Drosophila_melanogaster Locus RpL17
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL17
Drosophila_melanogaster
RpL17
X
snoRNA:Psi28S-1232, snoRNA:Psi28S-1060, snoRNA:Psi28S-3436a, snoRNA:Psi28S-3436b
1389..1529, 2203..2352, 2378..2518, 2713..2855
4667
TGGTCACTGGTCAGTGGCCATCGGTGAGTGGTGAGCGGTGGAGCACCGCCTCCTTCGAC
CGGTTTGATCCGCAGTCTTATTTTTGATCGCCAGCCGATTAGCAACGGGCATTTTTACGG
TCATGTCCAGAACGAACGCGCTAATAAATGACTAACAGAAAAGGGACAATGCAGTCGGGT
TTATTTTGGCTCGATCGGTTTTATCAGTTCGCTTAATTAAAATCCATTGTCCCCCCAGGT
GCTAGTTATTTTCCATACTTACATATAATCGAAAAACCGCAAAATACTGGAAGTTTCCCA
GGCTTAAGTGACGTCAGTTTTTTGAATCCATTAGCCAAAACCACAAATTTGGATGCTCCG
CCGCTTAATAAACGAACTGTTTCCCACCATTTAATGTGGGCCAATAGAATGCACAAATAT
TTATGATTTAACTAAATTTATTTGATTTTTAAAGCTATGGGAATTTAGGCCCAAGTGAAT
GCCACTATTGTTCATAAATGAAGTGAGTAATTTATGCAGAGCTCTGGGAAGTTTCCATTT
AATCGAAAGCCCTCTACTTATCTCGGCTTCAGTTTAGTTCGATTCCATAAAATCAGGATT
AGTATAATTTGAACGGGATTTCATTTAAAATCCCGCGTTCGGCGCCAGGAAATTGCCAAG
TGCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCTAAAGGTCCCCGGTTCAAT
CCCGGGTTTCGGCAATTCTTAGCTTATTTTTTATTTTTCTATCGAACTGCTGCACTGCAC
TGGATGGTGCAAGCCATCGCTCAGCTAAGCGGGGTGTTAAACCATCGCTTCGCTTTGCAA
CACTGTTAGATCTTGCCAGGGGCGCAGAATTTGGTTTGCGTCCAAAAAAAACCAGGGATT
ACTGGCCTATTTTTAGCCATTTTCTGCAAATGACGGTCGGTCACTCTAATTCGACTTGAT
TTCCAGCACTAGAACTGCCATTTCCTTTCTTTTTCGTTCCACGTTTCCGGTGAGTGCATG
TGCCTAGAAAGTTATTTTCCGAAAATTGCCACTTAAATCGTATTCAAACTCATTTATTTG
TAGCCAAGGCACTGTGGTACGTTTGCGGTCGTGTTAATGGTGTTTGCGGCGCAATTCTGG
CTGGTGGAAATCAACACGTCGAATTGGCCGGCCAGAAAATGCGCTGACACCAAACCAATT
CATTTTTTTTCTTACATATTTTTTTTACTGTGGGCCTGCGGGTCAAAACTGAAAGGTGCA
CCATGTAAAAACAAGCGAATGCATGAATGCATTATATGCCTTGATGGCATTATCTTTTTT
TTTCTGTGAAATATTGTGTAAATTGTTCCAGAAATGCATGTGGTGTTGTCATTGTGTCTG
TGTGTGTGTGTGTGCCTATGCGCGAACATTGTTTCTCAAAAGTATTTAAACTATCCAAAT
AAAGTGGTAACTCAATGAAATGCACATAGTTAGACAGTTTTCAATGGATTTCGACTCGGA
ATCCGTGCAGAATTTTTGTTGTTTACAGGAGCACACACATGCGCACTCCCTTACGCACGC
ACACACACACATAGGAGCAGGCAGCCGCTTAGTTTTTTTTCTCGCTCATTTTGCACGTGT
TTTGATTGCCGCCGCGTTTTTAGATAAAAACCGGTGTTCCAATTGGTTATATTCTTGATA
TATTTACACACGACCGCCAGCGTATTTAGGTTGCCCTCTGAAATGAGAAGGAAATTGGCG
AAAATCTCGCAATTTTCGCATTTTACAATACCGGTCAACATAATAGCAGCAGCAGCAAAT
AAAAGCGTGGTTAATTCAAGCACCAAATTTTGATTCAGCTTGCTACAACAAATTCGAAAC
CTTTAAAGCTTTTTGAAGCGTCTCAAGAAACTCACTAGAATTTAATTCAATTTTAAATAA
TCATACAAATCAATAAGAATCCATTAAAATTCCTTCTGCTAGCGTGCCACAACTGCTGTC
TAATATCTTGACCGGATGTGTTATTTACACATATCAAATATTAAGATATCTTACTAATTG
CCCATGTTTCTTGCAGATATTGAAAAATGGGCCGTTACTCACGCGAGTCAGACAACGTGG
CCAAGTCGTGCAAGGCGCGCGGGCCCAATCTACGTGTGCACTTCAAGGTGAGAATCCTGC
CCAGAAATCCGAGGAACCTGGGCCTTCTTGGGCATCAACCAGTCCGCAGCTTAAATCAGT
GAATGCCAGCCGATTGTGCAGCATCTCGCTTTTGCATTGCTGCTAGAAGAATCCTCCAAT
TTGGACGAGTTCATCAGCTGAGTGCCAAGTCCCAAAACTCTGGACGCCCTCTTCTAAAAT
CTCGCCAACAACCAATTATCCCAATGAATCCAGTATTTCGGCATGCCAACTAAAAAGGCG
GTTGCTCCATTCTGGACAACTGCTGACGATACGTGTGCCCAGAGCGAATCCAAAGCCTTG
CTAAAACAGCGGCCTGCTGCTTTCAATGAGCTAGTCTCTACCTGTAGCCTGGCACAGATC
TAACTAAACCCAAATGAAATCCATCACGGAATCCACTAGATCAAGCTCATATCACCATCA
CCAGTTAGCTAACGAAATAATGTACACATATCTAGCAGCTCAAGCTGATAACTTAACCAA
TAGTTATATGCCATGGGCATATCCAATCCTGTATAGCTTACATGATATGAGTTATGATTT
ATGTTCCCCCTGCATGGGCACAGTTTTAAACTAGGTGGTTATCCTCCATGGAAGATCACC
GATCGAAAGCTGTGCCCAAAGCAAACCCCAGCCATTGTAAAACAGCGGCGTGTTGGCCCT
CAGTGCTCGCGTCTCTACCTGAACCTTGGCACAAAGTAATATAGTACTTTCCAATCACTA
TGATTTACGATCGCGCCGCATTTATGTATCAGCAGCAACTGATGAACGATCATTTACTCG
TTTTGCAGAACACACATGAGACCGCCCAGGCCATCAAGCGCATGCCCCTGCGCCGTGCCC
AGCGTTACCTGAAGGCCGTCATCGACCAGAAGGAGTGCGTGCCCTTCCGTCGCTTCAACG
GAGGAGTCGGTCGTTGTGCCCAGGCCAAGCAGTGGAAGACCACGCAGGGTCGCTGGCCCA
AGAAGTCCGCCGAGTTCCTGCTGCAGCTGCTGCGCAACGCCGAGGCCAACGCTGATTGCA
AGGGTCTGGATGCCGACCGCCTGGTCGTCCACCACATTCAGGTGAACCGCGCTCAGTGCC
TGCGTCGCCGCACGTACCGTGCCCATGGTCGCATCAATCCCTACATGTCGTCGCCATGCC
ACGTCGAGGTCATCCTCACCGAGAAGGAGGAGCTTGTCTCCAAGGCCACTGATGACGAGC
CCGCCAAGAAGAAGCTCTCCAAGAAGAAGCTGCAGCGCCAAAAGGAGAAGATGTTGCGTT
CTGAATAAAATGTGTTCTGGGCCAGCCGCCCAAGCCGGTGACAACTACTGAAGCTCCATT
CTTTTTTTTTTTGTATCCTAAACTTAATATCGATTGTTGTGCGACGAGATTGGAAGTCGC
GGATGTGGAGAATACAGAGCACAAGCCCCAGATTTGACCTCCTGGAAATGCTATGCGTTT
TGTGTTTAACTCAACCCACTTTTTTTTTGCTAGGCTAGGAGAGCAATAAAGTGAATTGCT
GTTTTCGTACATCTGACTTGAACTCAAAATGGGGTTAGGGCTAGATTTTGGCGCTCTCTA
GAAAGGAATTTTTTAAAGGTATTGTGAGGGACTTTGATGAAATAGGAATATGCACGGCAT
AATATGCAAACCACTAATTATATATAAGTTTATTTAGATCGGATTGTTTTTTCCAGTGTG
CATTGGCATTAAGCCAATACACCATCCTTAGTTAGCGGAGACACAATACACATTGGTTAG
TACGTGCGCGAACCATTGCGATAACTTATCGATATCGATATAGCCAAGATCGAGTTCCGC
AACAGCGAGCTTCAGACAGCTAGCCCGTTGAGCGCGCATTTGATTTGAATTTGAAAAAAC
GTTTTGCCGATCAACAGCGAACATTTTCAGTCTATTTCCTTCCGCAGAGCTCTTGTGGAA
TGTTCGGTGGCTTTTGCGCGCATTCACTTGCATCAATTGCCTTCGAGTGGCCACTTGGCA
TATTCATTTAAACTGATTTCATTGTAGCGCACTCGTTTACCAGCCTCCCCACATTTTCTT
TGATTACAATTCAGTCGTACTTATACTTACAATGCAAATTAATTGAATTATTTCAATTTG
CTGTGCTTCTGGCTCTGGTCAGCGTATTTCGTATTATTATTTTCGTGAGCTCTCTTCCCT
GTTTTTGTCTATTTTTGTACTTTTCTTTCCTGATTCACTCGCTGGAGGAATGCCACGCCC
ACAAGCCCTGCTTGATATCAATTCCATTGAAGGAGCAACCCACCGAGAAAAAAGACGGAA
AAACAGGCATTCGGACTCAACGAAGAGCACTTGAGCGGCATAATGCAATAAATGTCGGGT
TTTGTTTTTTGCTTTTCTTGGCGATCGTTGCGATGGGATCTTTGCGGATCTTTGGGGATC
TTTGGGTCTTCTTCTTCTTCTTTTTACCGAGCTTGGATTCAGATACACCTAAACCTAACG
TTGTCCGAACTGAGACAAATCTAATTTACATGATCGCTCGCATTATCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1254, 2056..2146, 2948..3667
2066..2146, 2948..3427
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved