Drosophila_melanogaster Locus Arf79F
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster Arf79F
Drosophila_melanogaster
Arf79F
3L
snoRNA:Me28S-G764
3412..3489
5655
ACACGGACGCAAACAATAGAAGGCAGGTTTTGCAACAGGCCGTCTTCGCTGCTTAGATC
CCCCAGCGTGGGCACTCCGCTGACGTTGGACTGCATTTCCACGGCCACTCCAGAGGCGGG
CTTCTCCGCGTTGTTGAACAGCTGATACCGCTGCATTAACACCTTGCCTGTACCCAGGAA
AACCTTATTTGGGCTTTCGTACCGCTTGACCGTCCCGCGCTTGCATTTTCCATCCAGATC
TGCGTAGACATTGACGAGTTCCTCCCGCTCAGTGTTTGACTCCATAGCTAAAACACCGGG
GGCGTATATGTGGGCGCCTCGCAGTAGTGCAGCTCCGCAGTTAGTGTCAACCACTACCTC
CTTGAGCTCGGAGTCGGCCACAGCTTTGGTGAGCTGTGAGTCCAGCGGATCAATGCACAA
CATCTCGGGTAGGTTTGGCAAGCAGTAAATCCTTGGAGATTTTACACCGTAGCGAATGGC
GAGTTTTTCTTCTAACTTTTTCCGAAAGTCGTCAACGGAACACCTAAGAGTGTTCACCCT
GTAAGTGGTGACTTTGGGAGTAAGGCACAGCCATTCCAACAGCGGAGCAAGTGCAGCAGA
CTTGACAAAACCAGGAATTAACAGTTAATAAAATTTGCAAGCCAGTTTTTGTTGTAAATA
CGTATTTGTGCACATTGAAAGTACATACATTCACTTTAAGGATATCGGCTTCCAGCAACG
GGTTCACCAAAAATGGTGTTTTTGGGTAAAACATATTAACATTTAACTTAGTTCAAATCA
CCTGGATAGTGAACTTTATCGAGTGAGCATTGTGCGACAATGATGAATCGATTAATCCAA
ATCGTTGGCAACTCTAGCCGAGGTGGCGGAGAAGAGACGTGGCAGCATTTCCCGAGTTTT
CACCACGGGACTACACAACATCGGCATCCCGCTCTAGCTCATGCGCTGCGCCCATCTCTA
TCGGCAACGTTTATGTTGGTGAGTTTGCAGTTTTTTCAACAGCAAGTGTATTCTCGGTCA
AGTTTTATTTTGCTCTGTGATTTTAGACATTTCCAAGCAGAAGTTTTTAAAATTTCCGCT
CCTAGCCGTGTGCATTTGATTCAATTAGTTGGTGCGTATGCGTTTTCAGTCGAAAAAGGG
GGTGGTATGTCAAGGCAGAGATACTTTTCTTGATTTTAAGAAGTTCCGCAGTAATGTAGA
TGTTCGTGTGAGTGTTTAGTGTGGGCTATCCACGAACACTCGCGCAACGTACGCGGCTGT
GGTGAATAGTGGAAGTATTAGTATTGGAAGCCGCACGAATTAATCGTCGGTGCTTTGTTT
ATAGCATTATCGTAACAGGAGACAAGGACAAGCTCTCCTTTAATTACAAAAGTGATAGCT
AAATTATATAATTGGGAACATTTTACAATCTCTGTTCGGCAGACAATAGTGACTTGTGCT
CATCGACTATCGGTAGCGGATGCTATCGATACATTTCTCTCCATTATCTTTCTATTCGCA
ATTCGGTGTGTGGTGTGTTTGGCAGCATAGAAAATTCAATCAAAGAAAAGTCCACGAAAA
AAGGCAGAATAATCGGTAAATGGACGTGTAAAGTGTCACTGAGCTAAAAGGATCTCAGTT
AAAAGAAGTCCAAGTAACTTCGGACCGGTCTCTGTATTCTTGTAAAAACAAGGGACGGCG
GCAGCCGCATTTCACCAACCCATAAGAAAAACAGCGTACGTCACTCACACAGACGCAGGC
AACCACGTATAAAGTTCAAAGTTGTCTGATCCCGATCCGAAAGTGGGCTTAGTTGCGAAA
TGTCTGAACATGGGGCGTGGGCTGGCGAAGCGTTCATCTTCGAGCAGTGACGCCCTCCGC
CTGGAGCTTCTATTTAAACGCATTAAAGGCAGCAAAGGCAGGGCGGCTCAACGCAGTTGG
CAACCCTGGCGCCTGCGGGTGTATGCGTGAGTGTGCGGTGGTGGGCTGCCTCGCTTCCCT
CAGCGCTAAATTAAAAGCTGCTACGTGTAGTTTTCGATTTCGGCTGCTTCCAAGCCAACT
ATCGTCAGCTGGCATCAGCATCTTCTCAGTAACGTGGAGCACCTATCTTTGCGCACTACC
GGTCCGGAGAAGAAGTCTCTGGGGTGTTAGTTCCCTGTAACAAACTTAGGTTTTTGGATA
TCCGATTGCTGTCAAACGAAAGGTTTCCGTATGTTTCGCTGGCAACCTTTTTTCTTTTTG
TGTTCGTGCGAAACGGGCTTGCTCATTGCGTTCCTCCATTTTAACATGAATTGCTTAGCC
ATCGGTTGCAGCCTGCTCGGTTGCAGGGCTCAAAAGGCGGCAGCGGTGACTCACTGTAGA
GTTTGGGAGCTTCCCCTCCGCCCAGCAAGTTCGCCGAAAACTGCAAGTTACCTGGCCTTA
TCATTCACGCACTTCTCAGCCCGCACGTTTCTTGCGTACTCTGTGTAAAGTGGGTGGAGG
ACGTTGGAAGGGAGGCGCTGAGCGCCGACAGCCGTCATGGTTCTATACTAAAAATCGATA
TCTTATCAGCAGCCGCTAGCGGGGCAAACACTAAAAGCAAGCGACTCGTGTTTCATACAT
CCTCCATTTCGCGTTGTATTTAAGTGTGGAATTAATTACATAAACAAATTTTCTGTTTTT
CTCATGCTGACGCATTGAAGACGTCCTTATTACAATAAACAAAAACGAATTTCGTTTCTT
TTTCCGGTTTTTCCGCTCTTCCGGTTTTTGTATGACTCAGAGTGGGTAAGCGCCATTCAA
CACGTAAGCGCGATCATAAGTGAAACAAACACCAGAGGAGCTTCGGCGCATCCGTCCTTT
GTGATAGCTCTTCCTACCACGAAAAATTCTCGCCTACAACTGTCTATTTTTGGACTCTTC
ACAGATTCTCCCACTCCATGCACACAAGTGTGCAGTTTGCATATTCTGATCGGTATAGCA
ACTCGGATTTGAACTTGTCATAATTCCAGCCAGCAGACAGCGAGCAGGCCAACCAGAGAT
CCAACTTCCTACGACTACCGAGCATCCGAAAGACAAACAGCAGCCATGGGAAACGTATTC
GCGAACTTATTCAAAGGCCTATTCGGCAAAAAGGAAATGAGGATATTGATGGTCGGTTTG
GATGCCGCTGGTAAAACCACAATTCTGTACAAACTCAAATTAGGCGAAATTGTTACAACG
ATACCTACCATTGGTAAGTATCTTATTAGCACCTTTAATGTATCTTGTCCAAATCTAATA
TCTAATGGTTGTCCCCCTAGGTTTCAATGTGGAGACTGTAGAATACAAGAATATTAGCTT
TACAGTGTGGGATGTGGGTGGCCAAGACAAAATTCGTCCCCTGTGGAGGCACTACTTCCA
GAATACACAAGTAAGTGTGATTTCAGCTTTTCCACAGATTCCAGAAAATTCTATATGATG
TTAACAGCTTGTAATGATTATGCATTGTGATTATTCAAGTTTATTTTGTTTCAAGACGGG
ACTGACTATATTATCTTAGAGATCTATCTCCTACGATTCAAGCCAGGACAATTGGAATAA
AGTTTTCATTTGAATCGTTACAGGGTCTTATCTTCGTCGTGGACAGCAATGACCGAGAGC
GTATCGGTGAGGCGAGAGAGGAGTTGATGCGCATGCTGGCAGAGGACGAGCTGAGGGATG
CAGTCTTACTAATCTTCGCAAACAAACAGGTAGGTCCAAGCAAAGGTTGTCGTTATCAGT
AGCCAGTTGCTCGGTCCTTATATTGTCATACTAATATTGCACCTCGCTCTTTTCTGGGAT
CATTTTAGGATCTGCCAAATGCAATGAACGCGGCCGAAATCACCGACAAGCTCGGCTTGC
ACTCACTCAGAAACCGCAACTGGTACATCCAGGCGACGTGTGCAACTAGCGGTGATGGGC
TGTACGAGGGACTCGACTGGCTGTCCAACCAATTGAAGAACGCTAATCGCTAATTAAACA
CTAAAATTAAAGCAACAATATGAATACAACTAACTCTGATTTCAAGCGAGCCGAAGCAGT
TAACCAGCAACCAGAACCATAGAAAGAGCGGCTGAAGGACATCCAACATCCAGCGGTAAA
CGGTGGAAATCGACATCAGAAGGAATTTTCACAAAACAGCAGCAGCGGCACCAACACCAA
CAACAAGAGCAGCAGATCTTCGCATAACTTAAAGGGCTCCGCATGTCCGTATTTCCAAAC
AAGAAACTGAAATTGTTTATTGAATTGCAAAAACATAACCTTTCAAGCAGCATATAAAGA
ACGCTATAATATAATTTAAATTCGTATACATAATTATTGGATGTTTAAAAGCAAATCGAG
TAAAAGAAAAGCCCAACCAATCACACAAGAAAGGAAACTATAGTATATGGTATAAAAATG
TCTTTTTTAAGTTATTTTTGTCCTCTCCCTACCCCTCATCAAAATATATATTTCTTTTTA
ATTTTATAATATTAAAGTAATATTAATGAGAAAAAACTGTAATTGTAATTGCTCTTTAAA
AATACAACAAATACCATTTTAATTTTTAACCCTTCTGTTTCTTGTTGTCGCTTGGTCACG
CAAAATCCATTAAAAATCACGCATATATATAAGACCATATTAAAAAGGAAAGTACTACTT
AAAAGGTAATTTGAAATAAAATTTAAATATTAATGAAAACTACTGCGCTGTTCGATTTTT
GCACATGCGTTTCAAAAAGTCCGCGCAAAATCGTAACTGCCTATCGATACCCTGGTGCCA
TACACATCAGTTGCCTATCGAATTGTCTACACTACAATAATTTCGGAATTTAACGTTGAA
CAACACTCAGCGACCAATTGTCAGAAAAAATCGTCATTTTGTTTTATAAATTGGCAAAAG
ATTAAATAAAAGAAAGCACAGCATGTCCGCCAAGCAAAACCCAAAAAAGTTAAAGTGGGC
GCTGGACTTTAACGGGAGGTAAGGATTGCTAGCCTGCGCGGTGACTCAAGTTCTTACCAC
TTTTGCTTTTTCCTGCAGCAAAAATGCTGATATTCCTTCGCCGCTGGGCTACAATCCATC
TGCTTTGGTGAACCAGAGTGAAGTGGTGCGCGACCAGCGCCTGGTCATCAAGAAGTCGTG
GGACCTTGCCCTGGGACCTCTTAAGAACGTGAGTAGCAGCCCTTTGGAAAGACCCGTGCT
TAACCTTTGGATTCCCTCAGATTCCCATGAATCTATTCATCATGTACATGTCAGGAAACT
CGATTTCCATTTTTCCCATCATGATGGTCGGCATGATGCTGATCCGGCCTATCAAGGCCA
TCTTCACCACCCAGGTGACTTCCAAAATGGCGGAGGGGGCCCAGGGAACTGGCCAGCGCA
TCGTCTACTTCCTGGGCAACCTAGCAAACGTGGCTTTGGCCCTCTACAAGTGCCAGAGCA
TGGGGCTCCTCCCCACCCACGCCTCCGATTGGTTGGCATTTGTCCAGCCTCAGACACGCC
TGGAATATTACGGCGGAGGAATTTCGTTTGTCTAGTTTTACACATATAGATTCTCTTTAT
TTGATCATAGATAAATTGGTTTAAACTAAAATTGTGGTCTTATTCCGCCAGTCAGTCGTC
TAGTATCTTCTTGGCCTCCTTTTTGATGTCATCCACTAGTTTCTCGCCGGGCGATCTGTT
AAAGAAAATAGTAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1110, 2740..2819, 2884..3192, 3260..3369, 3563..3688, 3788..4655
3045..3192, 3260..3369, 3563..3688, 3788..3949
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved