Drosophila_melanogaster Locus RpL7A
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL7A
Drosophila_melanogaster
RpL7A
X
snoRNA:Or-CD10
2585..2651
4272
TTGCTGTTGCTGTCGCGCTATCTCGCTCGCTCGCGAAGATGGGCACAAAATAAACAAAG
AAATTAAAAATGGTGGACCCGCTGCCAGCGTTAGTTATCCCTGATTTTCCCTGGCTTCCA
TTTTCCCGAAGTTTTCGTTCTGGTTCTTTAGTCACTCGGTTTCGTTTAGGCGCAGCTTAA
GAATTCACGTTTGATGGTAAAAACAGTTTTTCTAGCATTTAGCGCAAGCGCAGGCGAGAA
ATTTTTATTGTTGGACAGCGATTTAATGAGAGACAACAGCGGAAAATGGCTAAATAAGGC
CGGATGAAAATACCGCACTGCATCTGCAGCCACCAGTTGGATTCGGTAGTTTCAGGGTTG
GCATAACTGGTTGCTAGCTAGATCTAGCTAAATGTTTAATATTTTTTATTTTCTTTTCTT
GCACTTGAATATAAACAGATACTATTTTTAGCTTGTTAATTAATCAATTAATATATGTGT
AATTGAATTCTATATTGAAATGAAAAAAATAAGAACTTGCAATGATTTTACTTGATATTA
ATTTCAATATTTTTTATTTACTTTGGCAAGTTTAAGCTACTTTTCTTAAGCAACGCGACC
TCCAACACTGGCTGCTTCCAAAGTTTCTTTCTATTTAGTATTTCTTTTCAAGATTTTCGG
TAATACAAATCGGTCACTTTTAAGAAATTCATAATTTGAGCATGTCTTTGCTGTAACGAT
CACATTTGTGGTGTATGTCCTAGATAGGATGGAATGTTAGATATATTATTTTTATTTAAA
CGAAAGGTATTCTGACCACGATTTGATTCGTTTTCAAGCGCTGGCCTATTAAAAAAGAAG
TTACGCTTAAATAACATTGTTTTTTAACTTATCTGATGTACCTTAAAATTTTTAAAACAT
AAATGGAGCGAGTCTCTGCTAAGAATAAGCATAGCCTCTCACCTCGGTATATCGCTTCTT
TTGGCGTTTCGGTGCAAATGTGGCACGGTCAGATCGAATCTACTCGATTTCCAACATTGG
AACTGCCACTTCCTTTCTTTTTCGTTCCACGTTTCCGGTGAGTGCATGTGCCTAGCGAGC
AGTCCTGAATTTTGTGCTAAAAACCAATATTTTATTTACTTTCAGCGAGTATTTCGATAC
GTTCGTGGTCGTGCTTATCACAGGTAAAGCTCACAATTCCAGAAATTCACCCAAAAACTA
CGCGGCCGGCGAAAATGTGTGCAAAACCAAATTTTTTGTATAATTTTTTTTCTGTGGGCT
TCCAAAGCCGGATTTAAATGTGCCACTTAAAAGAACAAAGTGTAAACAACACGTGAAGTA
CGCAGTATACTCCGAAAACCTTTTTTTTTTTTGTAGTGAAATTGCCAAATTCCAACCCAT
TTGAACAAAAATGTGCGTTGCGGCATGTTTTTGTGCATGTGTTGGTGCAGGTGTATGGAG
TGTGTGTGTAGAAGTGTTGTTAAAGAAACCTTAAAACTTCAAAGTTATCAAAATGAAAGT
AATATTTCTTCAATTTAATGAAAACGGAGTAGATTTCTTCGGAAAATCTGCGAAAAAACG
TGTGTTGTTTATACCCAATTATCACACACACACACACACACACACGCAAGCAACATGGTT
TTTTTTTTCTTTCCGTACTTACATTTTTCATGCACGTGTTTTGCTGGTCGCCGAAGTTTT
GCGTGTTTTCCCATTAACTTTACCAAGTTTAAAACGTATTAATGTGCTAATTCTTTTTTA
GCAACTGCTTATTTCGGTAGCAAACTTTAAAACCGCTTGAAAATGGTTGTCAAGAAGGTG
AGTTATCGGCGTAAATTTGCTGTTAACTCGAATTAACCTAATGCGTGTTTTCATTGCGTT
TACAGCCCAGGCCAAAGAAGAAGCCAGTGACCAAGAAGGTGGCTCCCGCTCCTCTGGCTG
TCAAGAAGCCCGTGGTCAAGAAGGTTGTTAACCAGCTGTTCGAGAAGCGTCCCAAGAACT
TCGGAATCGGTAAGTGCACAAAACATATTCTATATATATGAATATTGCAGCGGAATTTCT
TACATATTAGCTAAATGTATACATATTCTCTCACTTTGCAGGCCAGAATGTGCAGCCCAA
GCGCGATCTGTCCCGTTTCGTTCGCTGGCCCAAATACATCCGGGTGCAGCGTCAAAAGGC
TGTGCTCCAGAAGCGCCTGAAGGTCCCACCACCAATCCACCAGTTCAGCCAGACTCTGGA
CAAGACCACCGCCGTGAAGCTGTTCAAGCTGCTGGAGAAGTACCGCCCCGAGTCGCCGCT
GGCCAAGAAGCTGCGCCTGAAGAAGATCGCCGAGGCTAAGGCCAAGGGCAAGGATGTGGA
GCCCAAGAAGAAGCCCAGCTATGTGTCCGCCGGTACCAACACGGTGACCAAGCTGATCGA
GCAGAAGAAGGCCCAACTGGTGGTCATTGCCCACGATGTTGATCCTCTGGAGGTTAGTTT
GACTCAATTGTCGCAGCTCAAAGCTTGCACATCATCCAAATATTTGCAAATTTGCAAATA
TACATGGTTCTCAATCACGTTGCGATGATGAAAAAATTTCTTCAACTCAAGGCTTCTCGC
TTCCGGCGGCTAGCAGGTTATCCTGCTCCGGCGGAGTGGGTTGCTGCCATGTAGAAATTT
GACTCCTGACGCCTTAATTCTTTGTTAAGGATTGCTAAATCCTTGGTTTATCTTTGAATT
AGTTGAAGAGCTAACAACTAGATCTAATAACTAAGCCAAAGATAAAGTTAACATTTGAAG
AATTGAGGGCAACTTGATTGCATACAATGCGCAAGCCCACGAACCACGTGGTTTTCCAAG
ACGACAATTGATTAACGCGTTAATTTCCATTCCAGCTGGTGCTCTTCCTGCCCGCCCTGT
GCCGCAAGATGGGCGTGCCCTACTGCATTGTGAAGGGTAAGGCTCGTCTGGGTCGCCTGG
TGCGTCGCAAGACCTGCACCACCCTCGCCCTGACCACCGTCGATAACAACGACAAGGCCA
ACTTCGGCAAGGTCCTGGAGGCTGTGAAGACCAACTTCAACGAGCGCCACGAGGAGATCC
GTCGCCACTGGGGCGGTGGTATCCTTGGCTCCAAGAGTCTGGCCCGCATCTCTAAGCTGG
AGCGCGCCAAGGCACGCGAGCTTGCCCAGAAGCAGGGTTGATTCAATCTGAAGCCGGTCC
GGTCCGATGGTGGAGACTTTTAAGTACACATGGATGAAATTAGTTGGGCCATGCTCACTG
AATTTGATAACTAATAAACTTTTAAGTGTACAATTTTTTTTGTTTTTTTTTTTTTTAATC
TAAGTGCCTGTGAGAGTGCTTTTGGATGAGTCGATGATTTGGCGTCGGCTTGGATTCAAT
AAATCTAAGATGTATCCATGCCCATCACTCACTTTGTTTTCCGCCAATCGGGAAGTTGTG
CCTGTGAGAAAGAGAAGTCTTCTTGAATTGAATTTGGCCAACTTCCGCTTCTTTGTACCA
TTTCTCTCTAGATGACAACAAATTTCACATGCCATATGTTTCAAACATTTAGCGAACAAA
AGACAAAAGGAAGTACATTTAGTTTTCCATATTTGTTTTTATTTTATAACTAGTGATAGG
AGCAGGGCAACGATTTGTTAGATTTTCGATAGATCCGTCTTGATCCCCAGCTTGCTGCTC
TGAATGGCCTCGTTCAGGATGCTGAGCACCATGTCCACGCGCTCCACGGTAGCGTTTTCG
CCCATTAAACCGATACGGAAGACGTGCTCCACCGTGGGACCCAGACCACCGCTAATCTCA
ACGCTGTACCTGGAAAAAAAGAAAGGATTCAATACGGATCTCTATCGAGGATTCGCGTCC
AGTTGTACAATACTCACTTGCGCATGGCGTACTCGGCCACCTTTTTCCAGTCGACGCCGA
AGGGCACCTTAATCGTGTTCACCGTGGGCAAACGCTCCTCCTCGCGCGACACAAACATCT
CAAGACCCAGCTCCTCGATGCCCAACTGCAGTCGCTTGGAGCACTCCTGATGGCGACGCA
CCACCGCCTTGAGGCCGACGGCACAAAAGTGGGCCAGTGCCTCACGCAATCCGTAGAGCA
GGGTGGAGGATATGGTGTGGTGGTAGATGCGGGGTGTGCCATAGCAACCCCAGTACTGAC
CAATCAGCAGGATATCGAAGTAGTAAACCTTCGGCTTGGTCTTTCGCTTTCGGATGCGGG
TCAAAGCACGCTTGCTGAACGAAATGGGCGTTAGACCGGCGGGACCACCGAGCGATTTCT
GCGAACCCGTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1056, 1125..1162, 1741..1796, 1865..1988, 2081..2451, 2855..3272
1782..1796, 1865..1988, 2081..2451, 2855..3157
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved