Drosophila_melanogaster Locus csw
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster csw
Drosophila_melanogaster
csw
X
snoRNA:Me18S-C1024
8692..8790
21429
CTAAGCTACCAGCCACACTAACAAGATAAACGAGTGGGGGGAAGTACACGTATAAGATA
CACACATAAAGTTGCATCAAGTCCAAATGAACCACATTATATCATGTCTCACATCTCACA
CGACAAAACTAGACGGGGAAGAACAAGGATTCCAGCCCATTTGATCATCGTTAATGGATC
GTTCAGATAGAGTAGTATCCTCTATCTATCTATGAATCACATCTAATGCAAATCTTAGGT
ACCTTTGTTATTAAACGATATGCAAGATATACCTAAAATCGAGAACCTATAAAAAAAGAC
AAAATACACACTCAAGCGAAACCGCATAAATGTTTACGACTTCATATACAACAAATATAA
ATGTATATCAAATATGGTCGCGCTTTATAAACCAAACGTATTTAAAATGTATTACTAAAT
CGCAAATCTTTCAATGGAATGTGACTTTTTTGGGTCTCTGCCGAGTAAAACAAATATTAA
AAACCAAGCGAAGGCTATATAAATCATATAATATGATACAAAATTAAGAAGGGATCCCCT
TCCCCCAATTGTACGCGTATTTGTAAATTATTTGAAATGCAAAATAAATGACAGCCTAGG
ATGGAAATTATATTTATTTGATAAATTAGTAAAAGGAGAACACAAAAAACATAGTTCTAT
GTACAATGGACAAACCGAAAACTTTTAAATTGCTTGAATAAAAAGAAGAAAACTATTTGC
TGACACTTTGCACTTGGATTGGAATTGATTAACGAGGTGATTTTCCCATCATTTTCCATC
ATTCTGAGCATTCTGTGCTGCGAAAAATGATAGTGAACTACTAACTTTGCCCCGACGAAT
CGAATTTTAACGGAATTCTGGACAGTGTGGCACAACGTTTCGAAAATAGCGGGCAAAGTG
AAAAATCAATCTTCCATTGGCCGCATGTCCGTGGTGGAAGTCCGTGCTGAGTGCTCGCCC
AAGATCTGCACCCATTTCGTCTGGCACTTTGTAGTTTTTTTCTTAAATCGACTGGCCACA
CCGCACAGCCCAGTAAAAAAATAGTTTTTTTTTTGTATCCAACCAACCAACTGTAAAAAT
AAGTTTAAACAAAGCATCTACTCATAAGTTTCATTTTTTTCCGTTAAGTGTCAACATTAT
TTATTTTTTAAGTGTGCATTCAATAAGAAAATGTCATCGCGAAGGTAAATCCAATAAGAA
ATACGACAATGTTCCGCACACACACGCACGCAGTCTCGCACACACTCACACACACACACG
GACACACACTCGCAATCACACACGCACGCACGCTCCGCTCCCAACTGGGCTATTTACATA
TGTATAAGTAGATACAAAAGCAAGGCAGAGCGAAAAAGAAACAGAAACAAAAAACAAAAC
TGCTGAGATAAAAAGTGCACCAAAGTGTTGGTCGCGGGGGGGCGCCAGGGTGGATGCAGC
GGATCCGTTGCCTCTGCACTGCTTCATCCTCAGCCTCAGCCTGTTGCCCACCGCGGAAGC
AGTGCGGTAACCAGTGACAATTGACCGAAAACGATGCACACACCCCACTGTGCCCCACTG
TTCGCCACTGTGCTCCACTGTGCGCCACTGCACCTGCCACTGATGACCACTTGGTATGCA
GGGCAGGAGGCACCGGAGGCTGACCACAAACGACATTCGCACAATGGCCAGTGGCAGCTG
ACAACACCCATATGTTTGCCCACCGGGTAACCAGCTCGGCGAGCAGCGACAGTGGTATAA
ACTCTGACATAAACCGTATTCCGTCCACTCCGCAGATGGTTCCACCCAACGATATCTGGC
ATCGAAGCTGAGAAACTGCTGCAGGAGCAGGGATTCGACGGCTCCTTCCTCGCCCGCCTC
TCCTCCTCGAATCCGGGCGCCTTCACGCTCTCCGTGCGCCGCGGCAACGAGGTGACCCAC
ATCAAAATCCAAAACAATGGCGACTTCTTTGATCTCTACGGTGGTAAGTGGCTGCCGTTC
CCTGCCCCCCACTCGGTCACCCAATTCACCACAGTGAATCGTCCTCCCTTTGCAGGTGAA
AAGTTCGCCACACTGCCGGAACTGGTACAATACTACATGGAGAATGGCGAGCTAAAGGAG
AAGAACGGCCAGGCCATCGAACTCAAGCAGCCGCTGATCTGCGCCGAGCCCACCACGGAA
AGGTGAGTCCCGATCCTGGTGGCCAGTCGGAATATGGGATATGGGAACTGGCCTTCTTGA
GCGCTTGATAGATGTTGTGGTTCTTATGTACCTTGATGTGTCGCGGGATTCGGTCTTATA
TCCAAGTCGATTATAACAGAAGGAGAAGATCCTCTAGTCTTACGGCTGGTTGCAACCTTC
TCAGGCCATACAATTGGAATGCCCTCCAAATGGGCGGACTATTTTTTTTTTTCACACATT
CCAAAATGGACTGACGTCAACGGATGCAAGAGATTCACCTAAAATTGGGTCACCAGCCAA
ACGGCCAACCTGTTCTCATCGAATTCAATGACCTACATTAGCTCCATTCCGCATTGCCCA
AGGACGAATCGTATTTGTTTGCTTTCGGGTCGGATTATTATTCATGCACCATGTTTACAA
ACGATGTTGTTTGAGCACTCAAGAGTCCAAACATCAGTTTCGAGCACTTTGCTTATCAGG
CTTTCTCAAACGCTATCGGGTACTGGGTCCGGTACTGAAACTGGGAACTGAAATCGAAAG
TGGTCCAGGGCCATACTCCGCATCCCTTACTCTCCATTTGCGCTGCTATCCCAAGACTTT
TGTTGCTATTTCTACGGCCAACAGCTGTTTAGCTGTTTATTAATTTTTGTGCTAAAAGTG
CAGTTCTTTAACCCAAAAATTTATCATATGCATATATCACATTGGTGAGATATCAATTAC
GATCTAGCTCAGCTATCTCTTCTCGAACAACTAAAGTCTTACTTCCAAACTAGTACTCCG
AACTAAATATGATCGGTAATAAATGATTATTTAAGGAAGAGAATAAACGTAAGATTGATA
TAATTAGAATTGTACTGAGAATGAACCATGTACTAAATGAGAATCAAGCACCTAGCTCAA
CCGTCCAGTAATAAACATGATGTTGTTAATAACCAGTCGAAACTGCGTTAGATCGATGTG
TCGCTGATAATCTGGCGGCGGTTCTTGAAGCTTTGCTCTTCGCAGCTGGTCTTTCTTCTT
GGATACGCAACTCGGTTTCGAGCAGAGATGAGATTTGTGGGTGAATAATTTCTAATTCCA
CTTAAATCGGGCACCCACACACACCTGTTGCTCACGCAGCACCCACACGCACATCCACAG
GCGCAGGCACACGCACACGCACACGCAAGCAGTGACCACCATACAAGCAGTGCATTGTCT
TTGTCGCCGTTGTTTTACTGGCGTTCGTTTTCAACCCACACGCGCGAAATACTGTCGATA
TTTATTGTATTTCTTGCTTATTAATATTTTTAAGCCCGACCGTCTACCCAAGCCGTCAAA
TATTTTACGGCTCCCTTTTTCTTTCTTACATTCTTTCTTGTTTGTCGCCTTGTCTCCTTT
CTCAATGCCGAGCTTGCTTCTGCTTTTTGTTTCGTTGTTTTGCCTCGTGCGCTGCATTTT
CCGCATCCCAACAGGTCAGTCACCTTGACTGGCCACGCCCCCTCTAAAATTTGAAGGCGC
CACGGGAGAGCAATAGAACCCATCTTGAATCGAAACAGTAGAAGTTCGCAATTGTATCTC
AGGAAATTCGAGCAATCAAATTTGTTTTTAAAACTATATGTATAAAAAGCAAGGAAGAAC
CTAAAATTATGCTACGCATTGAACTTTAAAGATTTCAAGATCGCCTTTGTTCGTCAGATA
CGTTTGCCCTAAGCCTTCTTTGCCCCCAGACCTGGTTTCCCAGCCCCTCCACCACTCCAT
ACACTCCATCCACTCACTCATCCTTGGCTGGAGCTCGTGACGATTTTAATTTGTGTATTT
TCGATTGTGGTTTATTTTTAAAGCCCCTCGATCCGAGCGGTGGTTATTTTTACCCTAAGA
AGGTGTTGTATGGCTTATAATCGATTTGCGATTCGCAAAGCACAAATCGTTTGATTGGCG
ATGACGTCAAACGAGGGATGCGATCGAAGGCAATCATAATTACATATATGTATATTTAGG
GGTTGATCATGAGGATATTTACATACATTAAGCTCGAGAACGTCAATCGTCCAAAAAGTG
GGTTTATTATGGGGTGTGGAAAGTTACGCGGTCAGCTTTTTATAAATCAATTCGTCTGCC
TTCTGTTGCGAGCCCAATAAGCCAAGCTAATATGCATAGAATGGGGAATATTAGTTCCAT
CTATGCTTGGCTACTTTACAAAATCGGGAATTTCTATTGAGCTGGCGATGTGCGCCACAT
GAAGAAAGACCCTGGCGAAGGGAGAGATGTGAAAGATGCCATTGGAAATGCATTTGCCTT
CTGAATGGCCCAGACATTCTCCAACATTTACCAACCAATTCGACCGCTTCCAGCAATATT
CCCGCGACATTTCACCATCCGATTGCATTTCCATTTCCATTCCCATTTCCAATCCCAATT
ACATTTCTCGACGTTGATCTTGACCTTTGATCGAGTCAGAACTGCGATTGGAGTGCAACC
GAATTGCAAATCACTCGATGTTATGCGGTTAGGTTGTTTTTGTACACTGTTTGTCTACCT
GCCCACTTAATCGTTGCAATTAATTGCAAGATAATTGTAAATTGCTTTAGTTTCGCGCAC
TTTCTTCCATACCTCAGTCGATCTGTCAAGGAGTAAAACAAATCTGACAATCGTCAATTA
AGCCATCGAATTGTTTGTGCTGGGCAATACTTAATGGATACTGGGTACTAGTGGGTAATG
GCGTCCCACCTACCCCACCTATCCCACTACCCAGATCCCACTTGAGCCCCAGATCCAACC
CCTTCGGGTTCGCCCTTGCCCATCCGTTGCTCTCGAGTGCCTCAAATGCTAAATGCTTTC
AATTTTCGCCATTAAGACAAGCCTACAAATGGTTTATAAATTATGCCGTGCACGTAGCTG
TAGCTGTAGCTGTATCTGTATGTGTATCTCTACCCTCAACCTCCAATGTATCCGGATCTG
TCGCTGTATCTGTATCTGTATCTAAGGCATCAGCAATAACACCAGCGGCAATAAATGTCT
ATAAAGAGTACACTTAAAGAAAAGTACCGTAACATAAACTGTTTCATTTGCTCTAAGTTA
TATAGGAGAAAACCCTATGAAGTTTTTACTCAAACGTTAGAAAATCAGAGATTAGAACTA
GGCGATTGAAGAGCCTTTAAAATGGAAGAGTGGCTATTAACGGTGTACTCTCCATCTCTC
TCTCTCTGTGTGCACATATGTACGCTTTAAATTGGATTGTGCAAAACACGCACATGTACT
CATCCATATGCACGTATTTGGCTGCAGGTACTTGGCCGCCTGTTCGCCCCCACTTGCCGC
CACTCTAACACCAATGCTCGGTGCCCTCGATCGTGCCATCCGTCACATACTCCACAAGCT
GTAGATGCGTCGACCGCGTGGAATTGCACCCACTGCATCGCCATGGCCTGCATGTGGAAC
GGATAGTCCATAGTCCCCGGTCACGCAGCATCATCGCTAGATACTCTGATCATGATTAGG
TAAATTAATGGATCTAGCGCACAACTGTACCACATCAGAAGTTCCAAGTCAACTAGACCT
AGACCTAGCTTGTATAATATCTGTCTAATTCTCGTTGCTGATTGTACTCTAATTGTCGAC
ATCAAAATCAAATATTAATCGATCAACTGCATCGAAACAGACGGCTGAACTGTGCTTCCG
ATTCGATGATCACTATTATCAATCAAACACTGCAGTCAGTGCAATGCAATTTATGGGTAA
ACTTCATTATCGATTTTGGAAAATAAATCGAAATAGATTGCATAGACTGGATTGTGAGCA
CTGGTCATTTGCATGGCCAGCGCATCACACCTGACCCAATGATGTTATGCAAATCGCAAC
TACATTTTATCATTATCACTAGCAACGGCTAGTTTTTGATGTGCTTTCCCTTTGTAAATC
CCACGAAGTGAATTAAATTTAAAACGCACGTATGTATGGTATGTATGTATATGTACGCCA
ATCGAGATGATCGCTCATTATATTTGGTATCCTAAACTGCCCAGCACACGACAATTTAAA
GCTACCGGCACGAACCGCAAATGCGTCCGTCTCGCAATTAAATATTCAGGTAAATCCCTC
GCCAAAACATCGCCAAAACAATGAGCCACAAAGAAAACGAGGAAAGATTCGAGTCAATAA
ATGGGGATGAGGGATTGATTCGACGGACCGAAAATCAAAGTTGTGGGGGGCCAGGCCAAC
GAACCAACGAAATATTCCAACCCAATCCAAAAGGAATACTTTTACGCCGCCACTAAGCAG
CCGTGAGTCCCCTGCTATTTGCGGAGCTGGAGGTTTGATTTGCTTACAAAAAAGTGTTAC
ATGGAAGCACTCACGTAGCATTCCATCTAATAGTATGAATTACGACACTGATCGTAAATC
TCGGTATATATTTTTGGCTGGTGGAGCATGGCAAAAATCGAGCAGTATCATAAATCTCGG
CCGCTATGGGGAAGCCCACCTGGCTACAACTAAAACTGGGCTCGTCTCTCTAGGCTTGGA
GATTGGGAAACGCAACATGTTTGTGCAGGATGCAATAATCCTATAAAACTTTTTACACAT
TATTTCGGTGCTTGAGTTGGTGCCACGAATCCTGCATTGTCAGCAAACAGTATGATTTCT
TGTTAACAAGCTGAGTTTTAGCTAAAAAAAAAAAAAAAAAAATGCAGCCCACGCCCACCG
GCGGTGAATTTATGATTTGTAAATTATTTACAAATAATATAAGTAGTTCTCCTAATTGCC
TCTTCCCGTCTATTTTTGATTTACCCCTTTCTGGGTGGGGTCGCAAAGTACTCATTTTAA
AATTTACCATATAACCAAGCTCACAAATGCCCGGTATAATGGCCCATAAACTATACTCTC
TGGCATTTGCCGCAAAACAGTTCTGTTGGTTTTTGGCTGATTTAGTGCGAACACGTCTGT
ACAGTGGTCCCCGCAGCGACCCACAATCGATTTGCGATTGCCAATTGGCTATTGGCTATC
GGCTATTGGCTTTTGGCGACTGAATAACCCATTTCGAGGAGCTGTCGCCGCGCATTCGGT
CCGGCACGCTTCACTTACGGATTGGGCTTTGGCTTCGGCTCCGCTGGCTGCCATCCCTGG
GTCCCGAGACCAAATCTCAATCTCAATCCCAATTCGGAGTGGCGAACAATCAGTGGTCGG
CACATATGTAGCTGTGTGCCTAGCATACTAACCATCCCCCGCCTCCGACTGAACAATAAA
TTATGTTTATTTCTGGCCCACTCCCCATCGCACCTACGAATGGTTTTGGCTGTGCCCAAA
TGCGGTCTGGGTCTCCAGCAACGAAATCGGGATAGCCAAGGTCGCGGAGCTCAGGAATGG
AGCACTGGGGATACTGGGACTGGGCTGTCGCTCTGGCAACTGGTACCGATCAAGTTTATT
TCTGGGTAGGGCGGCACTCACGGCACTCACTACTTCGCCGGAACTTTTAGTAATTCCATA
CGTAATGTAAACACGTTGGGTAGGCTATTGGTCAATGCCACTTCTAAATTGCGTTACCCG
ATCATTTCTAAGAACTTAAACTTGCGAATGGCCAATGTTGGCCTCGCTCTTAATTCTGTA
TCGATAGCAATCAGGTAGCTCAAATCATCTCTACTCACTTTTAATGCACTTCTCGTCTTG
CATTTGCCATTGCAATGACTAATATTCTTAACCGACACCTAACTGCGCCCAGAAGCCCCA
TGTGGTTTCCACGGATCTGGTCCACCTGGCCTGGAACATCCTGTTTGCATTGATGCATGC
ATGCATAGCTACATGGGGTTTCCCCGACTGGTTTGAGCTGAGCATTTTCAATTTTGATCG
AACACTTCGGAGACAATTTCCATTGAGTGGATTTTGAATGTGGTTTGGGTAACAAGTTCT
AGTTGGTTTCCAGCGAAAAAACAATGACGAAATGTTGGAAAAAAAAAAAATAGTTCGTCA
TCGTTGGGAGGCATGAATACGAGGCTGGAAGTAAAGTGTTGCTAGATCGCAGTTCGCAGG
CTGTCGCACGTCGAACGATTTTGTTTTGCTGGCCAAAAAAAAAAAAAAGATATTCTGCGC
ACGTTCGCACCTCTGACGTCTGCGCCTGCGCTGTAAGAGAGCTTTGGCACTGCTCGCTTC
TAGCTCCCACTTACCCAACTACCAACCTGCCCACCTGCCCACCAACCCACCTGCCCCCCA
GCAAACCCAGTTCCTTGCCTAGATGGCCGCCACAGTAGTTGCTGTGCGGCTTCAGTTTCA
TTTCCGGTGGCAGGCAACGGACGGCGCTAAAAGCGCTTTTTGTATTTGCTTTCTTACAAG
CCAACAACACACTCATATCACGAAATGACCATTTTCGGATTGGAATTAATCTTATGTGCC
TGCTTTTCGAAATGTGTATGATTCGGATTCTGATTGCGATGAACTCCATGACTCATCCAG
GAGTACAGTCATTACGAAATAAACATAGAGTGGAGCCCGCTATACATATTTATAGGTATT
AGCCTGGCTCTAGCACTTAATTGAAAGTAAATGAAAAGTAAAAGTGTAATTTTTTACAAT
GTTGATTGCAATTCAAAGTGCTTTCGCTTTCTGAATAAACCGTAAGTGGCGTCCACAGGA
TGGCTACAATTAAGTGGCGCCCGCTGAGGGGCCCAAGCAGTTTGATGATACTGAAACAGG
AGCCCAGGGGAAAGCTGTGCACACACCCACTGCCAATCAATTTCAAAGTTACGTCTTTCG
CTCCGTTTTATTTACTGTGTTTTTTTTTGTATTTGTTTGTGACTTCTGGCTCGCTGACAG
TAAATAAAGCCCATAAATAAAAACACCCACCCACGAGATCGACAGGAAGGGCTAACCAGA
GCGCCGGCTGGATTTAAAAACAAAAAGCGCCGTCCGCAGCCAGTCAAGATTCAGATTCAT
TCATACCCCAGCGCTTAGAACACCACCAGGCCACAGCTCCCGTCCGAGAGATATAGCCAC
TAAGAGAGAGCGGAAGAATCGAATCGCAAAGAGAGGAGCCGCGCTGAGACAACGTCAAGA
ATCCGATTTCGATTCCGATTGCGATTTCGAATCCGAGGCAAAAAGCTTCAGACTCGGCAG
CAGGCGCTTCATTCTCGAGTTGTGATCCAACGGGTTAGCAGCTCAGCTCGCAAGCAGTCG
CCGTTCGTCGTCGAGCGGCAAGCAGTTCGTTTCATTTCTACTGGGCGCCAGTACAAGTTC
CATCGAGTGTTTTTGTTATTCGAAGGCAAAGCGCGAAAATTATGCCTTCAGCCACATTTG
TCCTGGAGCATTTGATGGCGGCACAATCGCGACTCGACGAGCAGGCCGCATCCCCAGCAG
AGGTCAAACCCACCAGCACCATCAACAGCAGCAGCACCACCGTGGCCAAGGCCATCAATG
TCAAGTCGTACGAAAAGAAGCTGTTGCTGGCTCTCAAGAAGATTGTGCAATAATAAACGA
ATGCGGGGTAAACAGCACTCTATTTGACAAACTGTAGACATTTCCCCTAATCGAGCTGAC
TAAGATCAATAAAAAGCAAACAGAGAAGCACAACAAACAGCGGCAAAAAACAAAAACCAA
GAATTCTAGTTTTTGTGCTTTCAGTGTGTGTTCGTGTGTGTGGGCAAGTTGTTACATAAA
ACAAAAACAATAACAAAATAAAAAAAAAATAATAAAAAAACACCCCAGCCGAGACGCATT
TTTCCGCAGTGGAATACTACTATCTAAGCTTCTTTTTGTTTTGGTGTGTGCGAGAAAACG
AGTGTGAAGAAAATGCTGTTCAACAAATGTCTGGAAAAGTTGTCCAGCTCGCTGGGCAAT
GTGGTCAATCACAAGCTGCAAGAGAAACAAGTCTACAACAACAACAATATCAACAATAAC
AATAACAATACGCTAAACAACAACAATGCCTACAACAATCAGCGAAACTTTGAGTACGAA
AGAGCCATACAGGCGCACTACGGAAGCAAGGGAAGACGCTCGGAGGAGCGCGAAAGGAGC
GGCAAGTTCAAGGCCAGCAAGGGTCGGAAAGCAAAGGTCACCCCACCAACGGAGACACCC
GAGGCCCAGGAGCCGGCCTGCAAGAACTGTATGACCCACGACGAGCTGGCCCAGATCATA
AAGGGCGTGGCCAAGGGCGCTGACGCGCAACGTAATCGAGACAACCGACTGCAGCGCAGA
CGTCGTCCTCTCTCCGCCCAACCCTCCGCCGCTGCCTCCGCCTCCACATCGACGGAATCT
CTGCACCGTCTTACACCCAGCCCGCAGGCTTCCTACCCGGCCACGCCCACCTCCTGGACA
GCCACACCGCCCCAGTTCCCAGCCGCCTTCGGCGGCGCCAGCTGCTCCAACAGCACACTG
TCCCTCTTGGCCACCATGCGCGTCCAGCTCCATGGTTACACGTAAGTTCAGGTCGCCCAA
AAAAAACGACAGCAGTCCAGTCCAGAGTGTTAGAAAAAGAGCAGCGTTCTGCTAATTTGG
GGCGCGTGCGAAATTAGGCACTAATTGTTATTGGAGTGCGAGTAATGAAGTTGTCAGGCT
GCCAACTAAACGATACCCCGTAGCAGGTGAAATGGTATTTTGAGCTACCATCGCATCGTA
GTATGTCGCCCCGCCTGTCAGTCACATGTCGCGGAGTAGCAGATGATTCGCGGGAAATCT
GGAGACAATCTGCTGCCCATCAACATTAACCCTAATAAGGCAGGCAATCACAGGCAGTTG
ACGCCGCAACAAAGCAAAAAAAAAAAAAAATCAGCGCAGCACATACTGTCATGTGTTCAG
AATTGCCACGCAAAATGAGTAAATATTTACGCAAAGCATTCGACTCGAAAACAAGCAATC
GTAAATTGACGTTCTAATATGAATGAATTTCCGACTGTCAAATGCCGAAGTGAAGTGAAG
GGAGTGGAATGGCAAATGGCAGGGGGCCCAGCTCAGATCGCCACTCAAATATGGTCACAT
ATCAACATATCAACCCCCCCCACACAATTGGCCCGTTGTCAAGTTGTGTTTCGATATTGG
TTCTTTCATTTAGAGCTGAAGATTGAGTTATTGGTTAGGCACTGGCTAAATTACGCACTT
GTAGAACCGGGAGAGTTCGGCGAATTGCCCACTGCAGACATCGTATCTTGGCCCACTGCC
AGATCGGAATTATCTCTTCACTCGCGCCCGGAATGTTTACCCATGTCCCGCTGTTGCGCT
GTCCGTCGTCCACATTCCCCAAAGATTCCATCCCACTCCGTGTCTGATCTTGGTGTTTAT
CTGCCCGGCTGTGCCATGTGCCGTCCGATTGTTTGTGTGGGCTGGCCCCATCTTGGCGAT
CTCGATTCGCACAGTACACCCAGAAAACAATCGCATATGTATCTGCTGGACTATTATTAT
GTCCCATAAATTATCTTTGACTTTTAGTTGAGCTCGGATTGGTAGTGCAGTCGGTTTCGG
TTGTTGCTTATTTATTTATTTTGATTTTTATCGCAACGGATTCATAATCGCTGAACGTGT
TGATTGGCTCGTTAACTTGATCTTTGTTTTTCTAATTTATGCTCAGCTTTTATAGGTATC
CTGCTTTAGGGCGATCTTTTCGTCGTTATCCTAAAACGCACATCATGCCAAATGATCTGA
AGATGATGTGCCAATAGCTTTGACAGCTTAAGCTGCGTGATTTCCGGATTTCACTTGTCA
CACTCACTAGGTCAACAATGGGGCACCGCCGTCCTCTGCCCTCCGCCTTGTAGAACTATT
AACCTTCCGATGGTTTTTCTTCTCGCCATAAGGCTGATTAACGATTTATGAAATTACATT
TCCCGTAATGGATTTCGAGCGCTGCCTTCTGTTTTGCATATTTCCGTTTATTTGTCCGTT
GCACAACCGTGAGCTGTGGCTACTGATCAAATAAAAGCGTTTAATTTGTGCAAATTCATA
ACGTCGGCCGACTACAAGATGCTCTCAGTGGAAAGGCCCAATTATGGGGGGGAGGGCTTT
GTTCTGGGGTTGTAACTCCATGGAAATTTTACAATTCTATCCCAGACTCTCCCCAACTAG
TACTTTTCCCCGTCCAGTTCTCCAACTTGACATATCGTTTATATGCTTATTTTAACAGTT
TGAACTGTTCAAAAAATATTATGTTTTGAATAGACTGTACTACTACTTCACACACTGCTT
GCGAGTGGGCGGTTAGGGTAGGGGCAAGCAGCTCATTCGATAATTCAATAAGTATCTTGC
CGACTTTTGAGTTAATTAATTGAAGGCCTCGTTCCCCTGCTTCCGCGCTCCACCTCGTAA
CCCCAATACCAGTCGTTTCGCTGCCGCCTTTCCAGGTGCGTTGCCACACGAAAAGCAAAA
TAAACCTGTGACAAACGAAACGACTAAAACACTGAGGGGGGGATTTGTATATGTATTCGG
ATATTGTGTACGAATACGCTGCACATATTCGTGTGTGCATGTAAATCTGTTTGTTGACCT
TAGCGGCGCTTTCATGAATGGCGCGCAGCTTCCTCCGTATGGTAAATACAAATACGCCAC
ATTCGCATTCGCTGCTGTAAGTGTAACTGTAAATGATGCAAAAAGGTGCAAAATTTTCAC
TGACGTACTCGGGTGATGGTAATTCCATCTGCTTGTATTTTTAACCCCCAGTCTGCCCGA
TTTAAATCGCTGAGTGAGAGCGCAACAGAAGTAATTTGTGTTGCTTTGTATTATCGTCAC
AGTGCTAAATTTAAAGATAAACACCGAAATATGGGTGGAGACGGAGACACAGTTTGGCAG
CACCGCAGTTCGGCAGAATGACACAAAGGATATCAGCGATATGATCGATGTGGGCTGCGA
TAATTGCTAAGTTCAACTCGATTGCACGGGGTCAGACGGCAGAGGGCGATGCGTCCACGA
ATCCGAATCATTTTAACTACGGCGATCGCAAACAAGCGATCGGCCAACAATACGCAAATG
TGCTAATAGATGTGGTCCGAAAACTGTGAATTGTCTTATGCAAATAACTCGGGAACCTTT
CCATACGCAAATCGTGTGTGTGTGTGTGTGTTGAATCATCCGAAAGAATGCGCAGTTCGT
ATTTACGAATATCGGAAATCGGAATCATTTTTCCAGAAATTCTAACTTTTGCCTAAATGA
AGATAGAGTAAAAACTGAGGTTGGGATGCTATCGATTTGGTGCAAGCAGTGCACAGTTTC
CGTCTACGTGAAAGCAAGCAGTGCATATAGACCTGCTTGTAATAGATTTATAACTTCCGT
TTTGCTAAAAATAAACCCATCAAACTCATTCTTATCACTCGCAACCGATCGGCTTCGCAT
TTGGCCACCTTGAATCTGTAACAAGCTAGCAAAGCAGAGCGAACGAGCGAGTGAGCGAGA
GGGCCAATGTGGAGAGTGAGAGATGGTGAGCGAGACGGGCGGGACAGCATGAAATGCCCG
ACAGTTTGTGGCTCTAATGTAATGTTAATTGTTTCCACATGGACTTCTATTAATAGCCAG
GCCAGCACACGGAAGATGAATTGATTTGGCTGACTAAAAAGCAAATCAATATGCACAGAA
AGCATTTTTATTCAATATCGCCGGTACGAAAACTCTACGATATGTGCCGTCAACATGGCT
AAATAGTGTTTACTTCGCTTCGTCGAACTAAAAGACGTGATTTCTTCCAGCGGAGAATTT
ACCAATTATCATTTGAAAATTACATATGCATTGTTTTCTGTGTAGCGGCTCCTAGCACTT
GCCGCATACATTATACATGAGTTTTGAGTATTAGTTTTAGTTCCCACACCCCGATACACC
GAAAATCCCCCCAAAATTCTCGCCACATCGATGACATATTTTATGATATCTATGACCCCA
GGCACTAAATTGAAACCGGCTTAAGGACAACTCAATGTTGTCAATTGTTTCTAGATTTTT
GCTCGAATTCCGTATTTTTGCGTTTGGTTCGCTCAATGGCGACGAACTCGAAAGCGGGCT
AAGAGATGGACAGCACAACAGCAGCACGCGGTCTATAATGACATTCAGAGCAAGTTGTTT
TGGGCTAGTGTTATTTATGCAAATCAGTAGGAGGGAGGCAAAGCAGATCCAATGAACCCA
TTGTGTGTAGGCCAACGGCGGACATCGGTGTGGACATCGAAGTGATAGAAAGAGATGATT
TAGTTTCGTTCGACAGAAACAGAAACAGAAACAGAAACACCAAACTCAACTAGTGCTCCG
CTTAGTCGAGCTCTATTTGAGTCTAAGCCGACTTTAGCCGCCTTTTTCTGTGTCACATGG
GCAAAAATGCGCTTCCAACTGCAATTGCCATGGCGATGACAATCTCAAGTCTGTCAAGCC
AACTAAGCTGAGCAGGCCAGACGGGTAGACTTATAAGTCCCGGCCCCCAGTAGCTGGCTT
CGACTCAACTTGCGCTTTTCCACACGGCGTATGCGTGTTTTCGCCACTATTGCCGTTGTT
ATTGCATTTGTCGCCTTGCATTTGACTGTTTTCTTCGAACTTTTGCTGGTGTGTGCTTTA
GCACATATTGTACATATACGTACAGTAAACCCTCCTCGCAGTGGGCCCTAAAAAGCTCTA
AGCTATGTTTACACGTTTAGTTCTAGTCGTCAAGACCTGGGAATGATTGCCTTTGGTTTT
TGCCAGATGTTGGGTTTACTTACTAATCCTATTCAAATGAAAAGACTGCGGCCGTTCATA
GAGTTCCACCCACTGAGTAAAGACCGTACCCATATTCGATTCGTATTGCGCTGTTTGTTG
CTGCTTTTGCTGTTGGTATTGCGGTTGCTGCTGTTGTTGCTGGCTCTAGTATTTTGCGCT
TTTGTGCGCTTCTCGTATAGTTTGTAATTGCATTTTGAGCGCTCACGTAGTCGCCAGTCG
AGCACTCAGTCAGTCAGTCAGTCAATCGCTCAGTTCGTTCAGTGGATGCGCCATCGATCG
GTACATATGAATACATATCTACGAATAACAGTCGAACTAATTTAGTCATATATCCTAATA
ACCATCCACCTCTTTCTCTCCGCAGATGGTTTCATGGCAATCTTTCCGGAAAGGAAGCGG
AAAAATTGATCCTGGAGCGGGGCAAGAATGGTTCGTTTCTCGTCCGTGAATCTCAGAGCA
AGCCTGGCGACTTCGTCCTTTCCGTGCGCACGGACGACAAAGTAACGCATGTCATGATTC
GATGGCAGGTATGTTGAATACGTAACCCCAACTAACCAGATTTTGTAGCCGCCCCTTGCC
CCGCGCCCCTCGCAGGGTGCAAAATGCAAATGCAAATCGATGGCAGTGCAGCAACAAAGT
CGCACTGGCCATAAAGTTCCTCATAGCGCGACCTTGGCTCTACAGTCGAGTCGTATGTAC
ATATGTATGTGCACATAAACTCTACAGTTGAGCCTAACTAACAACGATGCTTGCTCGAGC
GGAGTGGCAAGAATATTATAAAATCAATTGACAATAATATATTTAAACTCTTTCATCTTG
AACGCATTTGGCTATCCGTAATTATCCGTTAACATTATCGAAGGCCTACTGTATAAACTC
CGAAACATGCCTGCTTTGCCTTGGCGCGGGCAAACTGCTTGCGCCAGGAGCTTCAACCAG
GTCAAGCAGTGCAGCAGTTCCAGTTTCAGCGTAATTCCCCTAAAACAATTTTTCCACTAT
TACTATAACTTTAGCCGTGAGCGCGGTTTCTGCGGTTTGCGGCTGCAATTATGCCATTTA
CATGTCTAGCTGGCCTTTTTCCCATTTGACATTGAAGTCACGTTTTCGATTTTATTAGCT
AATCTCTCGACGCTCCATCGAACTCGGAGATAGAGACTCTCCACCACGTGTCCCCCCATT
AGAATGCCACGATAACAATAGAGTGATTTCCTGATTGCAGGACAAGAAGTACGACGTCGG
CGGCGGGGAATCCTTTGGCACCTTGTCGGAACTGATCGATCACTACAAGCGTAATCCCAT
GGTGGAGACGTGCGGAACCGTGGTGCATCTGCGACAGCCATTCAACGCCACACGAATCAC
GGCGGCCGGCATCAATGCCCGGGTGGAACAGCTGGTCAAGGTGAGTTCCCTCTCTCTGAT
AGCAGTGATTCTGGAGCGCACTAATCCCGAGGTGGCTTTCGATTCCAGGGAGGTTTCTGG
GAGGAATTCGAATCGCTGCAACAGGACAGTCGGGACACATTCTCGCGCAACGAGGGCTAC
AAACAGGAGAACCGCCTCAAGAATCGCTACCGCAACATATTGCCATGTGAGTATAGAAAT
CCACTAAGATCCGTTAGGACTCCCAAAATCCTGACGGTTTAAAACAGTTATTTCTAACTA
ACTAACTAACATTAACTAACAAATTTCTAACCTATTTCCCTGTCCGCTTTCCAGACGACC
ACACGCGCGTCAAGCTGCTGGACGTGGAGCATAGCGTGGCCGGAGCCGAGTACATCAATG
CCAACTACATACGGCTGCCCACCGACGGCGACCTGTACAACATGAGCAGCTCGTCGGAGA
GCCTGAACAGCTCGGTGCCCTCGTGCCCCGCCTGCACGGCTGCCCAGACACAGCGGAACT
GCTCCAACTGCCAGCTGCAAAACAAGACGTGCGTGCAGTGCGCCGTGAAGAGCGCCATTC
TGCCGTATAGCAACTGTGCCACCTGCAGCCGCAAGTCAGACTCCCTGAGCAAGCACAAGC
GGAGCGAATCCTCGGCCTCTTCATCGCCCTCCTCCGGCTCTGGGTCCGGACCAGGATCGT
CGGGCACCAGCGGAGTGAGCAGCGTCAATGGACCCGGCACACCCACCAATCTCACGAGCG
GCACAGCCGGATGTCTGGTCGGCCTGCTGAAGAGACACTCGAACGACTCGTCCGGAGCTG
TTTCTATATCGATGGCCGAACGGGAACGCGAGAGGGAGCGCGAGATGTTTAAGACCTACA
TCGCCACCCAGGGCTGTCTGCTCACCCAGCAAGTGAACACGGTGACGGACTTCTGGAACA
TGGTCTGGCAGGAGAACACGCGGGTGATCGTCATGACCACCAAGGAGTACGAGCGCGGCA
AAGAAAAGTGCGCCCGCTACTGGCCGGACGAGGGTAGATCGGAGCAGTTCGGCCACGCGC
GGATACAGTGCGTCTCGGAGAACTCGACCAGTGACTATACGCTGCGCGAGTTCCTCGTCT
CGTGGCGGGATCAGCCGGCGCGCCGGATCTTTCACTACCATTTCCAGGTGTGGCCGGATC
ACGGAGTGCCCGCCGATCCGGGCTGTGTGCTCAACTTCCTGCAAGATGTCAACACGCGTC
AGAGTCACCTGGCTCAAGCGGGCGAGAAGCCGGTAAGTTTGACTTCGATCATATTTGGGA
CATCATTGGCTCTAACCAAATACTTCTATATATTTATTGATTGTTCGCAGGGTCCGATCT
GCGTGCACTGCTCTGCGGGCATCGGTCGCACTGGCACCTTTATTGTGATCGATATGATTC
TCGATCAGATTGTGCGCAATGGTAAGTTTGAACGGTTAAATGTGGTCAAGAATTGATAAC
TGAGAAAGAAGACAATTCAAGCCACATAGATCTTGAACCTTATTAAAGCTCTTTTCCCTA
TGTGTTTCCTCACAGGATTGGATACTGAAATCGACATCCAGCGCACCATTCAGATGGTCC
GATCGCAGCGTTCCGGTCTTGTGCAAACCGAGGCGCAATACAAGTTCGTCTACTATGCGG
TGCAGCACTATATACAGACCCTGATCGCCCGGAAACGAGCTGAGGAGCAGAGCCTGCAGG
TTGGCCGCGAGTACACCAATATAAAGTGAGTGGATTACGAGAGACTCCGTAAGAGTGTCC
GTCTAATGGCAACCTTATCCCACCATCCAGGTACACGGGCGAAATTGGAAACGATTCACA
AAGATCTCCATTACCACCAGCAATTTCTAGCATAAGTTTAGTTCCGAGTAAGACGCCACT
GACGCCGACATCGGCGGATTTGGGCACTGGGATGGGCCTAAGCATGGGCGTGGGCATGGG
CGTCGGCAACAAGCACGCATCGAAGCAGCAGCCGCCGTTGCCGGTGGTCAACTGCAACAA
TAATAACAACGGCATTGGCAATAGCGGCTGCAGCAACGGCGGCGGGAGCAGCACCACCAG
CAGCAGCAACGGCAGCAGCAACGGTAACATCAACGCCCTACTGGGCGGCATCGGCTTGGG
GCTGGGCGGCAATATGCGCAAGTCGAACTTTTACAGCGACTCGCTGAAGCAGCAACAGCA
GCGCGAGGAGCAGGCTCCGGCGGGAGCAGGTAAGATGCAGCAGCCGGCGCCGCCGCTGCG
ACCGCGTCCTGGAATACTCAAGTTGCTCACCAGTCCCGTCATCTTTCAGCAAAATTCAAA
AACATTCCCAAAGACATGATCGGCTTGCGACCGCCAAGCCATGCGCCTGCGTTGCCGCCG
CCACCGACACCGCCGCGCAAAACATGACAAATGAATTTCTAAGTCGCGACGCCCCCTTGA
CACGCCCCCTTGACACGCCCCCCTGACACCCACCTCCCTCCACACGCACACAGACCACAT
ATGGTTTTCATTTTAAATGTCACCCAGCCGCCGCCCCAAACCCAAAACCCAATCCCTCGA
CTATGTTTTACTGTTGTACCACGTTCTACGTTTTTTTTTTTTTTTTATAATTGTAATCTA
TATACTTTTTTGTAATTGTGTGTAATGTAATGTTTAGTTTTATGTTATTGTCTCGCTTTA
TGTTGTAAGTGTTCCCTGCACACGAAAAGCAGTAACCCCACCACCACCCCAAAACCCAAA
ACCCAGCATATTTATGTAGTAGTATTGTAAGAATCCCCGAACCGGTAGTTGAGGATACAA
TCTGGGCGGAACTGCAGCAGATCCGCCAAAAAACAAAAACACATTTTTAAGCAGAATCGC
AGCAACAAAATATAACACCCGTTCCCTGTTCCAAACCGCTTGAATTTGGTGGAATCGGCC
TTGATAGTATTTCACTTTCTTGAAAATATTCGCTTTAGATAAGAAAATTGACTTGTGACA
AATATTTACATGTATTGCGCTGGTTACAAACCACAAAAGTTGCTTAACTTTAAATTTTAC
GAATCGACATTTATGATATTTCGCATGCTTGAAAATAGTTGTAGTTTCCTATTTGGGAAT
CATTGAAAAATCCATTTATAAAGCGAAATCCAGTTCTGGCACGTTCAATTTGAATCGGTT
AATTTCTAATCTAGTTGGCGAAAAAGTGAAGAAAAGTGAAGTCCACCTCCTCCAAATTCA
ACTTGAAACGGAAACGGGTTACCGGTTGGAGTGCAAATAAAGTTTTTAGTGTAGTAAGTG
TTGACAAAATCGATAGAGAAGAAATTAGAGGAGTAACTGAGGCAGTAAGCACGTAACGAT
AATGATACAAAAAGCGTTGATTGTGATTCGAGTGACAGCGAGAACAGAAACTGAAACAGT
AACAGTAACAGTAACAGATGAGAACAGATGCGAATGGGATCAGTACAGAACAGAACAGAA
CAGCGGAGACGCCAACCGAACAGAACAGAAATGAACAGAAGAGAAGAGAACAGATTAGAG
GTAAAAGAAAAAGCTAAGAAGCGCTTAAGCGTGTCGTCCCTAGAATAAGAAAACTAATAT
TACAGCTCCACAGATCCAGATTCAGATCCAGATCTATATCTCTAGCAGCCAATTTCTGAT
TTCCCCTTCCCTCTTAGTTTTCCCATTAATTTAGTGATTGTGTGTATATTTTTAATTGTA
TATTGAAGATTATTTATAGCGATTGTCCATTGTGTTACATTTCAAATGTTCGAAAGAATT
GTATTTAGAAAGTTTGTACTTTAGAAATTATGCATTAATTGTGTGTCTGTGTCTCTCTAC
CCAGTCTCCCTATCTCTGTCTCTCTCTCTCTCTCTCCCTCACTGTCTATGCACGAGTGTT
TTCTTAACTAAGTTTATTATTTCAACGCTGAAGCGTAATCAAACTATATATGCAATATTT
AAGCACAGTACCTTGGGCGCTGCAAAGAAATTAAAAAATTTTAAAATAAAAACAAACTGC
TAAATCATAAATACAAAATATATACAGGAAGGAATAATAGCAGCGAAATGTAAATCAATT
AGATTATTGTGCAAATTTGAGTAATATATTTAAAACATACCCTTATTTTATCTTATTTAA
CTTTATGCTTTTGTAAGTGCTTTAAATTGTTATTCATCTTGATCTTGCAAAAAAATGAAA
AAACCACAAAACTGAAAAACGAATACAAAACTAAAAAACAACACAAATTATATTTGTATT
TATACAGAAAAATAAAACATTTTATATGCGATACACGATAGCACATTATTTTTTATTTTC
CCTGCATGTTTGTTGAACGCTTTTCCCTTTTTGGTTCTCAACTTCAGTTATGTTACCACA
CATCACCAACGAACTGAAAGAAACCCGAACACTTTGGAACATAGCCTTATATAAAACGCC
TCGACGACCAAGACGGAAAGTTGAATCACACCACGGAGAAGAGGGAGACATCTCCCCTCT
CCCAGTTAGAACAATAAGTAATCATGTGTTCACCCCCACCACCCACACGAATCTAAACTG
ACCCCTGACCTTCCACCAAAGACACTAGAATAATATTATTCTAATGTCTTTGCTTCCACC
CACCATCTGAGCACTAGCGGGTGATCCCGATCGGACGACAAACGTGTGTGTAAGTGCGTG
ATCTAGTACTTTATATAGTTAGCCTATAATACGATTATTCAAACGGAATATGTCGAAGCC
TGGCTTCGACTGGGCGGCGACCTAGTGGCCCCCAAAAAACGAAGGTGAATCCGAATATGA
ATCCCACTGGGGATACGATATGTTTTGATCTTGGAGCGCGGGGCGAACAAAGTCGCGCGC
TTCTTGTGTTGAATTTTTATAGCATATAGAAAGAGGTGGATATCGGATATGGATATTGAA
GAACGCAGTCCAATGGAGCAGCCGGCGGAGGGAGAGATGAATGCCAAAGCACAAAAGCCA
ACAGCAACAAAACACCAATAGGCCTCATCGCAGTCATTTGACCACAAATCTGACAAACAA
CGATGTTATAATCAATAAGAGCGAACCAAAATCAAAATAACGACGTGAATATTGAGGGAG
GGATCGATGGAGACCCAAACACCAAAACAAAAAAAAAAAAAAACAAAAAAAACAAGAGCA
AGGAAACGCTTTAAACTTAAATAATTCTAAAATTGTATCTAGGCAATATCGAAATGTAAA
CCACACACCAACTATCCATAGTAGACAAACAAACAAACACCAAGAAAAAATTGCTTGAGT
GACTTACTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1183, 1775..1962, 2035..2161, 15145..15307, 16000..16179, 16248..16365, 16494..17431, 17510..17600, 17715..17904, 17970..18388, 18469..20429
1170..1183, 1775..1962, 2035..2161, 15145..15307, 16000..16179, 16248..16365, 16494..17431, 17510..17600, 17715..17904, 17970..18388, 18469..18563
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved