Drosophila_melanogaster Locus sta
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster sta
Drosophila_melanogaster
sta
X
snoRNA:Me28S-G980, snoRNA:M
1392..1462, 1431..1529
3233
AGAAACCAAATCACAAGCATCAATTGAAGTCGAATCAATTTTTAAACGCAATGATATGT
ACACCTCCCCGTGCATAACGCATAACGCATAAAGTGGGACAGAATTCGAATCGCAATCCA
AAAACAAAACAAAAGTCGGTCGCCAACTCCTGTCCCCAGCCAGCAACTGAGCGAAGGAGG
GATAGGAACGGGACGGAACGGCACGGCACGACGACCGATCGTATTTCAAGTTACTAACAC
AACACAATTTTTTAACCACGCAAGCGGATCGAGAGAAGAAGCGTTTCACGTACTAATCTA
AGCAAATGGAATATGCGTACATTGTTGTGGTAGTTACAGATGGCGAGGAGCATACACGTA
ATTAAAATATAAACAAACTTGCAATAAATGTGTATACAAAAGGTATTGCGTTGCGTCATT
GGGAATGGATGGGAATGGTATAAAGTCTGATTGCCGAACTTACCACAGATAGATGAAATC
ATTCGCCGTCCCTCGTTTGAACTGCGAAACTCACCACGATTCTACCGATGGCCCGGGAAA
AGTCCGCGCACTTTAATCCATACACTTTCCGCGAAAATTTCGATAGACTGATTCTCAGTG
TGACCGCTCTGCGTCGGAGTGAAAAAACCGAAAAAGTCGGAACGCGTCGCGATACGGAAA
AAAACCGTTTAACGCGAACGCAACACCGATTCTCTGCATGCCAACGTCGCCAACTTCAAC
CCGGAAATCGGCCATTTTGTCAAAACTCCCAGCGGCATCTAGACGTAAGTAGTCCGAGCT
CCTCCGAAATGCTTAGAAATACATGCGAAATGAGTACCGCCTGCAACACGCGACGCCTGA
ACGCACTCCGGGTGCCTTCAAAATTCAACGACTGCGCCCTAGGCATCTAGGCAAGAAATT
CCGAACGCCAGGTCTCTAGATGTGCCGCGGTGCTCCGATGTTACTCCGAAATCGGTTTCG
CCTGGGCGCATCCAACTTCTTGCCTTGTGACTGCTGCCTCTATGTGCAGACGCCTCTGGC
GGCAGGCGCGACACCGGCGAAAAGTCGCACGTGGAGCCCCTTCTTTGAGGTTATGTCCAC
TAACCATATGCCTGTCTCGTTCACAGGTCCGTAACTCTTTCCACGTTAACATGTCGGGAG
GCTTAGATATTCTGTCCCTCAAGGAGGACGACATCACCAAGATGTTGGTGGCCACCACCC
ATCTGGGTTCCGAGAACGTCAACTTCCAGATGGAGCAGTACGTGTACAAGCGCCGCGCTG
ATGGCGTCAACATCCTCAACCTGGGCAAGACCTGGGAGAAGCTGCAGCTGGCGGCCCGCG
CCATCGTGGCCATCGATAACCCCTCGGACGTGAGTACAAGTGCAGAATTCCATGGCATAC
CAGTGCGGCGTGGCTAGCGTGATGAGTTTATTACTAATCTTTCGGGTATGAAATTCAATG
ATTTCAACTTCACTGCTGACCAGCCACGCCTCAACGCCTCGGAGTGTTTGCCCCCAGTCT
CTGATAGATACACCATATTCTAATACACACTTATTTTGCAGATCTTCGTCATCTCGTCGC
GTCCGATCGGCCAGCGCGCGGTGCTGAAGTTCGCCAAGTACACCGACACCACTCCGATCG
CCGGCCGCTTCACGCCCGGTGCCTTCACCAACCAGATCCAGCCCGCTTTCCGCGAGCCGC
GTCTGCTGGTGGTGACCGACCCCAACACCGATCACCAGCCCATCATGGAGGCCAGCTACG
TGAACATCCCCGTGATTGCCTTCACGAACACCGACTCGCCTCTGCGCTACATCGACATTG
CCATTCCGTGCAACAACAAGTCGGCCCACTCTATCGGTCTGATGTGGTGGCTGTTGGCCC
GCGAAGTGCTCCGCCTGCGTGGCACCATCTCTCGCAGCGTCGAGTGGCCCGTAGTCGTCG
ATCTGTTCTTCTACCGCGATCCCGAGGAGGCCGAGAAGGAGGAGGCCGCCGCCAAGGAGC
TGTTGCCGCCACCCAAGATTGAGGAGGCCGTCGACCACCCGGTCGAGGAGACCACCAACT
GGGCCGATGAGGTTGCCGCCGAGACCGTTGGCGGAGTGGAGGACTGGAACGAGGACACCG
TCAAGACCTCCTGGGGTAGCGACGGCCAGTTCTAAGGAATCGTCCGGGCCACAGATGGCA
CTACATCAGCACAGCGTTTTGTCAGGAGCCTTTTCAACGGCATAAATAAACAGCTGTTTA
TATCTAAACACCTCGTTTTTTTTTTCTGCATAGCGTAGCCCAATATCACGTGCTTCCACC
TTATTATGCACGATATATTTACTAGTATCGAAGCGATCTAACGCATTTCCATAGCTGGGC
TCTACTGTGAGTGCCAGAAATTCTGAGAAAATAGGAACCATTCAAAAGAAATGAGACAAA
TTTTCTTACGGATCCCCGCCCAGATTAGAGGGAGACAGGCAGCTCTCGCTGTTGCATTCC
ATTCTGGCTGCAGAGAAGGGCGGACGATATATGTATGAACATATGTACATATGTATGAAC
ATATGTACATATGTATGAACATATGTACATATGTATGTACATACATATGCATTATCCATG
CATACGAATGGCAGTCTTGTTCAATTTACAGTATTAATTTATTGTTTTTTGGGCTTTGTA
CAAATAGAAAACAGTTAATGATCGCAATTGCAAATTGCTTATGTTGTATACATATCCATA
TAGTTTATCCTCTCGCCAAACATACGATTTTAGTGGTTCTTATCCGCCAAAAACGGGAAC
GATATATGCGTAAAAGTAATGTTAATGTTAAGAGACAAAAATTGTGTTAATCTGGTAAAA
CTATGCATCGGTAAACACGATTATGTGTAGCATCGACTTCACTTCATTTAAATTTGGACA
GGGCTATCAAACGTTTGGTAGTCGATTGGTTCCGTCGAGCACTATTTAAATGGATTCGGA
CGAGCCTTGAATGCCGTCATCTTGCGCAGCTCCTTAATCTCCTCCTGCTCGCATCGCTTC
CGTTGTTCGTCTTGCTGCAATGGCAAAGGCGGAAAGGAACACGGATTAGCATTGAAATGT
ACACATTGGTCGTCGGCGGTCTGGTGCAGTGGAAAGGTGATGAGTATGTGTTGATTGCTG
CTGTAGTGCATTCTAATTGCGACTGAACCTGGCGTACGCAACCTTTGTCTCTGGCCACTC
GGAGAGATGCATGGATGACTGTCCGCCTGACTCATTCAACGCCCGGAGGCAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1348, 1541..2233
1001..1348, 1541..2131
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved