Drosophila_melanogaster Locus Idgf4
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Idgf4
Drosophila_melanogaster
Idgf4
X
snoRNA:Me28S-U1688
1974..2091
4721
GGCCTGATTGTATAATTGCTCGAGCGATTCCCGGTAACGATGACATCACGACGTTGGTG
TGGTAGGGGGGAGGGGGGAGGGCGGCGCTTAAAACAGGCTCTGGCAGAGAAAAAACCGAA
TTACAAAAAAAGCTGATAGCAAAAATTCATTACAACAATGACAGACACTTAATCACTTAA
TAGAGAAAATCAAAAACGAGAGCAGATCAACCAGGCTTTGTGGCGCTGGTGAAATTTTTG
CGGCTAAGCTAGATTTAATTACGGATTTCAAACGGAGATAACGAGCTATTCAAACGAACG
GCCTATAAAGTATAGTTTAAGGCTAATCAAATGTATTACAACTAATTTAATTAGTCTATC
TACACTTTGGCATTGATCCCTAGCAGATATTTACAATTTATTGAGACTGATTAGGCTTTA
TAGATAAATATATAAAGAAGTTAATAGCTATATCCATTAGAGTAAGCTTCGAATATTAAT
CACTTCATTAAAACTGTATTTTAAGTTTTTTCTTATTACGTTTTTTTTTTACTCACACTA
AAAAATCTCAACCACTTTAAATGCAATTAATGACAAATCTGTAAAAAGTGATTAACTGGA
GAGCTAAGAACACAATATTTCAACCCAAATTGGTGAAGGTTATTTGCTCTGCGATGATTA
AAGTTTTCAAAGCTCTCGAAATCAATTGATATTCTTCCATCATCCAGATCATTATCGTTT
ATCAATATGCGTACTTATGAGTCGCCCCTCGTTTCGCAGCTTGGCTTCGCTTGTTTTTGT
TTTTCCACACACATTTCTAATTTTTTTGTTTTTGTTTGCCAAAGTTCTCTATCTCCATCT
CTATACCCCTCTGTTCTGTTTGCTCCGATCTTATGTATTTCCAAGCCGAGTTTTATTCTC
GCTGCGTTCGCTTTGCCCTCGCTCTTCTTCGCTCCCGCCGCCGCAGCTTCAGCGGTCTCT
CGCTCTTCCCTCTTCGTCTTGCCCGGTTTCGTATTCTCAACGAGTTCACTTAAAGTTTGG
ATCACCTCCGCCGGCGAACAGTTTCAGTTTTACCTTTAATGCGAGCACAACAAGTCAGTG
GAGAGTCATTCTAATATTCCGTTGGTTTTTTTTTTTCTGTGATCTGAGTTCTTTGCGCCG
TGTGATAATTTATATAGTTTTTATGGCCAGGAACTGGAACTATAACTTCTTTGATATACA
CGTATAATAATCCGAGATTTGGGCTTCTTAGAATTCCATTTTGTTTGATTCTCTAATGAT
GTATTTATTTTATATGGTTCAGCTTCTTCTTCATAATTCTTATCTATTAATAGTCTTCTA
AGAATATAACGTGCCTAGTTTTTTGAATTCAGAATCACAGAATGTTAAAATAAGTCATTT
TTCCATAATAATCAGGCATACAAAATAACCTAAAATCTTAAAATCTCACACATAATGTGG
GTTTACTCTGGAACTTTCCAACAGTTAACAGTTTCAATATAAATACATATATTTTCCTAT
TCACAGCTATGAAGCTCTACGCCCTGTTCTCCCTTCTGGTGGGATCTTTGGCCATTGGTC
AGATTTCCGCCGCCGGATCTCATCATCTACTTTGTTACTATGACGGCAACAGTTTTGTCC
GCGAGGGTAAGTCCCACTTCTAGTTCGTTCTTGGCTATATAGTTGATAAGAATCGGGGTT
ATCGGTGGAAGGAAAATGTACATATATTACCCGTACGTATGTACATATACATATGTGTAT
TTTGAAACCAAGAGATAGAGAGCTGCGCGGACTCAATTCAATTAGATGATTTTCACTTTT
CATAGACACATGCTAAAAGCATAAAGCGGTGTACTTTTTTGCGATTCTGATAATTGGCAA
CGGGTCACAAGATCAGAGGGGAATGTTTTGCAACCAATTTGAGTAAATTGCATATAGAGA
GGAAAGCCCACACAAAACGCCAGACTTGAACTAATTGAAATTGGCATCGGGTGTTCGACG
ATGATGATTCATGACCAGAGGTGCCACCTCCAAGGCGCTAATTGATGATGCAAACCGAGC
TTATTTTAGTACACTCGAATTTTCAGCTGCCAGTGGAAGATTCACTGAATATAAAGTGTT
GGCAATATTAAACACATGCTTTTTCGGGGACAACAATCAAATTTATTGATTAACTCAACG
CTTCCTGTTAACAAAGCATTAGTATAATAAGCTTTTACATTCATGAATATATTTCACAAT
TTCCTTATTCTAAAATGAACATCAACAGGCCTCTCCAAGCTGATCCTAACCGATCTGGAG
CCCGCCCTGCAGTACTGCACCCATCTGGTCTACGGATATGCCGGCATTAATCCCTCGAGC
AACAAGCTGGTCAGCAACAATGAGAAATTGGACCTGGATCTGGGCAGCAGCCTGTTCCGC
CAGGTGACCGGATTGAAGCGCAAGTACCCAGCCCTCAAGGTCCTGCTTAGCGTGGGTGGC
GACAAGGACACCGTGGATCCAGAGAACAACAAGTATCTGACCCTGCTGGAGAGCAGCAAT
GCCAGGATTCCGTTCATCAACAGTGCTCACTCGCTGGTGAAGACCTACGGTTTCGATGGC
CTCGATCTCGGCTGGCAGTTCCCCAAGAATAAGCCAAAGAAGGTGCACGGCAGCATTGGC
AAGTTCTGGAAGGGATTCAAGAAGATCTTCAGCGGTGATCATGTCGTCGACGAGAAGGCC
GAGGAGCACAAGGAGGCCTTCACCGCCCTGGTTCGCGAACTGAAGAACGCCTTCCGTCCC
GATGGCTACATCCTGGGTCTCAGTGTCCTGCCCAATGTGAACTCTTCGCGTGAGTTAACA
TAAATAATTTCGATTGTATTAGATTTCATTTAGTATGTTTTGTTCGAAAGATTGCCCAGC
ATATTTATTATATATTCAATATGTTTTTGTTTATCTGGTTTAGTGTTCTTCGATGTGCCC
GCTATTATCAATAACTTGGACTACGTGAACCTGCACACCTACGACTTCCAGACCCCCGAG
CGCAACAACGAGGTGGCCGACTTCCCGGCACCGATCTACGAGCTGAACGAGCGCAATCCG
GAGTTCAATGTCAACTACCAGGTGAAATACTGGACCGGAAACCGTGCTCCGGCCGCTAAG
ATTAACGTGGGCATTGCCACCTATGGACGTGCCTGGAAATTGACCAAGGATTCGGGACTG
ACTGGACTTCCACCGGTTGCCGAGGCTGATGGTGTGGCTCCTGCCGGAACCCAGACCCAG
ATACCCGGACTTCTTAGCTGGCCAGAGGTGTGCGCCAAGCTCCCAAATCCCGCCAATCAG
CATCTGAAGGGCGCCGATGGTCCGCTGCGAAAGGTTGGTGATCCGACCAAGCGCTTTGGA
AGCTATGCCTACCGCTCCGCCGACGACAGCGGTGAAAACGGAGTCTGGGTGGGCTACGAG
GATCCCGATACGGCGGCCATCAAGGCGGAGTATGTTAAGCGCGAGGGTCTCGGCGGCATT
GCTGTTGTCGATCTGAGCTTCGATGACTTCCGCGGCGGCTGCACTGGCCACGACAAGTTC
CCCATCCTGCGCCAGGTTAAGAGCAAGTTGTAGAGCTCCTCATCCTTCTGATTCTTTTCC
CGAACGAAAGAACAACGTGTTTTTATTTGCCCCACTGTTTTTTTTATATGTAATTGACTC
AACGCAAACCTGTGTAAACGCGAAATGCAAATTAAATTAATATAACATTGACACCAAAAA
AACTTGTCTCTTACTTGTTTCTGAATTTTTGTAGCTTACATATATTTATATAACCAGCCA
GCCGAATAACGGGTATCTGATAGTCGATGAACTCGATTTTAGTGTTCCCTCTTGTTTATA
ATTTGAGTTTCCCACACTTTTCCACATCTGCTTTAAGCCACTCGCTTTAGCTAATTATTT
ATGCTAATTGTACTCAATTGAATTACATAACATCATTATATAAAGCTATTAACCCATTAT
GAACCTTTATAAAGTTTACTATCGTCAAATAAATTATGTTAATATGACATCAATCGTGTT
GCCGTGCCTTTTATGCCAATTGTTATCGGCCAATTAATTATGTTGATTTTAGTGCACTTT
TCGCACTCGCATCGCATTACAGTGAGCACTCGCTGTGCGTGAACCGATGCTCATTGCACA
TTAACTGTAATTGAGTGCAACAACTTCCAATTACTTTCCCCCGACGGCAAATAAACTGAT
TAGAAGGCCGGCAAATGAACGCACTCATGTATGCATTGTGCCGCCGCATTGTCCCCGCCT
CTGTCCATGTGAAAGAAGTATCCTTCTGCTCCCCCTCTCGTGGTCCTTGTCCTCGTCCCA
GCTCTTTTCAATAGCCTAGTGTGGGGCTCCTTTTATGATTCGGACTTTTGTGCCTGGTTC
CTTGTGCTGCTGTGACTTCATTTTGCTGCTCCTTCCGGCATTTCGTGTCAGCCTGTGGTC
GCCGGCTGATTGTTTTATGTGCGGTGTTTGTGCCCGCTCTGCACGACCCATCAAGCCCTC
GGACCACCCACTGCACCACCCACTCACTCTAACGGAAACGGAGCAAAAATCCCCTCCTGC
TCCAGCGACTGCCTTCTGAACACAGCAACGGCTTCAACTGCAGTCGTGTAGCAACAGTTT
CCATTGCATTGTGGCCAATGGCTCATTCATCTTTGGGCGGTGGTCATGCTGTGACCACTT
GAACCATTGCCGCTGACACCCACCAAAAATGGGTGGATGGAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1099, 1506..1625, 2248..2808, 2923..3721
1508..1625, 2248..2808, 2923..3569
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved