Drosophila_melanogaster Locus RpL22
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster RpL22
Drosophila_melanogaster
RpL22
X
snoRNA:Psi28S-2179, snoRNA:Psi18S-531
2054..2198, 2906..3057
4580
GTGAAGTGCGCACAGAGATCAGGACTCTGGTGCCCAGCCAATCTGGGCAGTTAAAAAGC
GGCAAACACGGGTCGGAAACAGAAGCGGCAGCGAAAAGTATGACTTGAATGCACGCAATC
CCCAGGGCGCCACAAGGATCAAAATGAATTGTTAGTACGAAGTGGGGAATTCATGATTAC
TGGAAATAGAAATAGAAATAGAAATAGAATACTGGAAATTATGCGAAGCTGCTAGCCGAA
AACGGGGCGTGGCGGAGGAACCGGATCGAGATTGGAAGTGGAAGAGGGAAGGGAAAGGGG
CAACACGTGGAGCGGGCGCAGGAGGCAATCAATCGGTTTCCTTTTCGGCAGAATGCTCAT
TATCGCCAATTTGTGGGGGCAACCGCGGGGCGGTTGAAAAGCAGATCTGCACTGAGAACA
ATGCAATGTCGAACTCCGCAATTGTGATTTTATGCCGCGCAAATGGCGCTGTGATCAGGG
TTCCAGCTAAAAATTAAATGCACGTCCCGCGGCTTCTTCTCCTCATCATCCTCTTTGTCT
TCTCTTCATCGTTTTTGCTTTTTCGCTGCTTCTTCTCGTCTTGCTCCTCGCCATAGTTTT
ATGATATATGGTCACAGGGGCGGGCCAATCTCGTGGCACGTTCGGGGTGTTGGTAATTAT
AGGACTTTATGTCTGGAAGTTTCTTTATGATGGCTTTTACTTTCAAGCGCAATTCGAGGG
ACGTTAGCGTTGTTGCGGCATAGCAAGGCCTTGTTCGCATATTGACCATAGGTTTTAATA
TTCGCTGTACGAAAGGCTGTCTGAATAGTAAGAAAACATCATTTTTTTAAGCAGAGTATT
CATTTTTTTGCTGAACGCTGGGAACATAACTGCGCATTGGATTGGAACACGGTTGCGGGA
TAGCGGAGTTCCCAACCCAGGGATGCAATTGCAGCGTGGCTTATCGGAATACGGCGTTGG
CGCGCTGCGGCCACACCAACCGTCTCTTCTTCTTGCCGTCGCTTCCGCCTTCTGTTCTTT
TTCCTCGTGGTTTTCGACTGACAAGATGGCTCCTACCGTAAGTGCTCCGAAATATGAGTT
TCGCGACTGGCCACCGGCGCCCGGGAGCTCCAAGTTGTGTAACTCTGCAGCGGAAAGCCC
TAGTCGGTGGCCAGCAGCGAAATATTCCATTTGTCGAATGTGCGTGTGATTTTTTTTGCT
TTTTTTTTCGGTGAGCAGGCCAAGACCAACAAGGGTGATACCAAGACCGCTGCCGCTAAG
CCAGCGGAGAAGAAGGCCGCTCCCGCAGCCGCCGCCGCCAAGGGCAAGGTGGAGAAGCCG
AAGGCTGAGGCCGCCAAGCCCGCCGCCGCCGCGGCCAAGAACGTGAAGAAGGCGTCCGAG
GCGGCCAAGGATGTAAAGGCAGCCGCCGCTGCTGCCAAGCCCGCGGCAGCCAAGCCCGCA
GCTGCCAAGCCCGCCGCCGCTTCCAAGGATGCCGGAAAGAAGGCTCCCGCTGCCGCTGCT
CCCAAGAAGGACGCCAAGGCTGCTGCTGCTCCGGCTCCCGCCAAGGCTGCTCCGGCCAAG
AAGGCTGCCTCCACGCCTGCTGCCGCTCCCCCAGCAAAGAAGGCTGCTCCCGCCAAGGCC
GCAGCCCCGGCTGCTGCTGCTCCCGCTCCGGCTGCAGCTGCTCCTGCTGTCGCCAAGCCC
GCGCCTAAGCCGAAGGCAAAGGCTGCCCCAGCTCCCAGCAAGGTGGTCAAGAAGAACGTG
CTGCGTGGCAAGGGACAGAAGAAGAAGAAGGTCTCGCTGCGCTTCACTATCGACTGCACC
AACATTGCTGAGGATAGCATCATGGATGTGGCCGACTTCGTAAGTACATGGGGTACACAG
ATGATCACAAATCTCACCGCTCAGTACCAAGCACTGGTTACAATCTGTCGTTGCTTTCAA
GATGTTATGGGGGATGTATTGCCCATTAGTATCTTTCACTGTCTATGGTAAAAGTAGTAG
TGTGCCGTCTATAACTATAAATTGTTCTCCCAAAACATTTGAAAGCATTAACCAGATCGA
AATCTGTATAGTCTTACCGCACCAAGCTTTCCACTGCCCTCCAAGTTAACCAGGGGCTCT
GGATAAAAAGTTGTGGTTATAGTGAGTTCACTCCATTTTGCGATAAACTGCCAGCGGACT
TTCCCGTGCCGCCGGCGGTTAACAACTTCTGGAACAACGCTAAATGTAGATGATAGTCAT
AGGAAGGGTAGGTAGGTGTCCGTTCCGTTTTAAACCAAGTCGAATCTTTCGCTGCCTCAT
GCGGGCACACGCGTTTCTTCCCAGCGCCTTCCAATCGCGCTTGTAGTCAAGGGGCTCTGG
GCACTGCACAACGGGGTAGCCACTGACCGCCAGTGACCTGGCACTGGCCAGTGGTGCAAC
CGTCTGTGAACAGCGTCAAGCCGTGCTATGTGTACCGCCACGTGGTGGGCCCTGGGTTGA
GTGCGACCACATCCGTGGCGCCTCAGGCCAAAATTCATAGTGCGCCCTGCTCACAGTGCC
CGCTCTTCCGTGGCACTGCAGGTTTTCCCAACTTGTAGAAGTTAGAATTAGGTGCTTCTT
CCATATGCCAAGTGATAAGCCAACTGACTAAGTACCCGCTAGTGGGCAAACCGAGTGCGC
TAAACGCGCTTCTCAGCAGGGCGCTGAATAGTTCAAGTGTCGCCTACGTCACGGGATCAG
GTAACTACAATCTTATGCTGCATTCACAAACGGGGAATGGAACCACTGGGGGAAAGGTAC
ATAGTCGCATGCATGCGACTGAGTCATTTGACTGGAAACCCCCTTAAGAAGTTTCCTTTA
CTGGCACGCCGTCCGAAAAGTACCGCACCTATTGGTTCCATGGCCCCTTCATTGGTCATC
TATCACCTAGATAAATCTATTTTACAGGCCACGCCGATTTGCCGTCAGAGAGTGAGCTTT
ATGCGTCGCTCTGATGGCAGTGTACTCAGTGGCAGAGCAAAAAATTGGTCACTCTTCTTT
ATTTGGGCTCTCTGTTCTACCCACTCGACTCTTAGCCTTAACAAAGAAAGAGACATTTAG
CCCAGCTTACCGCTAGCAGGAGCTGCCCCAAAGATCCAGCCCAGTCCAAGCTGAACTAAC
CCGGAATACCCTCTCTATTCCGCCCGCAGGAGAAGTACATCAAGGCCCGCCTTAAGGTCA
ACGGCAAGGTGAACAACCTGGGCAACAACGTCACCTTCGAGCGCTCCAAGCTGAAGCTCA
TTGTCAGCTCCGACGTTCACTTTTCCAAGGCATACCTCAAGTACTTGACCAAGAAGTACC
TGAAGAAGAACAGTCTGCGCGACTGGATCCGTGTGGTGGCCAACGAAAAGGACTCGTACG
AGCTGCGCTACTTCAGAATCAGCTCCAACGACGATGAGGACGACGATGCCGAGTAAAGAT
GTAGCTGATCCCTTCAGTGGAATCACTAGGTTTACATTGGTTTTTATTATACATTTCACG
CCCTCAAGCGGCGTGTTTTTATAAGCTAACAGAAAGATGTGAACTCATGAAAAAAAGAAA
ACTTCGGGCTAGCCTCAATAAAACAATTGTGTGTGAACCTTACGACCCCCAAGTCATTTT
TATTGTTAGTACAAATCTATCTGGGAGAAAAGACCTATTCAATTTATTTCGCTTGAGAAG
ATGCGGCTATAATCATTGAAAACGATTTGCCTTCAAAGACATTTGGTTGTGGGCATGTAC
TTTATATATTTAGACATTTATCCAATCCAACAAATCCGATATCCCCGTCTCGCTTTTTTC
CGTGATCGGTTGGTGCTCTTTGTTGAAAGAGTGATGAATACTATTGAATACTATGTGCAT
AATTTAATTGTTTATATTATCTGGTCATCCACATAATGAACACTACTTGAAACTTAGAAA
GACGGAAAGTAGATTTATATAAAGCCAGTCAGTTGGATTGCATCCAATCGAATAATTAAG
ATGTATGGGGGGTGCTCTTGTCAGCTGTCTACTTTCAGGGCATCCGAGAGTTTACAGATT
TAACTAGCTGCAAATCGCAGTACGTTAGTCCGTCTGTGGTTACGAAAGCAGGGGGTCTAG
AATAGTCCGGACCACTGGTGTGCTCATCGTTATGCAAGCGGACCATTAACTAGTCAGCTT
CCCATTTCGTTTAGGCGTGTGCATCGTGGGCACCGGCCATGTGAAATGAAACTCATACGT
GGCGGGTGTTGTAGGTGTAGGCGAAAGCTTTTATTTTATTCAACAATTGAAGAGTGCAAC
AAATACGTTTGCTCACAGCAATACAAAAACAAGCAACAATTACGCTAACAAGTCTAGAAA
AATACACACTTTTAGTGGGAACTTACATTCAGGTTGTCTTTCTTCAGAAGGCTTTTGAGT
TGGGTTTGCACATAGGGCTATATAAATGTATATATATATATATATATGTATGTATGTAGT
TGCAGAGATATTCGAGCGTTTGCTTTGATTTCGAGCACACTGGGATGGGTCCGGGCCCGG
TTACGGTTACGGGGCCCATGCACACCGCAACAATCACAATTGAAGGCCAAATTGGAAAAG
GGGGCTTTTTGACTGGGAAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1056, 1218..1838, 3149..3580
1045..1056, 1218..1838, 3149..3415
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved