAACCCAAGAGACCGATGTAATT
ACACCATAAACGCAGATGGTCAGATAAAAAGAGGGGATAGCCGAAAGTTAGCTTTTTTCT
TTAGCAGGTGGGAGATGGCCCAAAGTCAAAGTCAGGCTCAAATGAAAAACGCAAACAGCA
GACGCAAAGTACGCTAAAAAAAATAAAAAAAAGAAAACTTGAAAAAAATGAAATGAAATA
AAATAAAAACAAAACAAAACCCGAAACTTGTCGTGTGTCGATCGCCAAAGGGGCGGAGGT
GGAGAAGGTGGAGGTCAATGTCTGGGTTCAACGACTCCTGACCTCTGGCAATCTGAAAAT
GGGGGGGAAAAAAAACAAACAGAGAAAATCCCAAAAACAACGGTTGTTATTGAAGCACTC
AAGCCGAAAAGATGAGAGATATTATCTCAAAAACTGGAGCAGTTGAAGGTATCCAAAGCG
AAGATATGGAAAACGAAGCAGAGCAAATGTATCTCAAGAGTCCTACACAATCGAATAAGT
TAATTATCCACTAACTATGGGCGGCTAAACTAAACTAGATCGTAAGCTAGTCTAAGCTGC
AAATGGAGCTTGCCAAATCAATGCCATTAAACGTTTAATTCACTTCATTCATAGCCCCTA
TTTTATTCTTTCTATTTTATGGTATTTGTATTTGATTTCATTTGAATGATAACTGGAATC
GAAACCATAAATAGATAATAAATTTGCTTACAAAATATCAATCATTTTAGGTCATCAAAA
AGCGTATTAGAACAGTGATTAATTAACGATTCAGCATGATAGGTATATAAATCATTTGAA
GATGAACCATAAAATACTATGTTTAATGAACCATAAACTATGACAAATTATCTAAAACTC
CTTTCAACTGACAATCCCTATATTAGATTACCTTAAAAAAAAGCTCATAAATTGTATTTC
TTAAACGCTCTAAGCATTTGTTAAATCCGCAATATTTTTTTAAGTAAGCCTTCTGGGAAA
TCCCAACGTTTTTCTTTTTTTTCTGGGAACTTTCAATTGCATCTTGGCGTCCAAATCTTT
TCGAGATGACGAGTGCAACGGGGCTGCTGCCTATGACCACAAACAATGGCAAATAAAACA
AATATTATGCATCATAAATTTCACCGACGACGAAACAGAAAACCAGTTTTTATATATTTT
TTTTTTCTTTTATTCAGTTCTGGCAATGAACTCAAAAGGCAAAGACCCAGACCGAGACTT
TTACACATATTTTTTGTTGTAACAAATAATAATATTGGAATAAAGCGAAATGCTCTGCGA
TTACGAAATCGAAATAAGCCCCAATCTGAATAATAATAGTAATAATACACGCACATAAAA
CATTTCGTTGGCCGATTAGAAATTCAAATGTGGCTAAGTCCAATTTCTGTTTCGTTCCCG
GTTTTTTTTTTTTTTTTTTTCAATGAAAAGTGAATGTGAATGCGATGACCGTTAGGACTG
AGGCAAGCATTTAACTGCCCCACACACAATGCAATGTTTTCCTTTATATATTCAGCTCTG
TTTTCGAAAGTGATTTTGAACTACATTTTATGCGGCAATCCGAAGCGAACAAAATGAAAC
CAAGCCAAAGCAAAGCCATAACCCAAAACCTAATACCACCACCAATAGATAGCAAATATT
TTACTATAGCGCGTTGCTTAATTGATCGATCGCAGCTCGTTTACCGTTGGCCGGCTGATA
TAATTGCCGGCCGCAAGTCGATTTTATAACTTCGAATCAACTTGACGTGGCCAGAAATCA
ATTAGCCATATAGCCGTATATAAACCATAACCCAAAAACCGTGTCAATCAAAGTGAAAGA
AGTCATCGCAAGTCATCGATTATCTCACAGATACAGATTTTCCCGATTGCAGACAAACAT
AACACATAATTGCTATTAAATTGTTCGCAATTAGTAAGTCAATTGATTGTACCACAGATA
CCTACGATATCGAATTGATTCGATGTCATTGGCTATAATTTTGCCGCGACTTACTGATCC
ACGATCGTCGATTAGACGAAATTGATTTTTCGTCATGGCGCAAGAAAATTATCAATGTAC
ACTGAACAGTAAGTAAAGGAAATAGGACACTCCATAGATTTTAATGGGCAATCTTGAGTT
CTGTTTAGAAATTATTTTACATTTAAGAAGGCAGAACATTCGGCTGTCTGCTTAAATCGT
ATTTTTGAATATTCATTGGGAATATTTCCCCACATTTTCCCCTAGAAAAATATTTATTTT
TCAACGTGTGGCTAAGGAAAATCGGTGATCAGATGATGAAAGATGCATTACTAGTGCCCA
GATCGATTCCATTCTTTTCTCATGATCGCTTCGCTTCGAAAGTTGTTTTCTCAAATCAAC
TCGGAATCAACTCACCCCATCCTCAGCACCAAGTCATCGAAGAAGAACGTGCAGGAGAAA
TAATGAGATTTTATATTTTCTCTATTCTAGAAAGTTTTTTTCCTCTTCAGCACAGCCTGA
CCTTTTTTTTTTTTTGTTCTTCAATTTTCTCGCTTATTGTTTTTCCAAGTTGCTCAGATT
TGTTTTTCCGCAGCGAAAGAAGGAACTTGCCAAGATGCAAGTTCATTGCGGCAGATGACA
TGCGTATGTAAAAGTACATATGTTCATAACTTGCAGTTTTTCAATTACCATTTGATTGAT
TGCTTTCGGGGAGATAAAAGTGTTTCGTCAGTGTGAGAAATGCCAGTTGGAGATGGCCTT
GTTGGCCAAGATAAAACAGAGTTTCTCATGGGAAGTTAAGTGTTCTAAACAAACAAAAAA
AGTGTTTTTGCGATATTTCCGCTAATATCATGGCATAGCAAGTGATATTTGTAATAAGTT
AATATTTCTGAAAGAACTGATCAACCTTCAATAATTTGTTATCAATTTCGAATTCAAAGT
CGAAAAACCAAACCCCACGACTTCTGACGACTTTAAATCATACTGGCAAAGATAAAAATA
CGACATATTGTTTTGTTGCGGCACGTCATGGAAATTATTGGAAAACTTTCGCTCAACCAA
AGGTTCAATGTGTCGACTTCCCAGGCATTTTACTCATAACTGACGCTCCCATGCCAAACC
GAAAAGAAACAAAACACTTTCCTTTTCCCCCCATTGTCTGGGGTATTGATAAAATAAGCC
ACCGTCCTCTAAAAAAGGAGAACCCGGTGACCTACCACAACTTTTTTTTGTTGGTTTTTT
CGTTTTTTTTTTTTTTTTGTTTCGGCAATGTGATTTGCATGGCAACCTTAACCCATTGGC
ACCGATGTGCGCACTCTCTCTTTCAATTAGCCCAACACTTTTTTTCACAGGCTTCTGGAA
ATCGAGTCATGTAAATGCCAGTCAGCCAGTAGAAATATCAATTAGATTGCCGGCAGAAGA
GCCGCTTTCGATTGCATGTCGGATCGCCTGGGTGGGCGTTAGCATTATGCTGGTGGTATC
GTATGTGTATTGTTTTATATATGAGACGGTGTATTATGGCTTGTAATGGAGTTAGATCCC
CTCCCGATGCATTTTGTTTGCTCGACTTACTAACATTTTGTGCTACTTTACATTTTTTGC
CATGATGCATTGCACTTCGGTTGGCTGACTGACTGATGGGTTGGAATGGAATGGAATGGT
ATGGGATCGGATCGGATCGGATCGGATGGGATCTTTCTTTTCACACAACTCTGTCGGGTG
GCTTTTTATTTCAATTGGCTTTTGACTGCGAAAATTTGAATGAAAGCGAGAGAAGCAAGT
GTCAATGGCAGACGTTGGCAAAAGCGTGTCGCAATTTCCACCAGCAAAACCATCTGAAAA
AACCAACTAAACAATGGGCCGTGACTGTACTTTCTCCAAATTCAATTATTATTGAAACGT
TATAGTATGGAATATTATGGTACGGTACGGTTTTATATGGCATGGCGTGAGAGTCGCCAA
ATTGATGGTACCAAAGTGCAAAATGCAATTGTCTCGGCCCGTGTAGCCGTAAGTTCAATT
GAAAACTTCAACGGATGGTATATGGTTAGATATTATTGTGTTGGCTCTATATAAGTCAAG
GCTCTATTGACTTGCGGCTAACATTGAATGATAAGCGTCATTATCAACAATATATATCTA
CGATAAGAATATTGAAGTTTGTATACCATGGACATTTCACAACGAAAGTCTGCTAAAGCT
TTCAACATTTGCAATTCATCAATGTCAAGGTGTTATATACACAAATTGGTGGGCGGGGCT
GTGGGCTAATTAGCATATGGCTGGCATTAAGTGACGCTTGATAAGAGCCATTAGCCGGAA
ATGTTGTATATATTGTAATATTTTGGGAAGCCACTAAATCTTTCATTTTTATACCCATTG
AAATGGTTTCAGTGTTTCTTCTTTTAACCTTAACACAGCCGGTTTAATCAGTTGTTTTTT
TTTTTTTTGCAAGAAATAATGGAAACATAGTTATTTCTACTCCGATTTAAATATCATTTA
TGTGCACAACGCAAAAAAAAGGCAAACTTATAAAAAATATTAACAACAACGGGCTTTTGA
CAAAGAAATCAGCGACTTTATCTAATCGAAAAGTTCTGTTGGCAAAGCAATCGTATTCCA
CAAAGAGAACTATATTTTTCCGAATTCTTACCTAGATTTAAAAAAAAACCAGCCCAGATT
TATAACCTATTAATAATAGAAGTGATATCGTACTAACCTGCCGTTCCTTACAACAATGAC
GATGAAGGTATATCTCGGGACCACAAAAAAAAAGAATAGTTTGAAAAAATTTCCAGCACT
AATGACTCAATTTGTTAACTGAACTTGACTGTAAATATGTATATATCGATAACGAAATGA
TAGCTGATAAGGCTTATCAGTCGTAACTTTCCTGCATATATTCATAAGCCCATGGTGTAA
ATATGGAATATAAACACCTGCAAGGGGTGCCAAATTCCTCAGCTCCTCCTAACTGAACCC
AACTACCGATAATATTGCAGCAGGCTGTTGTTAAAACCACCAGAGTACAGGTGGTGCTTA
TTCTGCTGGTGGTGTTGCTCGGGTGCTCCAATTGGTTGGTTGGTGGTAGTGTTGGTGGTG
CTAAACAAACGAAATAACAAGTGGGGAATGTCGGCAACTGGAGCAAAGGAAACTAGAAAC
CAGATAAGATACTTTGGCCGAAAATAATTAATCGAAAATGCCGTTGCCAATTATAAATGG
CTAGGTGACACATTCACTGCAGCAGCAGCAGAGTGTCTTTTAGCGGCCCGAGTGCTTCCC
CAAATGTTATTGAAGAAGCATTGGAACAGTATCTATATATATATATATATTAGTACCGAA
TTGATTGATATCACCCATTATCTTGATTATGACTTGGTTTGTCCAAGAGAAGTGGTTGAT
ATGGCAATTACTTCATTTTTGTGGCGCCCCCGGGTGGACCTTAAATACTATCAAACTTTT
ATCGATTGCTCTGTAGCTATTCAGTAATAGAAACTCTTTGTGAATATGTTTTCCACTGTG
GATTGCATAAACTGCAATCTGAAATCGAAGTTGCAGGTCTCGTGCCATCGAGTTTATGAC
CGCCTTCCCGTAATGAAGCCATTTCCACAGTGCGGGCATTTCCGCTGCCACCTGCTTCTG
CAAAATGCCTCGAATGCCGTTTGTCCGTTGTGTTGTTTTTCTTTTTTTTGCATTTGCTTA
ACAATGGTCGGGTGTTTAACGGTCGACGCATTACCATTGCCACTAAGTATCGTCACATCG
GTTGTCACACAGACATAGTAACATAAATAAGCCAGCGGAGACAGTTGGCCCCCATCCATT
TCGAGTGGAGCATATATGTATGTACATATAAATGTGTATAAAACAAGAGTCACTAACTTT
GCATATGCATTGGAGATTTTTGCCTTTCGCGTAATTTATATCTGACAAGATTTGGCAATT
GTCTCTCCAAGTTTCAACACTCAGAAAACGACGTATCCAACTCCATTTTGTTCCAAAGGC
GTGGGAAAGACATTCCCACATTTGTTATGCTTGTTATAAGTACATTTAACTAAATTAGAG
ACAGATATTGTTATTGTTTCAACACTCAGCTTGTTTTTTTTTTTTTAGCTGGCGAATTTT
GTGAAGGTGTTGGCGGTTTACGTGTCATTTGACCTAGTTTCTCGACAGAGTTTGTTGGGA
AAAAGCTCTAACGAGGTAGCTAAAAACAAGCGTTTTCACAAAAATAGTCTGCGTTTGTTG
TAAAAAGATCAACCGCTTAAAAAAAATGAAGAAATAAAAGTACAAATATTTAGAGTTTTA
TGAGTATAGTACTGCATTAATCCATAATCTATAAATGATTTATGACCACTATCAATGGCT
TCACCTTGTCATTGATTTGCTGCTAGCCAATGTCCACGAAACTTATCTATTTGCACTATC
GCGAAAATTCTAGGAAGTGCATACTGTTAGCCTGGAAAACCCGGAAAAGTTGGTGAAAGG
CAACAGCTTAAAATTTCCATAGCACATGGTCTTAATAAGTATGCACAACCTTTCACAAAA
CAACCAAAAAAAAAATAAATGAAGAAAATGGAATGCAAGGTGTTAGGGGAGTTGGAAAAA
AATATAGAAATAACCCAGCGACGATAATGATAATGATAATTTTTACGATCCATGCCAACT
GACGGACAGCGGACAAACGGACAAAATATGACGCTTATAAAGTGCAGTTAGCATCCAAAC
CGTTTACCGTTCGTTGGCAGTGGCTAAGCGGCTGCTAAATGTCATAAATGCGGACAATGG
ACGGGCGCATTTCATTCATAAAAAAAAAAGAAAATAAAATAAAAAAAAATGGGGGAAAAA
GAAAACCGTGCCCATTCAGTTTGGCTCAAGTTCAGCTCCAGTGGGCGTGTGGACTTATCG
GGTGGGTGGGGTTATTCGAATGCTTAACGGTCAACTGTCTAAGCGGGAAAATGAGCCAAA
CCGTTCAGAAAACGCGGACCATTGTCACGTCTTAAGTGTTGGCACTTTCTCAAGGCAGTC
AGTGAAATGGTTTCGCTTTTAATCAACCCAAAAACTGAGCTAATTCGCGCCTGTCACTGC
TGATCTTGCCACTATGTAGTTACCTCCCATCGATCTCTGTTTGTTCCGTTTCCAGGTTTG
CCAAAAAACCAAAAAAAAAAAAAAAAAAAACAACAACAAGACTAAAAACAAATAATAATA
CTGAAAAAGAGCAAATAGCTCGAATGCGAACAAAGCAAGTCAATTAACTTTGCCCGTGTA
TCTTGTATCTGAATCGCGTCTGTTTGTCCCCATCCATAGAAAGAATCTTGCGGTTGTCGT
GCCTCACCGACAAAGTGTTTCGCAAATATTTGCCATTGTCTTGGCTTGAGGTACATATTT
CAATCAGCAGCCGGCGACACAATATGAAACGCAGCTTCAATTACAGCAGACAGCAAAAGA
CATGGCAATTACAAAAGGCCCAGATATGTATGTGCACTCCAGCGATCTGATTTGGCCAAA
AGAACAGGCAACAGATGCCCAGATAATACACCGAAAAAAAATAATGATACTAAACACCTT
AGAGCATTATTTACAACATAATATAATAATATTGCGCTCTATTTATAATGAAATGGGTAT
GAACTGCAAATCAGTATATATATCACATATTTCTCTCAGTGTTCTCTGCATCTTTTACGT
GCTTCGTGGAGCGCCCCAAGTTCAACACGCAACTGTTTGCTGCACTTACAGCTGCACATA
CATGTGTCTCTACACGGCTTGTTCTTTGCGTCCACAGTTCTCAACAGTTCAGCAGTTTTT
CTCCTCGGCTGTGGCGCTTACTTTATTTGCCACGCCGCGTGTCAATGGCCCAGAGACCAG
CTGCCACCTTGCCACTTTTGCTTTGGGAAGATGTTCAGCTGCCGCTGCATTTTGGAAGTG
AACAGATGACATAATGCTCCTACATTTTATCATATCATTTGGTACGAGTAACATATATGC
TGGGCACGTTTTGTGGGTCTGGTCAATCGGCATGCAGCTCTGCTCTAGTCTGCATTCGTA
TGACATAATTTGTTTTTGTTTCTTTATTTGTTTGGCTTTTTGTTTTAGCTGTTTTTATGC
CTTTTGGCTTTTTGTTTTATATGTTTTTATGCCTTTTTGGCTTTTTGTTTTATCTGTTTT
TATGCCTTTTGGCTTTTTGTTTTATCTGTTTTGCCCTATTGTTATGGCATTTTTTGCGGC
ACATAGTGGCGCGGATCGCATATTTGGTGCTCCGGTTGAGTGGCCAGGCCACATTTTTCC
ATGGGAAGTTGGCTTGCAAAGCCAGATGTTGTACCTTTTTTTTGCTCTGAATAATTATTA
ATCATTTCTTTCTTAAATTATAGAGTATTTGCCCAATCAATACCCCCATTGAATTTCGAA
CGTAGTATACAGACTTTCTTGTTTTTTAATTAAATAATAATATAAGTAAACGCTGCCTTA
ACTTTAAAGAAATTTGTTTGCCTTGAGCTTGCAGCTTGGGTCAATAAAATAGGGTTTTTT
TTTTTTCAGTTGGCCAAGTTGCCGGACTGAATCATCCATCCATTGAGCTGAGTGCTCTGC
CTCCCATCTCAGCCAGGCACTTAATTTAATGACCGACTAACTAACTAACTGTCCGGGGCC
AATAAAAGCCGGCCAGGACCGACAACCGAATCCAAATTAATGGCCAAACAATCCGCAATC
AAGCCGCCGAATGTAACGAGACGGAATTGAAAAAGCAAACTTTAGTTCGAGCCCCTGATT
TGGCCAGGTCACGCATAGTTGGCAAAAAAAAAAGCTGGAAAACCTGGAGGGGCTGGGAAA
TAAGTGATCGAATCGACGGGCTTTTTTTTTTTTGTTATCAGCACTCGCCCGTTTCATTCC
ACCTCCCATCTAGCCATTTATTCGGTTATCGCAAATTCATTTTGGTTAACACACATATGT
GTAGGAACCTTTTATAGGAACCTACCCATCATATAAGATAAGGTTCGAATTAAAAGCAAC
ACGAACTATATATTTGCCAGCGAATTGCGCAAAAAGCCAATATCGTTTTGGCCCCATTTC
CCAACAATCCCACCCACAATCCTGGGCTCGCCTCCCCGCCCCCTTTGTGCCCATTTTGGC
CATCTATTTCGGCCTGTTTTCGCGTTGTTGACCAATTTGTTTGGTTTTTTTTTTTGCTAA
TGGAGCGCCCAAAGCTGGGGACGTGACTATGGCCATCATTTTGAGTGGTCTCTTGGTCTT
TTGGTCTGTTGATTTTTTTGTTGCCTTGCTTTGCTTTTTGGCCAACATTTTCTTCTGTGG
CATGGCAAATCCACAAGTCTAATGACCAGCCATCGCCATAACGGACCATTCTTAATGGTA
TTGGTAATGCTAATGATATGGCGTCATAATTGACACATGCTCCAAGTGCATCCGCCTTAG
ATTTCCACCGGCGATTATCTCCGTCTCCGTAGCTTTGGTTATCTCTCTTTTTTTCCCCCT
CTAGACCAAAATATATAGTGTGTGGATCACGATTTGCTATAGGTACGTCAAAACTGGGTC
GATCGGATCGTGGCTAAAGCTCGTTCAGCCAGAGCAGTGTTCAGTTGGGCAAAAAGATAA
TGGCATTGGCAAATACCTACGATCGGGAGCTACAAGCATGCATTCGTGGGAATTGAAGGT
CTATGGTTGGATATATATGAAAACAGATCTTTGGGTTAGATTAAAGAAGACTTGGTGCCA
AATTTAAGGCCAGAAAAGCAATTTCTAAAACTTTGTATCAATTTAAGTAGCTATTGATTT
CATACTAATGAACTTACTTCAATATTTCGCATAGAAGAAAAGAACAAAGAACTTTCAAAT
ATTTTCGAAACAATCCCTTAGTAATTTAACAATAACATAATTATCAAATGTTTTTAACTT
GAGATAAGAAGAAAAAGCGGGGAAATGAATCAACTTAAAAAACAAATTTTAAATGTGTTA
TTTTTAAATATTCAACTAAGTTTTTGAGTACGCTTTTATTAGCTAAAATGCTGCTGATAA
GATTTTAGAAATTTACTAAGCAAATTAGTAATTTATTAGTAATCACTTTTTATGAAATTA
AACAAATGATGATGACAAATTTACCATGAAGTTATGAAACTATACAGTATTAACACACCA
CGCATTTCAATCATTTCTTTTAAACACTGGTTTTAAGTAAAGTTTTAGAGATCTTTAATA
AGCTGATCCTATCACGAAATGATTAATCAGTTTATTCTAAGCACAGGATATGACTACAAT
CTTTTTTTTGGCATCTTGTGATTTTCGCTTTGAATCTGTGGTTTTAAAATGGCAAAAAGT
GTTAAATACCGCCCTTCGTTTGCATATTCAATGTATTGTTTTGGGTTTTTGTACCTTTAG
TTAGTTTTTTTGTTTTTTTATATGGGTTCGCTTCTTCTTTGTTGATTTGTACAATTTTTT
TTTTTGCACGCTTCAGCTGCATATGCGGCGGTCACTGAGGAAAACGCTAAATGAATTGCC
CCAAATACGAGTGTTGTACGCGATGATCACGAAGGCGATGATGACGATAATGATGATCGT
TATGCTAATGCTGATCGCTCGCCTGGAAACGACGTCAGCAGAGCCAGCAGCCCAAGCAGA
GCAGAGAAGATAACACTGCAAGAAAAATGTGCGAGCATCTTGTAACTTGAGATTAGCTTA
ATGGGAATACATAGAGAAAATTCGTACTTGTTTTTTTTTGAATTTTTATAATAACAATCA
TAGTTAGTTACATAGTTTAACTATCCTTTTTTAATATTGCTAAGAACCTTTCTAAATTTG
TCTCTGTGTAGTATTGCCCGAAGTGGATCAGTTGCCAGACAGAGATAGCGCGCTATGATG
AGAGGGAGAGGGAAAGTGGGGGGCGCGGAGAAAGAGCCACAGTCACGGTCACGTTTCTTG
TCACGTTCTCCCGCTATTTTTACGTTTCTTCTCTTGTTTCTCCTCTTCTGCTGTTCGTAC
CCTCTAATTTCACCAATTTGGGCATACAGTTTTCCTTATGCATAAGCTAATTGATTTCCC
ATTTGAGGTTGCTCAAGCCAAAGGTGGCTTAAATAATTCAATCTTTAGAAACTTTCTAGG
TAATTTATGTAACTTGTATTGCTTATTCTGTTCTAAACTGCAGCACTATATGTGCTTTTA
ATGTACATTTTAGTCGAGAACTTACAGTTTTTGGGCGTAAGTACGGAGTATAGTAGTTAA
ATACCATATCATTTATTATAATGCTATTTGTTTTAATTTTGACTTAGATTTTAGTAATGG
GTACTTTAAAATCCCCATCATCACTATCTGGTTCTTATTTGTTTCGCTTTTCGTTACTCA
TGTTTTGTTGTTCCCCTCTTGCCAATTTGCTTTCTGCCTCGTTGCTGATCTTGTTGTTGG
CCGATCTTGTCGTGGCAGCAACGGCAGCAACAAATTGCGCCCAAGTCTTTGGCTTATTTG
CTTGTTGCCTGCTTTTTGCTGTTTTTCAGCTGGCTGCCTCTGTTCACGCGACCGACCCAT
TGGGCGTTTGACCCCGGCGAATGTGGCATGCAAATGGGTTCAAGCTTGGACAAGAGCCGC
ATGCCATTCGCATTTGCAGAGTTGCATTCGCATTTGCATTTCCCCCTTGCGGTAAATTTG
CTGGAAAAACGCGCGCCAAAAGTGACAGCCGGTCGAGGAGCAGCTGTCAACTTGACTTTA
GGCAGCTGCCGCCAAAAGTTGCCGCTGTCATTGCACTTGGACGGCAGCAACAAGTAGCAG
AAAACGGAAGTATCGTACAACTTTTTACATTAGTTTGCCGCATTTTGGGTATATGTAGGT
ATACCCTTTCTTTTTTACTAACACATGCAACAAATAGGGGAAGGAAGCAACCGCAGGAAG
CGCTTCCCATTGGCACTTTTTTAATTAAACTTTGAACCCTCGGCATCACATTACTGTTTG
TGTACAAATTAATATGCACAAAAACCATCGACACTTGGGGTCTCTAAAGGAAGTACTTAC
GATATTAAGTTACCTTGCCGAAAATGAAAACAAATTGGTTAATAAAAAGTGTTCTCTTGC
TTGAGCAAGAAAAATATTGGTATTTATAATAAGAAATTACTTCAAAGTGCCTTGTATTTT
TATAATTTTTTGTGTACCTTAGAGTATTTGCTACTTCGAATTCCATCGTCAGTTTTTCCC
TGCTGTGCTTTTCTCCCAGCTTATTTTTGTTTTGAAGTAAGTGAAAACGACGTCGTTAAA
CGCACATTTTGATGCCATTCGTTGTCGTTTTGGGTGCCTAGCCCAAACAATTGAGTGAAA
ATCTGCATCGAATCGATGCGTTATGGGCGGCAACAGCTACGGACAGTGATTTTTTCATAC
TATGACTCCGAACTGCGACACAATATTTTTTTTTATTTCGACTTAGACCAAGCAAAACAA
GACAATAAAGCGGGGAAAAGCAAAAAAAAAAATAAAATGAAGCATAAATGCCGCATTCGC
TCATGGCGAGCACTTGCTGACTGCAAAAGACTGGCACTTTCTAATGCGACAACGATGCGG
AAGCCAACTGACGACACTCGACTGCCGGCAGCAGCAACTGCAGCATTGCAGCAACATCAA
CGCAACAGCAGCAGCAGCAAGGCAACACACCTGCCAGAGCAACCTCAACATCAACAACAA
TCAATGCGAGCACCCACATGGCGATGTCACAGACCCCACAGACCCTAAATGCCACCAAAT
GGCAATGCGGTGACCCGAAAAAGCTGGCCTATCTGCCCTCGAACAACCCCAAGTGGAGTC
CCTCATTTTCTTGAAAATAAACCTCCACCTTTTCCCCGGAAAATCAAGTAATATGCATAT
ATGTAGAAGGCGGATAAGGTGGAGGCCCTGTAAGTGCTTCGAGTCTGACTGCAGGGGAAG
TATTTAGCCATCAAGTAGATGCTGATTGCTGTGGGAATGTTCTTATTGCGCAAAAAGGTC
TGAAGTCTGAGTAAAAGCAGACAGAAAAACCCTAAAGACAACTTTAATTGTAAATGAATG
GAAAAAACTGCGCAATTCATATACAATTTGTAACAATTATCAATGTTGGAATATTTTTAT
ATCATAAAATCGAACACATTAGCATTTTTAATCTTATCTTACAGAAAAATGTCCCATTCT
TACATTTACCTAGGTTGGTTACTTTTTTATTATTATTTTTAACGCTGAAATAGTTTTTAT
TACATAACCACGAAAACAATCGTATGAACACATGAAAATACTTATCTCTTTGGCAAAATT
TCCCATTCTATACATTTTTAAAGGGGTAATTCGTAAAATTGTGTAAATATTTCAACTTTC
GATAAGCCAGCATGTGATTTTAAGCATAATAATTGTTAGGGTGCGTTATGAGTCACTATT
TATGATTATAATAAAACTTACAACATTTCAAAACAAAAAAAAATTAATATGACTGCTAAA
AGTTGGTTAGTTCAGAGGAAATTGCTTGTCACTGTAAAATTCTTTTTTAATTAGGCAACA
AAAATTCGTCTATTTATGTATTTATGCAGAATATAACAAAACCTCGCTGAAAGTGAGACT
GCTAAACACTTTTACTCTCTATGCGATGCTTTGTCATAGTTTCGCATATTTTATATAGAG
AAAAAAAAATAGCAATTCAAAAACCGCGATACAAAATCGTCAACGAACCGTAGAGAGGAA
TCACCAAAACCAACTAACTTTGTTGTCGATGTCACGCACAATAATCGGCTTAGGTTACGC
TTGGGTCCACTCTAAACCACTCATCGAACATTACTATGGGCCACCCCGAACCACTCTGTA
ACACATTGAACCACACGCCGTGTGTGGTTTTCGGGCGGATCATTTGGGCAGCACGATCGA
AGCCAATCGGATTATGCAAACAGCGGATTTGTCTCCTCCGATTTCGCTCAAAGATGCAAT
CCACGGATGCGGGTGTATCTTGTGTATTTCTTCTGTTTTTTTTTTTTTTTTTTTGTCTTT
GTTGTAATACGGCATGCAACTCTTTCGATTTGAAGCGGATCGAAAGTGAATGGCACTCGG
ATTTGCGGCATATTCGATTACATTCAACTTAGAAGTTTGAACTTTGTAGGGTAATTCGAT
CACTTCCACCGCTTTGGGTTACCAACTGCACTCAGCCAAAGTTTCTTCTTTCTTCAGTCG
AACGAATGTATATGTATGTATAGAACATAGTTGTTAATGATTTCTTGAAGTTAGAATTAA
TTTCAGTGCATTATTTTGTATACTCCTCAAAGAGGACTCAAGCACCTGTTTTAAATCCAC
TTCTTGTGTTCTTTGTGCTCGCAGAAAATCGATCCCCTGACACGCATTCAGGAGGAGATC
AAGGAGGTAGTGCGGCGCGAGGAGGAGTACCGCCAGCTGGCCACACTGTCGTCCAGCGCC
TCGATCACTTCCGCTTCGCCGGATTTCGAGACATACACGGTTAATAGTAACTTTGAGCCG
AAACTGCAGCAGGATGATGAGCACGATCTGGTCGAAAGTCCAGATCAGGACCAGGGCATG
CTCGTTACCGCCCAGCCGGCGGCCGTGCAGACCACCTCGCTCCTGCTGCCCATCGACGAG
CTGTCCAACACACCATCGCTGGCCTCCAGTGTGAATAGCGCCAAGGAGGAGAGCCTCGAT
GGCCAGCACTCGGATGATTCGGGCATTTCGGCCTCCTCGCAGAGCAACATCCTCATCACT
GGGATCACCACGAATGTGGCCAAGCAGCAGCCACTCAAACTGACCGTGGTGACGCGTCAG
GAGCAGCGTTACATTGGGCCCAACTGCTATAATCTGACACCTGAACCGCCACAGCAGAAG
CTGATCACCCGCACCATATCCACGCCCCAGCTGAGTGGTCTGCCCCAGAAGCGGCAGTTT
GCCTTCGGTGGCGCCACCAAGGGTGTGATGCAGCGCTTCATTGCCTCGCATGGCAAGTTG
GGCAACACTAGCCCGCTGCCGGCTGCATCTCCAATGACGTTGTCCCTGGGCGCCGCCAAT
GGTAATGGCGGCCTAAATGTCAATGGCCAGATCAACAATATCAGCAGCAGCAACAATAAC
AACAACAACAACAACAACACCCTCAAGCTGAACACTCGCACAGCCATGGCTTTCCTGGAG
TCTGGAGGTTCCACGGGCGGCATCAACTCGTCATCGGCGGCCCTATCGTCGGCGGCTATC
GAACGCGACTCGGAAGGCAGGCCCCTGCGACGAGGATATGTCCCCGTTGAGCAGAAGATT
CAGCGTGAGCTGCAGGATCTGAAGTCACGCGAATCGGAATTGAAGCGTCTGCGCAAGATC
AACAGGCAGAACACACTGAAGGCCTCCCTGGACAAGCTGTGAGTCTATCTGGGACTTTCT
GTTTGGATTGCATCGTAAACCAATTCTGTGAAAACTTCCGGAGTTTTAAAGCATACGACC
ACCAGTGGGATATCAACTAAATGTTTGTGTATATATATTTTGCAGGCAACTCAGCACAGA
TGATGAGGCCGATGCAGATGATGATGATGAGGACTCCGAGGTGGAGCACTGCTATGGGCC
CGGAAAACTGCGCAATGCCCAGTCCACACAGGAACTTGATAGGAATGGGTGAGTATGCCA
GAGTAAGCACTTAAAAGAGAGATTTTAACATATTAATCCTTACAGAAACGAGCAGGACAT
CGTTCACAAGCCATCGGGTAATCGCAGTCTGAACGCAACCGCCTATATAGCCAATGGAAT
CAGCAATGGCAATGGCAACGGCATGCGTCCGGCGATGTCGCTGGCCCAGCTCTGCGATCT
GACGCCGGAGGAGGCGCCCTCATCGCGTGGACTCATCGCCCAGTGGGAGAATCTGATCAA
GAAGAACGCCGAGGTGGGAACGGTCGAGGCGATCATCTAAAGAATGTGGGTCGGGTACCC
TTGCAGAAAACGGCAAAACAAAAAAGATGAAATACAAAAACATACACACCAACGACCTGG
TGCAGAGCAGACCAAATTATTTAATATATAGTGTCCACACTAACACACTTGATCCTCTCA
CTTCTCCGAGTCCACGTCCACGTCCACGTCAACGTCCAGGTCCTTCTCCTTCTTCTCCCT
CTTCACCTGCGAAAGCTGCTTATCAACGAATTAATCTTAATGCCAATCAATGGGAATTGA
AATTATAACGAAATTGAATTGCCTGTACTTAAAGCGATTTATATGTGTTATTTGTAATGT
GTACGTGAACTGTTCGAGAAATCTATTGTATATAAATAATTCTTCGTGTTTCCAGTGCGA
GTACAGTCGACTTGCTTATAATTTATTACAAATCAACTTTATATATACCATATATGAAAG
TATATAAACAAAATACTATATGTACGAAATCAATATGAGAAAACGATTAAAAAAAATAAA
AAAAATATTTGATTGATATTTGACCATTGATATTTTAAACACACTCAATAATGAGACACG
AATCATTTTTTTTTGGAAATTTATCATATTTATTTTTATTCAATACATTTCGTTTCTTTC
GTTTGTTGTTGTTGCGGTTTCTGTTTGTTAAGTTCTTGTTACGTATTCGCTCTGTACTAA
TTGAATTAATCAGATATTAGGGTGCCGTAGATAGAGAGCGCCTCTAGTTTGGAGTACAAG
TTTCGGTTAGAGTAAGCCGGTTGTTCATCATCGTCCGCAGACCTAAAAGTACAATTTTTA
TACACAACAAAAACGGAAGCGATCGACACTCAGCGAATTTGCACTACGACCTCATGGTTG
GCAGGTGTAAACGGTGCCCGAGTGCTGCGATAATCTTGGAATTTTGGTTTGGATTTTTTT
TTTTGTTTGGTAGTTTGTTTGGTTGATTGGTTTTTTCTGTTACTGCTACGGAAGCCTCAA
AATACATTGTTATGTACGTCGTTAATGTATGTGTTGATTTGCTGTTTCTATGTGAAGTTC
AAATCTTAGCTTAAAAGTTGTGTATTGCAACTAAAATCATATCGACTTGTATATATCGTA
CATATCTGTCGTGTTGTATTTATATTCCGTATATTTACAAAAAAGCCGTTTACAAACTGG
TGCAGCTTTCGCCAAATGGAGATTGTTATCATCAACCGATACGCTTAACTATGGACAAAT
CAGGGCGTTTGTAACTTAGAGCTAAATTAGTCAAATCATAGATACATAACCGAGATATTT
AAAACGTATTCGTATATTGCACTGCTTCGGATTGCTTGAGTATTAGAAATTAGGCAACAA
TCAACATATCGAAAAAAATATAACGCGCTGATATTCACACGGAGATTCGATTCACATACA
TACGACTAGAATAATACTTTGGCACACACATATAAACATAACTTTGGGTTTGGGATACTG
GAAATCAGTTGTATTGCTCGGCGGTACG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1433, 18324..19357, 19485..19607, 19665..20387
1413..1433, 18324..19357, 19485..19607, 19665..19896
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved