Drosophila_melanogaster Locus RpS6
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpS6
Drosophila_melanogaster
RpS6
X
snoRNA:Or-aca2
1060..1201
3643
AAAGTTCTCTTCGTCCAGCTCCAACTGCTGCAGCTTGGCCGCGGCCAGGATCTTTTGAC
TACTTCTGGCATCGATGTTCTGTGTTCAAATAGGAAAGAATTTGTTTAAAAACACAAAAC
GCAGTTCAAACCCGGATTCTTACCGCCGATTCCTCGGCCCGCAGTTTGACTTTATCCTTG
TTCTTGTTTTTCGCCACCCTGCCCTCGGTGATCTGCTTCTCCAGATTCACATTTTTAATC
GTTGCCACGTTGGCCTTCTTCGGCTTACCCATTTTGCTCGGATATTGTCAAAAATCAAGT
GTAATAATAAGGGCAACAAAAATTGTAATCACTACACGTGCTGCAACAAAGCAGTGGCGT
TACCGGATATTTTGAAAGAATCGAAAAACAAAACACATTTTCGCACGTGTGGCAACGTCG
CAGGGCTGGCTTTTCGATAGGCTTGTGAGACCAGGGATGGTGGCGCAAACGATATTGAAT
GCAGTAATTCAATAAAATCTATATATATTGTTTTTGAAGTTTATTATGAAATCGATTGTA
CCGATATAATTCGTTTCAAGATGTATTTAAAAAGTCGCATAAATAAATATTTAGAACGCA
CAATATAGCATGTTTGATGAATCAGTGCAATTATCTCCATTCTCGTGTATTATTAATAAC
GAGTGTTATTTTCGTACTTATTTGGCATAATTCTTATAATTTTAATTAATACAAACAATT
TAGTGATCTTCATAGTTTTAATAAACTCATTTACTTTTTAATATTTGTTATGTCTCAGTT
TTAATGTTATAGTGAAGGTTGGATATATAAATCCACTTCATATTTTGGTACGTTTTTACA
TCGAAAGAAATTATTAAATATCGCCGTGAGCACGAACTATCGATATGCGGCGGTACAGCT
GGTCGATCTGTCATCTCTACTTCCTCCTATCGGTCTTTTTCAACCCTGCGCTCGCAGCCA
ACAGACCTCCGCCGTTTCTTTTTTTTTCTGCGTTGCGTGCAAACAGACCGACAATATGAA
GGTGTGCTAAAAATTTGTGATAATACTGATATAAATTATATCAATTTGTGAAATATTGCG
AAAATGCTAAAGCGCAAGCATTGGCGCGGTGATCAAACAAATTGCAAGCGAAAATGTCCA
GTGATTGCGTTAAAATAAGTGGATGATATTATCTCCGCTGCAATTCGACTTAATATACAT
TTATATGTATGTTTATGCATTGTGTGTGACTTTTTTTTTTGCATTGTGTGTTCCAGCTCA
ACGTTTCCTATCCCGCGACGGGATGCCAAAAGCTATTCGAAGTGGTCGACGAGCACAAGC
TGCGCGTCTTCTACGAGAAGCGTATGGGACAGGTTGTGGAGGCCGATATCCTCGGTGACG
AGTGGAAGGGCTACCAGCTGCGCATCGCCGGCGGCAACGACAAGCAGGGATTCCCCATGA
AGCAGGGTGTCTTGACCCACGGTAAGTTTGCAATGCGATTTACAATTATGGTGTTGAGCA
GTGAATGATTGTATCTGGCTAGCCGGCATAGGTTTAGTCTTTTGTACGCCTTGAAAGAGT
GGTTCCTATTAAGAAACGTATGGAAATCCTTTTAAGCATTTGTAATAAAGCCTAGCAACC
TGGATCAGTCTTGTGATAATATATCTAAAAGAACATAACCTTAATATGGAAGCGTCTGTG
TATACTTCTGTGCATATTCGTGGCGAGTTTTTCGATTCTTAGTAATACAAAGCGAATATT
TCCAACAATTTAGTTGCAACGTTGCTAGCAGCTAGTAATTTACTATATGTGATTGGAGTA
CGTTCCAAAGATGAGCAAACAATTAGTAGGATAAATTTCCTTAAGTATTTGCAAACACAT
TTCCTTACACCCGAATGGCTAATGGCTAACCAGATAATAACTTTCCAATCACTGCTCATA
TCCATGGACTGCTCTCAAGAAACTACTACAAAAAGCAATCATCTTTTCCAACAGGCCGTG
TGCGTCTGCTCCTGAAGAAGGGACACTCCTGCTACCGTCCACGCCGCACTGGCGAGCGTA
AGCGCAAGTCTGTGCGTGGATGCATCGTGGACGCCAACATGTCTGTGCTGGCTCTGGTCG
TCTTGAAGAAGGGTGAGAAGGACATTCCCGGTCTCACCGACACCACCATCCCACGTCGCC
TGGGACCCAAGCGTGCTAGCAAGATCCGCAAGCTCTACAACTTGAGCAAGGAAGATGATG
TGCGTCGCTTCGTTGTGCGTCGCCCTTTGCCCGCCAAGGACAACAAGAAGGCCACCTCCA
AGGCCCCCAAAATTCAGCGCCTGATCACCCCCGTTGTGCTGCAGCGCAAGCACCGTCGCA
TTGCGCTGAAGAAGAAGCGCCAGATCGCTTCCAAGGAGGCTTCCGCCGACTACGCCAAGC
TGTTGGTGCAGCGCAAGAAGGAGTCCAAGGCCAAGCGCGAGGAGGCCAAGCGCCGCCGTT
CTGCCTCCATTCGCGAGTCCAAGAGCTCTGTCTCCAGCGACAAGAAGTAAACACCGCGAC
ACGGAACCCACATTCTTCGTTTAAGCAGAAACTGAACGTTGATCACAACCAAATGATCCA
CGAGAGGAGAAATAAAACTTTGTAACCATTTATGTTAAATAAACGCGATAAATGGTATAG
AATGTGGTGTGTTGTGTTCAATTATATTGATCGATTGAGCGAGTGTAAGCTTTAGGATAT
ATATACTAAAGTATCGGGTGTAAATGTTTTCATATTGCATGTGATTTTGGTTATGAGCTA
GCCAGCGGCATTTTTTGGTAAGGAAACCATGGAAAACAAACACTATCTTGGAATTCCAAC
ATAAGCCATTATATGGCCAAATCGGAATCGGAAAGAGATGGAAACAGGAAATCGTGAGCG
GATATATGTAGCTATCTCTTGCGATTTGCTGCAGTCCCCGCCAAAACAATAATGGTCCCA
TGTGTAGATTTCTATGTTCCGTATGGAAACCCTTTTAAGCATCTGTAATAAGCCAAGCAA
CCTGGGTATCTTCTGTCATGAGGTTGCTTGTCTTCTTCTGTCATTAGCCAAGCAACCTGG
ATCAGTCTTGTGATAATATATCTAGAGAACATACCTTAAATATGAAATCGTCTGTGTATT
CTTATGTGCATATTCGTGGTGAGTTCTTCCATTCTGAGCAATACAAAGCGAATATTTCCA
GTTGCTAAAAGCTAATAATTAACTATATGTGATTGGAGTACGCTCCAAAGTTGAGCATCC
AATTGGTATAATAAATTTCCTTAAGTATTTGCAAACACATCCATCCATGGACTCCTCTCA
AGAAACTACTTAAAAAAACAATCATCTTTTCCAACAGGCCGTTTGCGTCTCCTGAAGAAG
ATACACTCGTGCTTCCATCCACGCTGCAATAAAGTGCGCAAGTGCAAGACTGTGCGTAAA
TACACCGTGGAAGCCAACGTATCCGCGCTGACTTTGGTCGTTCTCAAGAAGAATCCCTCC
CCATGTCGCCTGGGACCCGTGCGTTCCAGCAACATCAGCAAGATCTACTATTTGTGCGAG
GAAGATGATGAGGTTATCCCTGTTAAGCTGCAGCGCAGGCACCAGAAGAAGCGCCAGAAT
GCAACCAAGGAGGCTATCGCCGAATACGTCAAACTGTTGGTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1460, 1974..2643
1343..1460, 1974..2509
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved