Drosophila_melanogaster Locus CG3902
snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster CG3902
Drosophila_melanogaster
CG3902
3L
snoRNA:Psi28S-2566
2835..3102
7171
AGGCACTGCTTTATTGGCGGGCTCTCCGAAATTCACAATAATTGCACGAACGAGTCGTG
CGTTGTTTTCTCTGCTCGATTTCATTGTTTATGGGGCATAATATGTGGGGATGCCGGGCC
AAAAACGAAATTAATCACGAAAACGCACTCACCGTCGAAAAATCAACGAAAAGAAAGAAA
TTTGACAGATGGGTCGCGGTTAGGGATGGCAAAGAGGCAGTGCTGGAGGTGGTATTTCGT
AACGATAGTTAACGATGTTATCGGTTGTACTTGTCAGGGGTGAAGAGCATTGGATTCTAC
GTTTATAAATGGTTTTGATAGCTCATTTTCCTTCTTCTACGCTTATTTTTTTCCTATGAA
ATTGTTTAAATATTTACTGTTTTGTTTATGTCTTCCTGTAACTGTTTAATTTAATTCAGC
TAGTATCGATAACACTGTCATCTCTAAGTCGTGAACTGTCAAATTCAAAGCATGTGCTTT
GCAACACTTCAAGGGAGTGTGTCTTTGCTAAAATCGTGGTCTTGTTTTCACTGTTACAAT
TCAATATTTTCCAATTGGAAACCAGTTTAAATTTTTCCCAACTCGTGAAAAATAAAAATA
ATTTTAAATTTTCGTTAAACGTTTTTATTACGTTTTAAAAGCATATTTTTCACATGTCAA
CATACTGATAGTTATAATTTAATAACGGTTCTTAATACCTTTGTAAAAAATGAAATACAG
ATCAAGGATCTAACGAAAGGCCATTAATAAAGTAGATATGTAAGTAATATAAAAAATATA
GACAAATAGTTTTAATAGAATCAATAGCAATTCAGTGATTGAATTCATATTTTTACCAGC
GTTGAAGAAAGTTCAGTAACATCTGTTGATCATCCGCACTAACAGAATGTTACCGAAAAG
CTCAACGAAATACAGCCCGCTGTTAACTAACATGGCGCTTCGCCAACAGCAACAGGTTTC
CTATGGTCCACGATCCCCACATATGTGGAGAATGGAAATTCAGTCGCGTGTGAGCAGCCC
ACTTTTAACGTTGTGGTGTCTCTGGGGATCAGATCCAAAATTCAAAAAAGTCCAGTTTGG
CCTCTTGATTAAATCAATTCTTCCACTTCATTCAAGATGATGAACAGCCTAAAGAAATTG
CCCGTGCGCATGGTGAGTTGGCCACGCCCCCCTAACCGACACCTTTATACATACATATAT
GCCTACAACTAATTCCTTTTTCTTTATTAATTAACTTTTTAGCTGGCTAACGCTGCACGT
CAGCAAAGTGCTGCGATGTCCTCGGCAACTGGTCTCCCCCCACCCCTCACCTTTCTCACC
GACGATGAGAAAATGATGAAGGAGACTGGTGAGTATACCCTTTGGATCTAAATAGATCAT
AGTGTTAATGGTACTGTACACGGAGTTGTAGTCCCCATTTGATAGGCGTGTTTTTTCTCC
ATGTCGAATTTTTAGATATTTTTATGGTGTTTAGAACTTGCTTGGTGTTACGTAACACCA
AGCATCGCATTTTAATGATGCTCTTGTTATTTATTAATTTTCCATTGTGCTAACCAGCTG
AAGTCTTGCTGCACTACTATGTGTGTATTCGTATTTTTCGAGTTTTGTTCTTTTTTTTTT
CCTTTTTTGCTGATAAAGTTTATTCAGTTGAGGGAAACGCGGAGGAGGCCGCTTGCCAGA
TAAGCACATTTTTATTTTGATAGTAGAAGTAAAATGTCACTAAGTATTAGTGGGTAGGTT
TGTCCATTTTCTTTATGACGTTTGTATGTTTAAATATTACAAGATATACAATTTCCGATT
TGATCCTTATTGTAAAATGACGATCAACGATTATTACCTTATAATTAATTCCTTATTAAA
TTAATTTTTCTGGCGATTATTATATAATTTGTAATGATTAATCCCTTAAATTTTTTGTAG
TGTAATAAACCTAATATTTTTAAGGTAAATGAGGTCCTTGAATGTGTTTCTATGTTTATA
ATTTATTCCCTTTGGTGAAAAATATTTTTATCTATATAAAATAATTTTTAATAAAACTAT
TTCAGTATTTAATAATAGTATGCTTAAAAGTTACAAAATATTAATGATTCATCCCACTGA
GGTCCTTAGGTGACAATTTTGTTATGTACTGCCATAATAAGGTTAGCTCTTAAAAATCAT
ACGATTTCTTAAAGCTGGTTACATGCATGTTTAATGAATATAATTAAATTTAGAAAGTTA
CAAATAATATAATAATATAATATATATAATAATATTTCGAATATCGTGTTGTGTCAAATG
TGTTTAAAAGTGTTCACTTAAACTAAATGAATATATGTATTCTTAAAAAGTGCACAATTA
ATGGCCGAAGAGCTAAAGCTGCCAGCTTGGCAAGTTCAAGGTCTAACCTTATAACAAGCT
TTTTTCCCGATGGAAAAATTTTCCTCCCACCTGCTTAATTCTTTAAAAAATTATAATTAA
TTGATAATAATAATAATTTACCAGTGAGAAAACTTACCCAGGTGGGCTGAAGGAAAAAGG
GGTGGGCCCCGCACACACGCCCACCCTGCTCACACACACACACACGCGTGTTCTAAAAAT
AGCTTTTGCCCACCGCCAACGCTGAACATCGAGTTTCGTCGCTGATATTTCTCGGTTGGC
CGTGGTGTTCCTCGTTGAGCGGCCGGCACATAAAGAAAGCAATTTACCAAAGCGCGAGTT
CGAGCCCTCAAATTATAAGCCTCTCTCATCCAAGATCCTCTCATTTCCCCTCCCACAGAG
TACTGTTATTGCGTGCGCGGAATGTTTCTTATTAAACTTATATAGTGTCCTTAAGGATAT
CCTTTAACCACGAGTTTTCACAGGTCAGTCAGCTGTACGGTTCTGGTTTTAAACGTCAAC
CGAATAGCGTTACACCAGTGATAGAGCAATAAATGCGGCTGTGCCATTCCCCCTGTCCAC
CTGTGGCCACTGTTCTAGTGGCCACGCCGGGCAATCCGGGGCGTGGCACTTGGCCGGGCG
CCCTTCCCTAGAGAGTTGAATTACCTGAGTGGGGGGAGGACGACGACTTGTTGTTGTTGT
CCCCCTGCAAACCATCTAATTCCTAGTTGGGAAGGTTACATTTCCTTTTTATCACCGATC
ACCTTGTTTTTCCTCCATAATAATTAATAATCCTCGTCTCGCTTATCAGTCCCTCAACTG
GACTCAATCTATATGGCTTCCCATATATATACATATGTACATATGTATGTGTGTTACATA
CAAATAATTCTAAGTGGGAAAGTATGTGTCTATATGGCCTAACTGTTGCGTAATCTGAGC
TGAATGCAAAGTGGCTAAGTGCATGAAGTCAAACTGGTTTTTTTTTATATTTTTCAATCA
TATATCATAGGCTTTGGCACAGTTAACACATTTTAAATTAAATTATTACATTAAATTTTC
TGTTTTAATATGTATTTCAAAGTGCTTGATTTTTTAAGTAAGCTTTAAGTACGTAAAAGA
ATAGCAAACACACATTTACTCGAACGATTATTACCTTCAAGAACCAAGTACAGTTGCCCA
AAAAAAAAGCAAAATTTCAATTTCAGTCTATATCAGACTAAAGAAATGACCTGATTTTAT
TGAATTTCATATTTCCACTATAAGCCAAACTCCAAAAAGGACATGTAAAATTTACCATCA
AGCCCATTGGGACACGACACATCTGTTCGAAATTTTCCGACTGACCCCTGTCCATATGTT
GGAAAACTAAATGAATATATAAAGTTAGTTAATTATTTAAGCAATTCCCATGAAAAGTGA
GCGAAAGAAAGTATTTCCAAATGTGTGCAAAACGGCAGGAAAGTGATTGAAGAAGGGGCG
ACGGAGGTGTGGGAGCTTCTGTGGGTGTGTACCAGTTGGATTTCCAAGCAGAAAAACAGA
AACACAAAGTCAAGAAAAAAGAAAAAAATGCTTAAAAAAGATCAATAATAAATACGCTGA
GAGAATAATAGAACTGCCGAAAGAAGACAGCTGCGAGAGCCCCACGCGATCGTAGAATCT
AGTGATAAAAAACGAACACACGAAGACTTTTTATCTGAGAGACAAACGCGTGTAGAAAAA
TACATACCTCAACCTACACAAGCAAGAGATCAACAGCAAACATCGCGCCCCTTAGAAGAA
AAAGAACTCCAAAAAAAATAAAAATCAAAAAAGCTTAAGTTTTTACCTTTTTTCAAAAAC
GTGCAGTTAAAAGCTTATCGAAGCTTTACAAAAACTTTGACATTAAGCTCTTTCACCGAT
CGTTACATTCTATATCTACACATATACATATACACATATGAGTTATACTTAAGGTCTAGG
AATTCTTATGTGTTATAATATATTTAAAAAATAAAAAACCTATTTTAAATGTATCTAAAT
GTATGCAAGCATATTTGACGTATATGAGTTATTTCACATGTTTCATAAACCATGGAAACT
TTCCTTTAAACTTTCAGTTGCCAAACTGGCTCAGGAGCAGATCCAGCCCTTGGTGAAGAA
AATGGACTTTGAGCACAAATTCGATCCCTCCGTGGTGAAGGCGGTTTTCGAGAACGGCCT
GATGGGCATTGAGATCGACACCGAGCTGGGAGGCAGTGGCTGCAACTTCATGACCAACAT
CGTCGTGGTGGAGGAGCTGTCCAAAATCGATCCTGCCGTCGCCGCTTTTGTGGACATTCA
CAACACACTGGTCAACTCGCTGATGATCAAGTTCGGCAATGCCGAGCAGAAGGCGAAGTA
TCTGCCTAAGCTGGCCCAGGAGTACGCCGGTAGCTTCGCCCTGACCGAACCCGGTGCAGG
ATCCGATGCCTTCTCCCTGAAGACCGTCGCCAAGAAGGACGGCTCCCACTACGTAATCAA
CGGCTCCAAGATGTGGATCTCCAACTCTGATGTGGCGGGAGTCTTCCTGATCTTTGCCAA
TGCCAAGCCAGAGGATGTAAGTATATATTGTTTTAAAGCCATTTAAATTTAGAAATAAAT
CATATTTTTATTAGTTTTTTTTTCGATTATACCCCCTAGCTTCGTTTTCACTTTTTCGCA
GACCACTGAATGATTTCAAAATATTTTCCGTTGCTAATCTTTATGTTATTCCAACTGATT
GCCAACTAATCGCTCTCAGATCAAAGTTCACTTGATTGCAGTTCGTTAAATATTAAAATA
TGCAAATGAGTTTTCTTTTCAAATATAACGTTTGAGGAAACAAATTTCATATTCCAATTA
TTCGACTGCATAATATAAACTTTCTTCAATTATATTTTACTGAACAAAAAATCTGATTGC
GTAATTCTTTCAAACTAAAACCTTATCGTTATCTTGTTTTTTGCAGGGCTACCGTGGCAT
TACCACCTTCATTGTGGACCGTGAGACTCCCGGTCTGATCGTGAACAAGCCGGAGGACAA
GCTGGGCATCCGTGCCTCTGGAACCTGCCAGCTCACCTTCGACAACGTGCGTGTGCCCGA
GGAGAACATCCTGGGAACCTTCGGCCATGGCTACAAGTATGCCGCCGGCTTCCTGAACGA
GGGTCGCATCGGTATTGCTGCCCAGATGGTGGGCCTGGCCCAAGGAACCTTCGACGCGAC
CATTCCGTACCTGCTGGAGCGCAAGCAGTTCGGTGATGCCATCTATAACTTCCAGTCGAT
GCAGCATCAGATCGCCACCGTGGCCACGGAGATCGAGGCCGCCCGCCTGATGACCTACAA
TGCTGCACGTCTGCAGGAGCAGGGTGTGCCCTTCCAGAAGGAGGCGGCCATGGCCAAGTA
CTACGCCTCCGAGGTGGCCCAGAGGGCGGCGATCAAGTGCGTCGACTGGATGGGAGGCGT
TGGCTTCACCCGTGATTTCCCGCAGGAGAAGTACTACCGTGACGTGAAGATCGGAGCCAT
TTACGAGGGCACCACCAACATGCAGCTGAGCACCATTGCCAAGTGCATCAAGAAGGATTA
TGCGGCCTAAAGACTACCCCGATACTCCTCCTTCCCCCAACATATCCCCCACACAAGCTG
AGATATCGTACGTCAGATACGTCAAGTGCATTTATGCGTGGGAACCGCTGGAACAATTTT
GACGGCCATCCGTTATCGGTTCTCACCATGTTAACGTAGCATTTACCACTTAGTTGATTC
TGTTATGCATATTGTATAAAATACAATTAAAATATATACACATATAAAATTTAAATAAAA
CATATAGTTGTATAGTATGGTTAATTCACTAATGACTGCCTCCTCCATCCGTTGTGGTAA
ATGCGGCCAGCAGAATGTTGATCACTGTGATCATGAAAACTCCCATTACGAGCAGATCGT
TGGTTCTTTCGTAACTTCGGTTCCTAAATCGCTTGAGACGTCGCTGCGGAGATTTTTTAT
TTAGTGAATGGACTAATTGAAGCTCTACTCACATACTTTAAAGATCAGCATTATGCCAAC
TAAAAGCTGCAGCACCAGGGAAAGTATCACCATAATCATGCTGTATATGTACGTGGAAGC
CTTGTCGTTATAGGTGATCAGGAATCGCAACTGATTCGCATTCGCCGAAAGCAAAGCTAT
ATCCATTAGGCCTACAAAAAGTAGTTTGAATATCAGAGTTACAAGTTGTGGTTAGCGTTC
TTTAAACTTTAAGTATTGTAACTTTCGAATAGTGATTTGCATTACGTTCTTACCTTCAGC
TACATTTTTGTTGGCAGCATAGCTATTCTCTGTCGAAAGATCGCTGGAACATTTCTTGTT
CGATTTTTTGGATTCTTGTAATTCACTGGTGGCCCTGGATGGGAACTGGTCGTCTTTTAT
ATGGCTTTCATGCACCTGAATATCCAAATCCCTGCCAGAACCGCAACATGGTCCACTGGT
TGTACTGGCGAAACTTTCCCCGGAGCTGGGGGAATCCTCCAAAGATATTTTCACCTCGCC
GCTGTCCATTGTTCGAGTTCCAACCGATTAATAAGCATTTAAATGCTCTTCTTTTAAAAA
AATGCGAAAAGCTTTTCTTGTTTTTGAGCATGAAAGCCGCAACTGCGGTTTAGTAACTGA
TAAAAGGGAATGACACTGACCGAACTACCCTAAAAAAAAAAAAAAAAAACTGGGCCATAA
GCCGACCTGAAAAGTATCTGATGGGTTGAGATACGCACTAAGCATGTTTGCCTTAAAGTA
TGCTACACAATCTTATTTAAAATGAAGGTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1151, 1242..1347, 4457..4935, 5326..6171
1116..1151, 1242..1347, 4457..4935, 5326..5946
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved